ORIGINAL RESEARCH. Abstract

Size: px
Start display at page:

Download "ORIGINAL RESEARCH. Abstract"

Transcription

1 ORIGINAL RESEARCH Physiologicl Reports ISSN X Impct of periconceptionl nd preimplnttion undernutrition on fctors regulting myogenesis nd protein synthesis in muscle of singleton nd twin fetl sheep Shervi Lie 1, Jnn L. Morrison 1, Olivi Willims-Wyss 1,2, Ctherine M. Suter 3,4, Dvid T. Humphreys 3, Susn E. Oznne 5, Song Zhng 1, Severence M. McLughlin 1, Dvid O. Kleemnn 6, Simon K. Wlker 6, Clire T. Roerts 7 & I. Croline McMillen 1,8 1 Snsom Institute for Helth Reserch, School of Phrmcy nd Medicl Sciences, University of South Austrli, Adelide, South Austrli, Austrli 2 Discipline of Physiology, School of Medicl Sciences, University of Adelide, Adelide, South Austrli, Austrli 3 Victor Chng Crdic Reserch Institute, Drlinghurst, New South Wles, Austrli 4 Fculty of Medicine, University of New South Wles, Kensington, New South Wles, Austrli 5 Metolic Reserch Lortories, Institute of Metolic Science, Addenrooke s Hospitl, University of Cmridge, Cmridge, UK 6 South Austrlin Reserch nd Development Institute, Turretfield Reserch Centre, Rosedle, South Austrli, Austrli 7 Discipline of Ostetrics nd Gynecology, University of Adelide, Adelide, South Austrli, Austrli 8 The Chncellery, University of Newcstle, Newcstle, New South Wles, Austrli Keywords Emryo, fetus, nutrition, oocyte. Correspondence I. C. McMillen, The Chncellery, University of Newcstle, Cllghn, NSW 238, Austrli. Tel: Fx: E-mil: croline.mcmillen@newcstle.edu.u Funding Informtion This study ws supported y funding from the Austrlin Reserch Council (CMcM, CTR, nd SKW) nd the Ntionl Helth nd Medicl Reserch Council of Austrli (CMcM nd JLM). CTR is supported y Ntionl Helth nd Medicl Reserch Council Senior Reserch Fellowship (GNT12749). JLM ws supported y Fellowship from the South Austrlin Crdiovsculr Reserch Network, fellowships from the Hert Foundtion, nd the Ntionl Helth nd Medicl Reserch Council of Austrli. Received: 18 Mrch 215; Revised: 12 July 215; Accepted: 15 July 215 doi: /phy Physiol Rep, 3 (8), 215, e12495, doi: /phy Astrct In this study, we determined the effect of mternl undernutrition in the periconceptionl (PCUN: ~8 dys efore to 6 dys fter conception) nd preimplnttion (PIUN: 6 dys fter conception) periods on the mrna nd protein undnce of key fctors regulting myogenesis nd protein synthesis, nd on the reltionship etween the undnce of these fctors nd specific microrna expression in the qudriceps muscle of singleton nd twin fetl sheep t dys of gesttion. PCUN nd PIUN resulted in decrese in the protein undnce of MYF5, fctor which determines the myogenic linege, in singletons nd twins. Interestingly, there ws concomitnt increse in insulin-like growth fctor-1 mrna expression, decrese in the protein undnce of the myogenic inhiitor, myosttin (MSTN), nd n increse in the mrna nd protein undnce of the MSTN inhiitor, follisttin (FST), in the PCUN nd PIUN groups in oth singletons nd twins. These promyogenic chnges my compenste for the decrese in MYF5 protein undnce evoked y erly emryonic undernutrition. PCUN nd PIUN lso incresed the protein undnce of phosphorylted eukryotic trnsltion initition fctor inding protein 1 (EIF4EBP1; T7 nd S65) in fetl muscle in singletons nd twins. There ws significnt inverse reltionship etween the expression of mir-3-5p, mir-3d-5p, mir-27-3p, mir16-5p, nd mir-376 nd the protein undnce of mechnistic trget of rpmycin (MTOR), FST, or MYF5 in singletons or twins. In prticulr, the expression of mir-3-5p ws incresed nd MYF5 protein undnce ws decresed, in PCUN nd PIUN twins supporting the conclusion tht the impct of PCUN nd PIUN is predominntly on the emryo. ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. This is n open ccess rticle under the terms of the Cretive Commons Attriution License, which permits use, distriution nd reproduction in ny medium, provided the originl work is properly cited. 215 Vol. 3 Iss. 8 e12495 Pge 1

2 Erly Nutrition Progrms Muscle Development S. Lie et l. Introduction A series of epidemiologicl nd experimentl studies hve demonstrted tht exposure to poor mternl nutrition during oocyte, emryonic, or fetl development results in n incresed risk of poor metolic outcomes including insulin resistnce nd glucose intolernce in lter life (Joshi et l. 23; Grdner et l. 25; McMillen nd Roinson 25; Roseoom et l. 26; Kwong et l. 27). Interestingly, in the sheep, the impct of poor mternl nutrition round the time of conception on glucose tolernce is different in the offspring of singleton nd twin pregnncies in erly postntl life (Todd et l. 29). We hve recently reported tht exposure to mternl undernutrition efore nd during the first week fter conception (periconceptionl undernutrition; PCUN) resulted in decrese in the protein undnce of key insulin signling molecules in the skeletl muscle of singleton fetuses in lte gesttion (Lie et l. 214). In twin fetuses exposed to PCUN, however, there ws n increse in the protein undnce of key insulin signling molecules. Similrly, in singleton nd twin fetuses exposed to mternl undernutrition during the first week of pregnncy lone (i.e., preimplnttion undernutrition; PIUN), there ws n increse in the protein undnce of key insulin signling molecules in fetl skeletl muscle. These findings suggest tht in contrst to the PCUN singleton, tht in the PIUN singleton nd the PCUN nd PIUN twin, there is progrmming of n insulin-sensitive, rther thn n insulin-resistnt phenotype. We lso note tht neither PCUN nor PIUN resulted in ny chnges in ody weight or crown rump length in the lte gesttion sheep fetus (Lie et l. 214). The mechnisms y which exposure to undernutrition in erly development result in the emergence of insulin-resistnt or -sensitive phenotype in skeletl muscle my include progrmmed chnges in pthwys tht regulte myogenesis nd muscle growth nd differentition. It hs een demonstrted, for exmple, tht periconceptionl or erly gesttionl undernutrition in sheep resulted in decrese in the totl numer of muscle fiers nd ltered muscle fier composition, in singleton fetuses in lte gesttion (Quigley et l. 25; Costello et l. 28). A reduction in muscle fier numer could result from either decrese in myolst prolifertion nd differentition or decrese in protein synthesis in skeletl muscle during development, thus, decresing muscle mss tht cn led to insulin resistnce nd hyperglycemi in dult life. Insulin-like growth fctor 1 nd 2 (IGF1 nd IGF2) promote myogenic differentition through the insulin-like growth fctor 1 receptor (IGF1R) or insulin receptor to ctivte the mechnistic trget of rpmycin (MTOR) pthwy (Dun et l. 21) (Fig. 1). Activtion of MTOR, stimultes the relese nd ctivtion of the eukryotic trnsltion initition fctor 4E (EIF4E) from the eukryotic trnsltion initition fctor 4E inding protein 1 Figure 1. Moleculr signling pthwys regulting protein trnsltion, riosoml protein trnsltion, nd myogenesis. 215 Vol. 3 Iss. 8 e12495 Pge 2 ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society.

3 S. Lie et l. Erly Nutrition Progrms Muscle Development (EIF4EBP1), thus inititing protein trnsltion (Puse et l. 1994; Gingrs et l. 1998), nd ctivtes riosoml protein S6 kinse, 7 kd (RPS6KB) (Brown et l. 1995) nd riosoml protein S6 (RPS6) which plys role in the trnsltion of mrna encoding riosoml protein (Kwsome et l. 1998). Therefore, the MTOR/EIF4E nd MTOR/RPS6KB pthwys regulte skeletl muscle protein synthesis nd growth (Lng et l. 21). IGF2 lso inds to the insulin-like growth fctor 2 receptor (IGF2R), which results in the lysosoml degrdtion of IGF2 (Kornfeld 1992). Myosttin (MSTN) inhiits myolst prolifertion, differentition, nd protein synthesis through the downregultion of differentition-relted genes, such s myogenic differentition (MYOD), myogenin (MYOG), nd myogenic fctor 5 (MYF5) (Groet et l. 1997; McPherron nd Lee 1997; Lngley et l. 22). The inding of MSTN to its receptor, the ctivin A receptor, type IIB (ACVR2B), is inhiited y follisttin (FST) (Lee et l. 212), which locks the inhiitory effect of MSTN on myogenesis (Amthor et l. 24) (Fig. 1). In the perintl period, skeletl muscle is composed of myofiers expressing the myosin, hevy chin 8, skeletl muscle, perintl (MYH8) (Young et l. 1994). MicroRNAs hve een shown to ply mjor role in mediting the progrmming effects of exposure to poor mternl nutrition efore nd during gesttion (Herrer et l. 21; Guy et l. 211; Rottiers et l. 211). In our previous study, we demonstrted tht there were specific ptterns of the types nd direction of chnges in the expression of 22 mirs in skeletl muscle fter exposure to PCUN or PIUN nd tht there were cler differences in these ptterns etween singleton nd twin pregnncies (Lie et l. 214). A numer of these mirs hd identified trgets in the insulin signling pthwy, for exmple, mir-126-5p, mir-16-5p mir-126-5p, mir-21-5p, nd mir-369-3p (Lie et l. 214). Interestingly, numer of these mirs lso hd specific trgets in the IGF signling, myogenic, nd protein synthesis pthwys (s shown in Tle S1). In the current study, we hve therefore investigted the seprte effects of mternl undernutrition in the periconceptionl period (PCUN: for t lest 2 months efore nd 1 week fter conception) or the preimplnttion period (PIUN: for 1 week fter conception) on the mrna expression nd protein undnce of fctors involved in myogenesis nd protein synthesis in the skeletl muscle of the sheep fetus in singleton nd twin pregnncies. We hypothesized, sed on our findings on the undnce of insulin signling molecules in the fetl skeletl muscle of the PCUN nd PIUN groups, tht exposure to PCUN would result in lower undnce of myogenic fctors in singletons nd higher undnce of these fctors in the skeletl muscle of twins. We lso hypothesized tht exposure to PIUN would result in higher undnce of myogenic fctors in skeletl muscle in oth singleton nd twin fetuses. Finlly, we hypothesized tht there would e reltionship etween the level of expression of those cndidte mirs which were chnged fter exposure to either PCUN or PIUN (Lie et l. 214) nd the undnce of regultory fctors in the IGF, myogenic, nd protein synthesis pthwys in fetl skeletl muscle. Mterils nd Methods All procedures were pproved y The University of Adelide Animl Ethics Committee nd y the Primry Industries nd Resources South Austrli Animl Ethics Committee (Lie et l. 214; Willims-Wyss et l. 214). Nutritionl mngement South Austrlin Merino ewes were fed diet, which consisted of Lucerne chff nd pellets contining cerel hy, Lucerne hy, rley, ots, lmond shells, lupins, ot rn, lime, nd molsses (Johnsons & Sons Pty. Ltd., Kpund, SA, Austrli), s previously descried (Lie et l. 214; Willims-Wyss et l. 214). All ewes received 1% of nutritionl requirements to provide sufficient energy for the mintennce of nonpregnnt ewe s defined y the Agriculturl nd Food Reserch Council (Energy nd Protein Requirements of Ruminnts) in At the end of n cclimtiztion period, ewes were rndomly ssigned to one of three feeding regimes s previously descried (Lie et l. 214). The Control ewes (C) (n = 11) received 1% of the nutritionl requirements from dys prior to mting until 6 dys fter mting. Ewes in the PCUN group (n = 13) received 7% of the control llownce from dys prior to mting until 6 dys fter mting. All of the dietry components were reduced y n equl mount in the restricted diet. Ewes in the PIUN group (n = 9) received 7% of the control diet from mting until 6 dys fter mting. All of the dietry components were reduced y n equl mount in the restricted diet. From 7 dys fter conception, ll ewes were fed 1% of nutritionl requirements. Mting, fetl outcomes, nd postmortem Ewes were relesed in group every evening with rms of proven fertility tht were fitted with hrnesses nd mrker cryons. Ewes were individully housed the following morning nd the occurrence of mting ws confirmed y the presence of cryon mrk on the ewe s rump. The ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. 215 Vol. 3 Iss. 8 e12495 Pge 3

4 Erly Nutrition Progrms Muscle Development S. Lie et l. dy of mting ws defined s dy. Ewes were weighed weekly fter commencing the feeding regime until postmortem t dys of gesttion. The ody weight of the ewes in the PCUN group ws significntly lower compred to the ody weight of the Control nd PIUN groups during the preconceptionl period (Willims-Wyss et l. 214). Pregnncy nd fetl numer were estimted y ultrsound t 4 8 dys of gesttion nd the nutritionl intke for the ewes ws djusted for gesttionl ge nd fetl numer. All ewes crrying fetuses used in this study (n = 33) were humnely killed with n overdose of sodium pentoritone etween 135 nd 138 dys of gesttion nd the uteroplcentl unit ws delivered y hysterotomy. In four ewes crrying twin fetuses, fetl helth declined prior to postmortem nd/or twin fetus died within 24 h of the postmortem, in these instnces fetl tissues were not collected. Fetuses (Singleton: Controls n = 5, PCUN n = 8, PIUN n = 3; Twin: Controls n = 11, PCUN n = 8, PIUN n = 11) were weighed nd killed y decpittion. Crown rump length nd ody weight ws mesured nd smples were collected from the fetl qudriceps muscle (from the rectus femoris muscle undle eneth the perimysium) nd snp frozen in liquid nitrogen. Smples were then stored t 8 C for further moleculr nlyses. Detils of the numer of nimls included in the study for the rnge of nlyses re provided in Tle 1. Quntifiction of mrna expression RNA ws extrcted from ~7 mg of qudriceps muscle tissue from singleton nd twin fetuses (Tle 1) The reltive expression of mrna trnscripts of IGF1, IGF2, IGF1R, IGF2R, MTOR, RPS6KB, MSTN, FST, ACVR2B, MYOD, MYOG, MYF5, MYH8, nd the housekeeper gene peptidylprolylisomerse A (cyclophilin A; PPIA) ws mesured y quntittive rel time reverse trnscription PCR (qrt-pcr) using the Syr Green system in n ABI Prism 75 Sequence Detection System (Applied Biosystems, Foster City, CA), s previously descried (Lie et l. 214). Primer sequences were vlidted for use in the sheep in this study (Tle 2) or in prior studies (McLughlin et l. 27). The undnce of ech mrna trnscript ws mesured nd expression reltive to PPIA ws clculted using the comprtive threshold cycle (C t ) method (Q-gene qrt- PCR nlysis softwre). Quntifiction of protein undnce The protein undnce of IGF1R, IGF2R, MTOR, pmtor (S2448), pmtor (S2481), RPS6KB, prps6kb (T389), peif4ebp1 (T7), peif4ebp1 (S65), EIF4E, RPS6, prps6 (S ), MSTN, FST, ACVR2B, MYOD, MYOG, MYF5, nd MYH8 were determined using western lotting, s previously descried (Lie et l. 214). Briefly, qudriceps muscle smples (~2 mg) from singleton nd twin fetuses (Tle 1) were homogenized in lysis uffer nd protein content of the clrified extrcts ws quntified using icinchoninic cid protein ssy. Prior to western lot nlysis, smples (1 lg protein) were sujected to SDS-PAGE nd stined with Coomssie lue regent (Thermo Fisher Scientific, Rockford, IL) to ensure equl loding of the proteins. Equl volumes nd concentrtions of protein were sujected to SDS-PAGE. The memrnes were locked with 5% BSA in Tris-uffered sline with.1% Tween-2 (TBS-T) t room temperture for 1 h nd then incuted overnight with primry ntiody in TBS-T overnight t 4 C, ginst IGF1R, MTOR, pmtor (S2448), pmtor (S2481), RPS6KB, prps6kb (T389), peif4ebp1 (T7), peif4ebp1 (S65), EIF4E, RPS6, prps6 (S ) (1:1 dilution; Cell Signlling, Dnvers, MA), FST, MYH8 (1:2 dilution; Snt Cruz Biotechnology, Snt Cruz, CA), MYOD, MYOG, MYF5 (1:5 dilution; Epitomics, Burlingme, CA), MSTN, ACVR2B (1:5 dilution; Acm, Cmridge, UK), nd IGF2R (1:5 dilution; BD Trnsduction Lortories, Sn Jose, CA). Memrnes were wshed nd ound ntiody detected using nti-rit or nti-mouse (Cell Signlling) or nti-got (Merck Millipore, Billeric, Tle 1. Numer of nimls from ech tretment group in singleton nd twin pregnncies used in ech set of nlyses. Singletons Twins Ewes Fetl sheep mrna expression Protein undnce mir expression PCUN, periconceptionl undernutrition; PIUN, preimplnttion undernutrition. 215 Vol. 3 Iss. 8 e12495 Pge 4 ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society.

5 S. Lie et l. Erly Nutrition Progrms Muscle Development Tle 2. Primer sequences for qrt-pcr. Gene nme Sequence Accession no. PPIA F: 5 CCTGCTTTCACAGAATAATTCCA 3 BC15173 R: 5 CATTTGCCATGGACAAGATGCCA 3 MTOR F: 5 TGACCATCCTCTGCCAACAGTTCA 3 FJ R: 5 GCTGCATGGTCTGAACAAAGTGCT 3 RPS6KB F: 5 ACTCAGCTCTCAGTGAAAGTGCCA 3 NM_ R: 5 GGTGTTCGTGGGCTGCCAATAAAT 3 MSTN F: 5 TCGCCTGGAAACAGCTCCTAACAT 3 NM_19428 R: 5 ATCAGACTCCGTGGGCATGGTAAT 3 FST F: 5 TGCACTCCTCAAGGCCAGATGTAA 3 M63123 R: 5 ATTAGTCTGGTCCACCACGCATGT 3 ACVR2B F: 5 TGCCCACAGGGACTTTAAGAGCAA 3 AF R: 5 GAAAGGCGTCTCTCTGGAAGTTGA 3 MYF5 F: 5 ATGGCATGCCTGAATGTAACAGCC 3 AF R: 5 ATCCAGGTTGCTCTGAGTTGGTGA 3 MYOD F: 5 CTCAAACGCTGCACGTCTAGCAA 3 NM_ R: 5 GCCTTCGATATAGCGGATTGCGTT 3 MYOG F: 5 CTACAGATGCCCACAATCTGCACT 3 NM_ R: 5 TGGTATGGTTTCATCTGGGAAGGC 3 MYH8 F: 5 AACGTGGAGCAACTCTCACTGTCA 3 NM_ R: 5 TGGCCATGTCCTCGATCTTGTCAT 3 MA) horserdish peroxidse-conjugted secondry IgG ntiodies t room temperture for 1 h. Enhnced chemiluminescence regents SuperSignl â West Pico Chemiluminescent Sustrte (Thermo Fisher Scientific) nd ImgeQunt TM LAS 4 (GE Helthcre, Rydlmere, NSW, Austrli) ws used to detect the protein:ntiody complexes. AlphEseFC (Alph Innotech Corportion, Snt Clr, CA) were utilized to quntify specific nds of the trget proteins. Sttisticl nlyses mrna expression nd protein undnce All dt re presented s men SEM. Dt were nlyzed using the Sttisticl Pckge for the Socil Sciences Softwre (SPSS Inc., Chicgo, IL). Two-wy nlysis of vrince (ANOVA) ws used to determine the effects of mternl nutritionl tretment (PCUN, PIUN, or control) nd fetl numer (singleton or twin) on mrna expression nd protein undnce. When there ws n interction etween the effects of nutritionl tretment nd fetl numer, dt from singletons nd twins were split nd the effects of nutritionl tretment determined using one wy ANOVA. A Duncn s post hoc test ws used to determine the level of significnt difference etween men vlues. A proility level of 5% (P <.5) ws tken s significnt. Reltionship etween mir expression nd trget protein undnce We previously identified tht the expression of numer of cndidte mirs in fetl muscle ws significntly ltered y either PCUN nd/or PIUN (Lie et l. 214) using the following criteri: threshold for fold difference of expression of mirs etween the PCUN or PIUN tretment groups reltive to controls ws set t >1.5 or <.67 with threshold of >1 reds/million or t >1.2 or <.83 with threshold of >1, reds/million where the reltive stndrd devition ws <5% mong nimls within tretment group. Selected mirs sed on these criteri from dt mpped to the humn mirbse were then cross checked with the corresponding mirs mpped to the ovine mirbse. mirs were then selected s high confidence cndidtes. Using the stringent threshold criteri defined in the methods, we identified 22 mirs with ltered expression in either the PCUN or the PIUN groups reltive to controls (Lie et l. 214). In the present study, these cndidte mirs were nlyzed using Trgetscn to identify 8mer, 7mer-m8, or 7mer-1A mtches etween the seed sequence of the cndidte mirs within the 3 UTR of the puttive mrna trgets within the IGF signling, protein synthesis nd myogenic pthwys which re conserved cross species (Tle S1). The reltionship etween mir expression nd the mrna expression or protein undnce in muscle ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. 215 Vol. 3 Iss. 8 e12495 Pge 5

6 Erly Nutrition Progrms Muscle Development S. Lie et l. smples collected from the sme nimls ws determined using liner regression nlysis (SPSS Inc.). Results Impct of PCUN nd PIUN on mrna expression nd protein undnce of the insulin-like growth fctors in fetl skeletl muscle IGF1 mrna expression in fetl muscle ws higher (P <.1) in the PCUN nd PIUN groups compred to controls in oth singleton nd twin pregnncies (Fig. 2). There ws no effect of either PCUN or PIUN, however, on IGF2 mrna expression (Tle S2), or on the mrna expression or protein undnce of IGF1R nd IGF2R in fetl muscle in singletons or twins (Tles S2 nd S3). Impct of PCUN nd PIUN on mrna expression nd protein undnce of fctors regulting protein synthesis in fetl skeletl muscle Singletons The protein undnce, ut not mrna expression of MTOR ws lower (P <.1) in muscle in the singleton PCUN fetl sheep compred to controls (Fig. 3 nd Tle S2). There ws no difference, however, in the undnce of phosphorylted MTOR (t either S2448 or S2481) etween the PCUN, PIUN, nd control groups (Tle S3). The protein undnce of phosphorylted IGF1 mrna : PPIA Singleton nd twin Figure 2. IGF1 mrna expression in the periconceptionl undernutrition (PCUN) nd preimplnttion undernutrition (PIUN) groups compred to controls in singletons nd twins. Different lpheticl suscripts denote significnt differences etween tretment groups compred to controls. EIF4EBP1 (T7) (P <.5) nd phosphorylted EIF4EBP1(S65) (P <.1) in singleton fetl muscle ws higher, however, in oth the PCUN nd PIUN groups compred to controls (Fig. 3). The mrna expression, ut not the undnce of RPS6KB protein or the phosphorylted RPS6KB (T389) protein, ws incresed (P <.5) in the PIUN group compred to controls in singletons (Fig. 4 nd Tle S3).The protein undnce of phosphorylted RPS6 (S ) in fetl muscle ws higher (P <.1) in the PIUN group compred to controls in singletons (Fig. 4). Twins The protein undnce of MTOR in ech of the control (P <.5), PCUN (P <.1), nd PIUN (P <.5) groups ws higher in the skeletl muscle of twin compred to singleton fetuses (Fig. 3). There ws no difference in the mrna expression or protein undnce of MTOR or phosphorylted MTOR t S2448 nd S2481 (Tles S2 nd S3) in fetl muscle etween the PCUN, PIUN, nd control groups. The protein undnce of phosphorylted EIF4EBP1 (T7) (P <.5) nd phosphorylted EIF4EBP1 (S65) (P <.1) were ech higher in twin fetl muscle in the PCUN nd PIUN groups compred to controls (Fig. 3). The mrna expression, ut not protein undnce of RPS6KB, ws incresed (P <.5) in the PIUN group compred to controls in twins (Fig. 4 nd Tle S3). The protein undnce of phosphorylted RPS6KB (T389) ws higher (P <.1), wheres the protein undnce of phosphorylted RPS6 (S ), ws lower (P <.1) in the twin fetl muscle of the PIUN group compred to controls (Fig. 4). Impct of PCUN nd PIUN on mrna expression nd protein undnce of fctors regulting myogenesis in fetl skeletl muscle Singletons nd twins MSTN mrna expression ws higher (P <.5) in fetl muscle in PCUN singletons nd twins compred to controls, however, the protein undnce of MSTN ws lower in PCUN nd PIUN singleton (P <.1) nd twin (P <.1) fetuses compred to controls (Fig. 5). The mrna (P <.1) nd protein undnce (P <.1) of FST ws higher in fetl muscle in PCUN nd PIUN singleton nd twin fetuses compred to controls (Fig. 5). The mrna expression of MYOD ws higher (P <.1) in the PCUN nd PIUN groups, while the mrna expression of MYOG ws higher (P <.5) in the PIUN group compred to controls, in singleton nd twin fetuses (Fig. 6). 215 Vol. 3 Iss. 8 e12495 Pge 6 ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society.

7 S. Lie et l. Erly Nutrition Progrms Muscle Development MTOR protein undnce (Au 1 3 ) A Singleton MTOR protein undnce (Au 1 3 ) B Twin peif4ebp1(t7) protein undnce (Au) C Singleton nd twin peif4ebp1(s65) protein undnce (Au 1 2 ) D Singleton nd twin Figure 3. Protein undnce of mechnistic trget of rpmycin (MTOR) in (A) singletons nd (B) twins; protein undnce of phosphorylted EIF4EBP1 (T7) (C) nd phosphorylted EIF4EBP1 (S65) (D) in singletons nd twins in the periconceptionl undernutrition (PCUN) nd preimplnttion undernutrition (PIUN) groups compred to controls. Different lpheticl suscripts denote significnt differences etween tretment groups compred to controls. Immunolots re shown in Figure S1. There ws no difference, however, in the protein undnce of either MYOD or MYOG etween the PCUN, PIUN, or control groups in singletons or twins (Tle S3). The protein undnce of MYF5 in ech of the PCUN (P <.1), PIUN (P <.1), nd control (P <.1) groups ws lower in twins compred to the protein undnce of MYF5 in singletons (Fig. 6). MYF5 protein undnce, ut not mrna expression, ws lso lower in the fetl muscle of the PCUN nd PIUN groups compred to controls in singletons (P <.1) nd twins (P <.1) (Fig. 6 nd Tle S2). The protein undnce of MYH8 in control twins ws lso lower (P <.1) compred to control singletons (Fig. 7). In singleton fetuses, the protein undnce, ut not mrna expression of MYH8 ws lower (P <.5) in the PCUN group compred to controls (Fig. 7). In twins, however, the mrna expression of MYH8 ws higher (P <.5) in the PCUN group, while the protein undnce of MYH8 ws higher (P <.5) in the PIUN group compred to controls (Fig. 7). Reltionship etween expression of specific mirs nd the protein undnce of fctors regulting protein synthesis nd myogenesis Using Trgetscn softwre, we found tht 17 of the 22 mirs tht hd ltered expression in the fetl muscle of the PCUN or PIUN groups reltive to controls were predicted to regulte the protein undnce of key fctors within the protein synthesis or myogenic signling pthwys (Tle S1). ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. 215 Vol. 3 Iss. 8 e12495 Pge 7

8 Erly Nutrition Progrms Muscle Development S. Lie et l. RPS6KB mrna : PPIA A Singleton nd Twin prps6kb (T389) protein undnce (Au). B 25, 2, 15, 1, 5 Singleton prps6kb (T389) protein undnce (Au) D 25, 2, 15, 1, 5 Twin prps6(s ) protein undnce (Au) C prps6(s ) protein undnce (Au) E Figure 4. RPS6KB mrna expression in singletons nd twins in the PCUN nd PIUN groups compred to controls (A). Protein undnce of phosphorylted RPS6KB (T389) (B) nd phosphorylted RPS6 (S ) (C) in singletons in the PCUN nd PIUN groups compred to controls. Protein undnce of phosphorylted RPS6KB (T389) (D) nd phosphorylted RPS6 (S ) (E) in twins in the PCUN nd PIUN groups compred to controls. Different lpheticl suscripts denote significnt differences etween tretment groups compred to controls. Immunolots re shown in Supporting Figure S1. In singletons, there ws n inverse reltionship etween the expression of mir-3-5p (P <.5, R 2 =.53) or the +1 isomir of mir-3d-5p (P <.1, R 2 =.71) nd the protein undnce of MTOR; nd etween the +1 isomir of mir-16-5p nd the protein undnce of FST in fetl skeletl muscle (P <.5, R 2 =.59) (Tle 3). 215 Vol. 3 Iss. 8 e12495 Pge 8 ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society.

9 S. Lie et l. Erly Nutrition Progrms Muscle Development A.5 Singleton nd twin MSTN mrna : PPIA CONTROL PCUN PIUN B Singleton C Twin MSTN protein undnce (Au) 25, 2, 15, 1, 5 MSTN protein undnce (Au) 25, 2, 15, 1, 5 FST mrna : PPIA D Singleton nd twin FST protein undnce (Au) E 35, 3, 25, 2, 15, 1, 5 Singleton nd twin. Figure 5. MSTN mrna expression in singletons nd twins (A), protein undnce of myosttin (MSTN) in singletons (B) nd in twins (C), FST mrna expression in singletons nd twins (D), nd protein undnce of follisttin (FST) in singletons nd twins (E) in the periconceptionl undernutrition (PCUN) nd preimplnttion undernutrition (PIUN) groups compred to controls. Different lpheticl suscripts denote significnt differences etween tretment groups compred to controls. Immunolots re shown in Figure S1. In twins, there ws n inverse reltionship etween the expression of mir-3-5p (P <.1, R 2 =.84) or the +1 isomir of mir-376 (P <.5, R 2 =.54) nd the protein undnce of MYF5, s well s etween the expression of the +1 isomir of mir-27-3p nd the protein undnce of MTOR (P <.5, R 2 =.53) (Tle 3). ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. 215 Vol. 3 Iss. 8 e12495 Pge 9

10 Erly Nutrition Progrms Muscle Development S. Lie et l. MYOD mrna : PPIA A Singleton nd twin c MYOG mrna : PPIA B Singleton nd twin. C Singleton D Twin MYF5 protein undnce (Au 1 2 ) MYF5 protein undnce (Au 1 2 ) Figure 6. MYOD (A) nd MYOG (B) mrna expression in singletons nd twins nd protein undnce of MYF5 in singletons (C) nd in twins (D) in the PCUN nd PIUN groups compred to controls. Different lpheticl suscripts denote significnt differences etween tretment groups compred to controls in singletons nd twins. Immunolots re shown in Figure S1. Discussion We hve demonstrted tht mternl undernutrition during the periconceptionl nd/or preimplnttion periods results in significnt chnges in the mrna expression nd/or protein undnce of fctors regulting myogenesis nd protein synthesis in the fetl qudriceps muscle nd tht these effects re different in singletons nd twins in lte gesttion. We hve lso demonstrted tht in numer of instnces where PCUN or PIUN resulted in chnges in the undnce of specific molecules regulting protein synthesis nd myogenesis in skeletl muscle, there were significnt reltionships etween the undnce of these molecules nd the level of expression of specific mirs in the fetl muscle. Impct of PCUN nd PIUN on the mrna expression nd protein undnce of fctors regulting myogenesis The protein undnce of the myogenic inhiitor, MSTN, ws decresed in the PCUN nd PIUN groups in oth singleton nd twin pregnncies. Additionlly, the mrna expression nd protein undnce of the MSTN inhiitor, FST, ws incresed in the PCUN nd PIUN groups in singletons nd twins. Interestingly there ws n ssocited increse in the MYOD mrna expression in muscle in the PCUN nd PIUN fetl sheep nd n increse in the MYOG mrna expression in PIUN fetuses, lthough these chnges were not ssocited with n increse in MYOD nd MYOG protein undnce. The protein undnce of MYF5, fctor tht hs een 215 Vol. 3 Iss. 8 e12495 Pge 1 ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society.

11 S. Lie et l. Erly Nutrition Progrms Muscle Development 4 A Singleton C Twin 1 MYH8 mrna : PPIA MYH8 mrna : PPIA MYH8 protein undnce (Au 1 2 ) B MYH8 protein undnce (Au 1 2 ) D Figure 7. MYH8 mrna expression (A) nd protein undnce (B) in singletons nd MYH8 mrna expression (C) nd protein undnce (D) in twins in the periconceptionl undernutrition (PCUN) nd preimplnttion undernutrition (PIUN) groups compred to controls. Different lpheticl suscripts denote significnt differences etween tretment groups compred to controls. Immunolots re shown in Figure S1. shown to regulte determintion of the myogenic linege (Megeney nd Rudnicki 1995; Perry nd Rudnick 2), ws decresed, however, in the fetl muscle in PCUN nd PIUN singletons nd twins. It is possile tht the epigenetic profile of MYF5 ws ltered in response to poor nutrition during the periconceptionl or preimplnttion period, resulting in ltered mrna expression tht persist t lest into the lte gesttion. Consistent with this is the decrese in totl muscle fier numer tht hs een reported in singleton fetl sheep t 75 dys gesttion, following PCUN from 18 dys efore to 6 dys fter conception in sheep (Quigley et l. 25). However, nutritionl environment of these fetuses hs een normlized from 7 dys postconception. Therefore, the decrese in MSTN nd incresed FST my e compenstory response to decrese in MYF5 undnce evoked y the impct of poor mternl nutrition on the emryo in the period immeditely fter conception, which my result in no net effect of muscle mss, contrry to findings from previous studies (Quigley et l. 25; Costello et l. 28). These compenstory responses my e medited y n increse in protein trnsltion, discussed lter. Furthermore, MSTN nd FST re expressed in the emryo in different species including zerfish (Buer et l. 1998; Vinello et l. 23), mouse (Alno nd Smith 1994; McPherron et l. 1997), nd cttle (Kmdur et l. 1997; Yoshiok et l. 1998) nd MSTN ws recently shown to inhiit glucose uptke nd consumption in mice skeletl muscle cells (Chen et l. 21). It is therefore possile tht mternl nutrient restriction during oocyte mturtion nd/or the preimplnttion period results in the progrmming of n ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. 215 Vol. 3 Iss. 8 e12495 Pge 11

12 Erly Nutrition Progrms Muscle Development S. Lie et l. Tle 3. Reltionship etween the expression of cndidte mirs nd the protein undnce of the fctors regulting myogenesis nd protein synthesis in fetl skeletl muscle. microrna MTOR FST MYF5 hs-mir-3-5p y = 91x + 815,475 P <.5, R 2 =.53 Singletons only y = 8x + 49,361 P <.1, R 2 =.84 Twins only hs-mir-3d-5p (+1 isomir) y = 69x + 874,941 P <.1, R 2 =.71 Singletons only hs-mir-27-3p (+1 isomir) y = 88x + 884,865 P <.5, R 2 =.53 Twins only hs-mir-16-5p (+1 isomir) y = 8x + 44,255 P <.5, R 2 =.59 Singletons only hs-mir-376 (+1 isomir) y = 2x + 32,191 P <.5, R 2 =.54 Twins only hs denotes tht the dt were mpped to humn mirbse. MTOR, mechnistic trget of rpmycin; FST, follisttin. increse in energy production, gin ensuring survivl nd pproprite development of the skeletl muscle. Additionlly, MYF5 protein undnce ws lower in the skeletl muscle of twin compred to singleton fetuses which suggests tht there my lso e smller pool of cells destined for the myogenic cell linege resulting in lower myofier numer in twins. This my e mechnism initited in the twin emryo from conception or lterntively it my e response within the developing skeletl muscle to the lower nutritionl environment of twin pregnncy. In either instnce such response would ct to limit muscle mss nd hence fetl growth in the twin pregnncy (Alexnder et l. 1998; Joseph KS et l. 23). MYH8 undnce ws lower in the fetl muscle in PCUN singletons nd higher in PIUN twins. One possiility is tht in the PCUN singleton, the decrese in MYH8 is consequence of decrese in totl myofier numer due to the decrese in MYF5 undnce. In the PIUN groups, the decrese in MYF5 my e compensted for y the increse in EIF4EBP1 nd RPS6 phosphoryltion (s discussed lter) nd n ssocited increse in protein synthesis. Impct of PCUN nd PIUN on the mrna expression nd protein undnce of fctors regulting protein synthesis in fetl skeletl muscle There ws n increse in the mrna expression of IGF1, which my promote myogenic differentition (Dun et l. 21) nd/or protein synthesis through the ctivtion of MTOR (Puse et l. 1994; Gingrs et l. 1998) in the fetl muscle in the PCUN nd PIUN groups compred to controls. Despite the increse in IGF1 mrna, however, there ws no difference in the protein undnce of phosphorylted MTOR (S2448 nd S2481). The phosphoryltion of EIF4EBP1 t T7 nd S65, however, ws incresed in fetl muscle in the PCUN nd PIUN groups in oth singletons nd twins. This increse in EIF4EBP1 phosphoryltion nd the ssocited increse in the relese of EIF4E from EIF4EBP1 my result in incresed protein synthesis initition (Puse et l. 1994; Gingrs et l. 1998). One possiility is tht PCUN nd PIUN ct to lter the undnce nd/or ctivtion of kinses known to regulte the phosphoryltion of EIF4EBP1, nmely cyclin-dependent kinse 1 (CDK1), protein kinse C, lph (PRKCA), or clcium/ clmodulin-dependent protein kinse kinse2, et (CAMKK2) (Pons et l. 212). We lso found tht in singletons, there ws no chnge in the protein undnce of phosphorylted RPS6KB (T389), ut n increse in the protein undnce of phosphorylted RPS6 (S ) in the PIUN group. In twins, however, there ws n increse in the protein undnce of phosphorylted RPS6KB (T389), ut prdoxicl decrese in the protein undnce of phosphorylted RPS6 (S ), lso in the PIUN group. RPS6KB hs een shown to regulte the phosphoryltion of RPS6 (Kwsome et l. 1998), therefore there is n pprent disconnect etween the ctivtion of RPS6KB nd the phosphoryltion of RPS6 (S235 nd S236). More recent studies, however, hve shown tht RPS6KB is dispensle for the phosphoryltion of RPS6 t S235 nd S236 (Roux et l. 27), nd tht the RAS/ 215 Vol. 3 Iss. 8 e12495 Pge 12 ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society.

13 S. Lie et l. Erly Nutrition Progrms Muscle Development extrcellulr signl-regulted kinses (ERK) pthwy is crucil for the phosphoryltion of RPS6 t S235 nd S236 through the ctivtion of riosoml protein S6 kinse, 9 kd (RPS6KBA) (Pende et l. 24; Roux et l. 27). Therefore, PIUN my lter the RAS/ERK pthwy differently in singletons nd twins, which my explin the chnges present in the phosphoryltion of RPS6 (S235 nd S236) in this study. Role of specific mirs in regulting the undnce of key fctors in muscle growth nd development in fetl skeletl muscle In previous study, we identified 22 mirs with ltered expression in skeletl muscle in the PCUN nd PIUN groups (Lie et l. 214). In this study, we hve shown tht 17 of the 22 mirs were predicted to regulte the protein undnce of key fctors regulting myogenesis nd protein synthesis (Tle S1). We lso found tht the expression of five mirs ws significntly relted to the undnce of three key proteins tht regulte protein synthesis nd myogenesis (Tle 3). In prticulr, the expression of mir-3-5p ws incresed nd the undnce of MYF5 ws decresed in PCUN nd PIUN twins which my support the conclusion tht the impct of PCUN nd PIUN is predominntly on the emryo in the period immeditely post conception (Tle S1). A numer of the mirs which we identified in our previous study hve ltered expression in response to PCUN or PIUN (Lie et l. 214). These include mir-126-5p, mir-3-5p, nd mir-3d (Guy et l. 211), s well s mir-27, mir-21, mir-26 (Herrer et l. 21), nd let- 7 fmily (Frost nd Olson 211), ech of which is ltered in the sttes of insulin resistnce, glucose intolernce, nd/or type-2 dietes in dult life. Also, it is interesting tht in our model, PIUN resulted in incresed expression of mir-26 in twin fetl skeletl muscle. mir-26 hs een shown to hve negtive correltion with dily physicl ctivity nd my contriute to chronic ostructive pulmonry disese ssocited skeletl muscle dysfunction (Lewis et l. 28) nd its expression is decresed in mouse model of Duchenne musculr dystrophy (McCrthy et l. 27). In summry, in oth singletons nd twins, PCUN nd PIUN result in n incresed IGF1 mrna expression nd decrese in the undnce of MSTN protein nd n increse in the MSTN inhiitor, FST mrna, nd protein in fetl skeletl muscle. We suggest tht these chnges re in response to the decrese in the protein undnce of MYF5 in singletons nd twins in the PCUN nd PIUN groups (Quigley et l. 25; Costello et l. 28), nd tht this my e the dominnt contriutor to the decrese in totl myofier numer nd to the emergence of whole ody insulin resistnce in postntl life. PCUN nd PIUN lso incresed the undnce of phosphorylted EIF4EBP1 (T7 nd S65) in oth singletons nd twins, which my result in n increse in protein synthesis, perhps s compenstory response to mintin skeletl muscle mss prticulrly when fetl nutrition is dequte. Interestingly, PIUN resulted in n increse in phosphorylted RPS6 (S ) in singletons, ut decrese in PIUN twins, independent of RPS6KB ctivtion. Therefore, PIUN my lter other pthwys, nmely the RAS/ERK pthwy, to ply role in regulting mitochondril iogenesis nd thus protein synthesis in skeletl muscle. We hve previously reported tht PCUN decresed the undnce of key insulin signling molecules in fetl muscle in singletons, while PIUN in singletons s well s PCUN nd PIUN in twins resulted in n incresed undnce of different suset of insulin signling molecules in skeletl muscle (Lie et l. 214). Therefore, decresed myogenesis coupled with decrese in key insulin signling molecules in PCUN singleton fetuses my result in the incresed risk of insulin resistnce nd impired glucose uptke which occurs in response to PCUN in lter life. In singletons exposed to PIUN nd in twins exposed to PCUN nd PIUN, however, the potentil decrese in myogenesis my e compensted for y n incresed protein synthesis which my mintin muscle mss in these groups. We hve lso shown tht PCUN nd/or PIUN result in ltered expression of specific mirs tht regulte myogenesis nd protein synthesis, which suggest tht the impct of PCUN nd PIUN is predominntly on the emryo during erly emryogenesis. Findings from this study provides evidence tht poor mternl nutrition during the periconceptionl period lone is sufficient to result in progrmmed chnges in the key fctors known to regulte muscle growth nd development, nd thus highlights the importnce of dequte mternl nutrition efore nd during erly emryonic development. However, the impct of these chnges in postntl life nd thus their contriution to metolic dysfunction, nmely insulin resistnce nd glucose intolernce, will require further investigtion. Acknowledgments We cknowledge the reserch ssistnce provided y Anne Jurisevic, Lur O Crroll, nd Andrew Snell during the course of this study. Conflict of Interest None declred. ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. 215 Vol. 3 Iss. 8 e12495 Pge 13

14 Erly Nutrition Progrms Muscle Development S. Lie et l. References Alno, R. M., nd J. C. Smith Follisttin expression in ES nd F9 cells nd in preimplnttion mouse emryos. Int. J. Dev. Biol. 38: Alexnder, G. R., M. Kogn, J. Mrtin, nd E. Ppiernik Wht re the fetl growth ptterns of singletons, twins, nd triplets in the United Sttes? Clin. Ostet. Gynecol. 41: Amthor, H., G. Nichols, I. McKinnell, C. F. Kemp, M. Shrm, R. Kmdur, et l. 24. Follisttin complexes Myosttin nd ntgonises Myosttin-medited inhiition of myogenesis. Dev. Biol. 27:19 3. Buer, H., A. Meier, M. Hild, S. Stchel, A. Economides, D. Hzelett, et l Follisttin nd noggin re excluded from the zerfish orgnizer. Dev. Biol. 24: Brown,E.J.,P.A.Bel,C.T.Keith,J.Chen,T.B. Shin, nd S. L. Schreier Control of P7 S6 kinse y kinse-ctivity of FRAP in-vivo. Nture 377: Chen, Y., J. Ye, L. Co, Y. Zhng, W. Xi, nd D. Zhu. 21. Myosttin regultes glucose metolism vi the AMPctivted protein kinse pthwy in skeletl muscle cells. Int. J. Biochem. Cell Biol. 42: Costello, P. M., A. Rowlerson, N. A. Astmn, F. E. W. Anthony, A. A. Syer, C. Cooper, et l. 28. Periimplnttion nd lte gesttion mternl undernutrition differentilly ffect fetl sheep skeletl muscle development. J. Physiol. 586: Dun, C., H. Ren, nd S. Go. 21. Insulin-like growth fctors (IGFs), IGF receptors, nd IGF-inding proteins: roles in skeletl muscle growth nd differentition. Gen. Comp. Endocrinol. 167: Frost, R. J. A., nd E. N. Olson Control of glucose homeostsis nd insulin sensitivity y the Let-7 fmily of micrornas. Proc. Ntl Acd. Sci. USA 18: Grdner, D. S., K. Tingey, B. W. M. Vn Bon, S. E. Oznne, V. Wilson, J. Dndre, et l. 25. Progrmming of glucoseinsulin metolism in dult sheep fter mternl undernutrition. Am. J. Physiol. Regul. Integr. Comp. Physiol. 289:R947 R954. Gingrs, A. C., S. G. Kennedy, M. A. O Lery, N. Sonenerg, nd N. Hy E-BP1, repressor of mrna trnsltion, is phosphorylted nd inctivted y the Akt (PKB) signling pthwy. Genes Dev. 12: Groet, L., L. J. Mrtin, D. Poncelet, D. Pirottin, B. Brouwers, J. Riquet, et l A deletion in the ovine myosttin gene cuses the doule-muscled phenotype in cttle. Nt. Genet. 17: Guy, C., E. Roggli, V. Nesc, C. Jcovetti, nd R. Regzzi Dietes mellitus, microrna-relted disese? Trnsl. Res. 157: Herrer, B., H. Lockstone, J. Tylor, M. Ri, A. Brrett, S. Collins, et l. 21. Glol microrna expression profiles in insulin trget tissues in spontneous rt model of type 2 dietes. Dietologi 53: Joseph, K. S., S. Liu, K. Demissie, S. Wen, R. Pltt, C. Annth, S. Dzkpsu, R. Suve, A. Allen, nd M. Krmer; the Fetl Infnt Helth Study Group of the Cndin Perintl Surveillnce System. 23. A prsimonious explntion for intersecting perintl mortlity curves: understnding the effect of plurlity nd of prity. BMC Pregnncy Childirth 3:3. Joshi, S., V. Grole, M. Dwre, S. Girigosvi, nd S. Ro. 23. Mternl protein restrction efore pregnncy ffects vitl orgns of offspring in wistr rts. Metolism 52: Kmdur, R., M. Shrm, T. P. Smith, nd J. J. Bss Muttions in myosttin (GDF8) in doule-muscled Belgin Blue nd Piedmontese cttle. Genome Res. 7: Kwsome, H., P. Ppst, S. We, G. M. Keller, G. L. Johnson, E. W. Gelfnd, et l Trgeted disruption of p7s6k defines its role in protein synthesis nd rpmycin sensitivity. Proc. Ntl Acd. Sci. USA 95: Kornfeld, S Structure nd function of the mnnose 6- phosphte/insulinlike growth fctor II receptors. Annu. Rev. Biochem. 61: Kwong, W. Y., D. J. Miller, A. P. Wilkins, M. S. Der, J. N. Wright, C. Osmond, et l. 27. Mternl low protein diet restricted to the preimplnttion period induces genderspecific chnge on heptic gene expression in rt fetuses. Mol. Reprod. Dev. 74:52 6. Lng, C. H., R. A. Frost, S. K. Bronson, C. J. Lynch, nd T. C. Vry. 21. Skeletl muscle protein lnce in mtor heterozygous mice in response to inflmmtion nd leucine. Am. J. Physiol. Endocrinol. Met. 298:E1283 E1294. Lngley, B., M. Thoms, A. Bishop, M. Shrm, S. Gilmour, nd R. Kmdur. 22. Myosttin inhiits myolst differentition y down-regulting MyoD expression. J. Biol. Chem. 277: Lee, S.-J., T. V. Huynh, Y.-S. Lee, S. M. Seld, S. A. Wilcox- Adelmn, N. Iwmori, et l Role of stellite cells versus myofiers in muscle hypertrophy induced y inhiition of the myosttin/ctivin signling pthwy. Proc. Ntl Acd. Sci. USA 19:E2353 E236. Lewis, A., J. Riddoch-Contrers, S. A. Ntnek, A. Donldson, W. D. C. Mn, J. Moxhm, et l. 28. Downregultion of the serum response fctor/mir-1 xis in the qudriceps of ptients with COPD. Thorx 67: Lie, S., J. L. Morrison, O. Willims-Wyss, C. M. Suter, D. T. Humphreys, S. E. Oznne, et l Periconceptionl undernutrition progrms chnges in insulin signling molecules nd micrornas in skeletl muscle in singleton nd twin fetl sheep. Biol. Reprod. 9:5, 1 1. McLughlin, S. M., S. K. Wlker, D. O. Kleemnn, J. P. Sions, D. N. Tosh, S. Gentili, et l. 27. Impct of periconceptionl undernutrition on drenl growth nd drenl insulin-like growth fctor nd steroidogenic enzyme 215 Vol. 3 Iss. 8 e12495 Pge 14 ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society.

15 S. Lie et l. Erly Nutrition Progrms Muscle Development expression in the sheep fetus during erly pregnncy. Endocrinology 148: McCrthy, J. J., K. A. Esser, nd F. H. Andrde. 27. MicroRNA-26 is overexpressed in the diphrgm ut not the hindlim muscle of mdx mouse. Am. J. Physiol. Cell Physiol. 293:C451 C457. McMillen, I. C., nd J. S. Roinson. 25. Developmentl origins of the metolic syndrome: prediction, plsticity, nd progrmming. Physiol. Rev. 85: McPherron, A. C., nd S.-J. Lee Doule muscling in cttle due to muttions in the myosttin gene. Proc. Ntl Acd. Sci. USA 94: McPherron, A. C., A. M. Lwler, nd S. J. Lee Regultion of skeletl muscle mss in mice y new TGFet superfmily memer. Nture 387:83 9. Megeney, L. A., nd M. A. Rudnicki Determintion versus differentition nd the MyoD fmily of trnscription fctors. Biochem. Cell Biol. 73: Puse, A., G. J. Belshm, A.-C. Gingrs, O. Donze, T.-A. Lin, J. C. Lwrence, et l Insulin-dependent stimultion of protein synthesis y phosphoryltion of regultor of 5 -cp function. Nture 371: Pende, M., S. H. Um, V. Mieulet, M. Sticker, V. L. Goss, J. Mestn, et l. 24. S6K1( / )/S6K2( / ) mice exhiit perintl lethlity nd rpmycin-sensitive 5 -terminl oligopyrimidine mrna trnsltion nd revel mitogenctivted protein kinse-dependent S6 kinse pthwy. Mol. Cell. Biol. 24: Perry, R. L., nd M. A. Rudnick. 2. Moleculr mechnisms regulting myogenic determintion nd differentition. Front Biosci. 5:D75 D767. Pons, B., G. Armengol, M. Livingstone, L. Lopez, L. Coch, N. Sonenerg, et l Assocition etween LRRK2 nd 4E- BP1 protein levels in norml nd mlignnt cells. Oncol. Rep. 27: Quigley, S. P., D. O. Kleemnn, M. A. Kkr, J. A. Owens, G. S. Nttrss, S. Mddocks, et l. 25. Myogenesis in sheep is ltered y mternl feed intke during the peri-conception period. Anim. Reprod. Sci. 87: Roseoom, T., S. de Rooij, nd R. Pinter. 26. The Dutch fmine nd its long-term consequences for dult helth. Erly Hum. Dev. 82: Rottiers, V., S. H. Njfi-Shoushtri, F. Kristo, S. Gurumurthy, L. Zhong, Y. Li, et l MicroRNAs in metolism nd metolic diseses. Cold Spring Hr. Symp. Qunt. Biol. 76: Roux, P. P., D. Shhzin, H. Vu, M. K. Holz, M. S. Cohen, J. Tunton, et l. 27. RAS/ERK signling promotes sitespecific riosoml protein S6 phosphoryltion vi RSK nd stimultes cp-dependent trnsltion. J. Biol. Chem. 282: Todd, S. E., M. H. Oliver, A. L. Jquiery, F. H. Bloomfield, nd J. E. Hrding. 29. Periconceptionl undernutrition of ewes impirs glucose tolernce in their dult offspring. Peditr. Res. 65: Vinello, S., L. Brzzoduro, L. Dll Vlle, P. Belvedere, nd L. Colomo. 23. Myosttin expression during development nd chronic stress in zerfish (Dnio rerio). J. Endocrinol. 176: Willims-Wyss, O., S. Zhng, S. M. McLughlin, D. Kleemnn, S. K. Wlker, C. M. Suter, et l Emryo numer nd periconceptionl undernutrition in the sheep hve differentil effects on drenl epigenotype, growth, nd development. Am. J. Physiol. Endocrinol. Met. 37:E141 E15. Yoshiok, K., M. Tkt, T. Tniguchi, H. Ymnk, nd K. Sekikw Differentil expression of ctivin suunits, ctivin receptors nd follisttin genes in ovine oocytes nd preimplnttion emryos. Reprod. Fertil. Dev. 1: Young, R. B., M. Y. Hsieh, J. R. Hudson, H. E. Richter, nd M. Scott Expression pttern nd prtil sequence nlysis of fetl ovine myosin hevy-chin gene. J. Anim. Sci. 72: Supporting Informtion Additionl Supporting Informtion my e found in the online version of this rticle: Figure S1. Immunolots of proteins regulting skeletl muscle growth nd development in singletons nd twins in fetl skeletl muscle. Tle S1. Impct of PCUN nd PIUN on the expression of cndidte mirs in singletons nd twins in fetl skeletl muscle (Lie et l. 214) nd the predicted trget proteins within the myogenesis nd protein synthesis pthwyin fetl skeletl muscle. Tle S2. Impct of PCUN nd PIUN on mrna expression of fctors regulting skeletl muscle growth nd development in singletons nd twins in fetl skeletl muscle. Tle S3. Impct of PCUN nd PIUN on protein undnce of fctors regulting skeletl muscle growth nd development in singletons nd twins in fetl skeletl muscle. ª 215 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. 215 Vol. 3 Iss. 8 e12495 Pge 15

EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE

EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.

More information

Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens

Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.

More information

* * * * * liver kidney ileum. Supplementary Fig.S1

* * * * * liver kidney ileum. Supplementary Fig.S1 Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION . Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,

More information

Expression of Three Cell Cycle Inhibitors during Development of Adipose Tissue

Expression of Three Cell Cycle Inhibitors during Development of Adipose Tissue Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy

More information

The Journal of Physiology

The Journal of Physiology J Physiol 595.13 (2017) pp 4379 4398 4379 Impct of perintl exposure to sucrose or high fructose corn syrup (HFCS-55) on diposity nd heptic lipid composition in rt offspring Crl R. Toop 1, Beverly S. Muhlhusler

More information

Effects of physical exercise on working memory and prefrontal cortex function in post-stroke patients

Effects of physical exercise on working memory and prefrontal cortex function in post-stroke patients Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei

More information

Effect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats

Effect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry

More information

Bioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM

Bioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms

More information

Abstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions

Abstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,

More information

Effect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1

Effect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1 Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5

More information

Effects of Recombinant Bovine Somatotropin Administration at Breeding on the Cow, Conceptus and Subsequent Offspring Performance of Beef Cattle

Effects of Recombinant Bovine Somatotropin Administration at Breeding on the Cow, Conceptus and Subsequent Offspring Performance of Beef Cattle Effects of Recominnt Bovine Somtotropin Administrtion t Breeding on the Cow, Conceptus nd Susequent Offspring Performnce of Beef Cttle V. R. G. Mercdnte 1, F. M. Cirico 1, D. D. Henry 1, P. L. P. Fontes

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+

More information

Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons

Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI

More information

Fetal programming of coronary heart disease

Fetal programming of coronary heart disease 364 Review Fetl progrmming of coronry hert disese Dvid J.P. Brker People who develop coronry hert disese grow differently from other people both in utero nd during childhood. Slow growth during fetl life

More information

DOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion

More information

Chapter 5: The peripheral nervous system Learning activity suggested answers

Chapter 5: The peripheral nervous system Learning activity suggested answers Chpter 5: The peripherl nervous system Lerning ctivity suggested nswers Lerning Activity 5.1 (p. 222) 1 Briefly descrie the two min functions of the somtic nervous system. Description should refer to:

More information

The effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat

The effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.

More information

PNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :

PNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 : PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged

More information

Irs-2 coordinates Igf-1 receptor-mediated β-cell development and peripheral insulin signalling

Irs-2 coordinates Igf-1 receptor-mediated β-cell development and peripheral insulin signalling Irs-2 coordintes Igf-1 receptor-medited β-cell development nd peripherl insulin signlling Dominic J. Withers 1,2 *, Deorh J. Burks 1 *, Hether H. Towery 1, Shri L. Altmuro 1, Crrie L. Flint 1 & Morris

More information

Differential effects of prenatal stress and glucocorticoid administration on postnatal growth and glucose metabolism in rats

Differential effects of prenatal stress and glucocorticoid administration on postnatal growth and glucose metabolism in rats 319 Differentil effects of prentl stress nd glucocorticoid dministrtion on postntl growth nd glucose metolism in rts K L Frnko, A J Forhed nd A L Fowden Deprtment of Physiology, Development nd Neuroscience,

More information

*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU

*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:

More information

Bright Futures Medical Screening Reference Table 2 to 5 Day (First Week) Visit

Bright Futures Medical Screening Reference Table 2 to 5 Day (First Week) Visit Bright Futures Medicl Reference Tle 2 to 5 Dy (First Week) Visit Universl Action Metolic nd Verify documenttion of neworn metolic screening results, pproprite rescreening, nd needed follow-up. Document

More information

The effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1

The effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1 The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce

More information

Introduction. Lance Baumgard. Introduction con t. Research Emphasis at AZ. Teaching and Advising. Research Emphasis at ISU 4/29/2010

Introduction. Lance Baumgard. Introduction con t. Research Emphasis at AZ. Teaching and Advising. Research Emphasis at ISU 4/29/2010 Introduction Lnce Bumgrd Associte Professor Ntive of southwest Minnesot BS: U of Minnesot MS: U of Minnesot Advisor: Brin Crooker Thesis: Effects of genetic selection for milk yield on somtotropin prmeters

More information

Supplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage

Supplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,

More information

ENERGY CONTENT OF BARLEY

ENERGY CONTENT OF BARLEY ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity

More information

TLR7 induces anergy in human CD4 + T cells

TLR7 induces anergy in human CD4 + T cells TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized

More information

THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS

THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY

More information

Optimizing Metam Sodium Fumigation in Fine-Textured Soils

Optimizing Metam Sodium Fumigation in Fine-Textured Soils Optimizing Metm Sodium Fumigtion in Fine-Textured Soils Neil C Gudmestd University Distinguished Professor & Endowed Chir of Potto Pthology Deprtment of Plnt Pthology North Dkot Stte University Erly Dying

More information

Research Article Total 4EBP1 Is Elevated in Liver of Rats in Response to Low Sulfur Amino Acid Intake

Research Article Total 4EBP1 Is Elevated in Liver of Rats in Response to Low Sulfur Amino Acid Intake Journl of Amino Acids Volume 2013, Article ID 864757, 11 pges http://dx.doi.org/10.1155/2013/864757 Reserch Article Totl 4EBP1 Is Elevted in Liver of Rts in Response to Low Sulfur Amino Acid Intke Angelos

More information

% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition

% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition % Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A

More information

Agilent G6825AA MassHunter Pathways to PCDL Software Quick Start Guide

Agilent G6825AA MassHunter Pathways to PCDL Software Quick Start Guide Agilent G6825AA MssHunter Pthwys to PCDL Softwre Quick Strt Guide Wht is Agilent Pthwys to PCDL? Fetures of Pthwys to PCDL Agilent MssHunter Pthwys to PCDL converter is stnd-lone softwre designed to fcilitte

More information

Using Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids

Using Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress

More information

Effect of environmental stress on biochemical and physiological features in cultured fish

Effect of environmental stress on biochemical and physiological features in cultured fish Effect of environmentl stress on biochemicl nd physiologicl fetures in cultured fish Toshiki Nkno, Toshiysu Ymguchi, nd Yoshihiro Ochii Grd. Sch. Agric. Sci., Tohoku Univ., Sendi, Jpn Fmous Smuri Mr. Msmune

More information

TNF-α (pg/ml) IL-6 (ng/ml)

TNF-α (pg/ml) IL-6 (ng/ml) Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6

More information

Supplementary figure 1

Supplementary figure 1 Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22

More information

Community. Profile Lewis & Clark County. Public Health and Safety Division

Community. Profile Lewis & Clark County. Public Health and Safety Division Community Helth Profile 2015 Lewis & Clrk County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl

More information

doi: /s British Journal of Nutrition (2016), 115, The Authors 2016

doi: /s British Journal of Nutrition (2016), 115, The Authors 2016 British Journl of Nutrition (2016), 115, 2236 2245 The Authors 2016 doi:10.1017/s0007114516000842 Supplementtion of rnched-chin mino cids to reduced-protein diet improves growth performnce in piglets:

More information

EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE

EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.

More information

Ulk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO

Ulk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1

More information

Supplementary Figure 1

Supplementary Figure 1 Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,

More information

Community. Profile Powell County. Public Health and Safety Division

Community. Profile Powell County. Public Health and Safety Division Community Helth Profile 2015 Powell County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl Risk

More information

Meat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel

Meat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE

More information

SYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT

SYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT Finl Arevited Clinicl Study Report Nme of Sponsor/Compny: Bristol-Myers Squi Ipilimum Individul Study Tle Referring to the Dossier (For Ntionl Authority Use Only) Nme of Finished Product: Yervoy Nme of

More information

obesità nel bambino: epidemiologia e prevenzione

obesità nel bambino: epidemiologia e prevenzione Obesità, Nutrizione e Stili di vit. Trento 31 Mrzo 27 obesità nel bmbino: epidemiologi e prevenzione Cludio Mffeis Diprtimento Mterno Infntile e Biologi-Genetic Sezione di Peditri - Università di Veron

More information

Community. Profile Big Horn County. Public Health and Safety Division

Community. Profile Big Horn County. Public Health and Safety Division Community Helth Profile 2015 Big Horn County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl

More information

Community. Profile Yellowstone County. Public Health and Safety Division

Community. Profile Yellowstone County. Public Health and Safety Division Community Helth Profile 2015 Yellowstone County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl

More information

Community. Profile Missoula County. Public Health and Safety Division

Community. Profile Missoula County. Public Health and Safety Division Community Helth Profile 2015 Missoul County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl Risk

More information

Community. Profile Anaconda- Deer Lodge County. Public Health and Safety Division

Community. Profile Anaconda- Deer Lodge County. Public Health and Safety Division Community Helth Profile 2015 Ancond- Deer Lodge County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12

More information

Sex differences in adult rat insulin and glucose responses to arginine: programming effects of neonatal separation, hypoxia, and hypothermia

Sex differences in adult rat insulin and glucose responses to arginine: programming effects of neonatal separation, hypoxia, and hypothermia ORIGINAL RESEARCH Physiologicl Reports ISSN 2051-817X Sex differences in dult rt insulin nd glucose responses to rginine: progrmming effects of neontl seprtion, hypoxi, nd hypothermi Ashley L. Gehrnd 1,

More information

Optimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality

Optimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1

More information

Phosphorylated p70s6k in noninvasive low grade urothelial carcinoma of the bladder: correlation with tumor recurrence

Phosphorylated p70s6k in noninvasive low grade urothelial carcinoma of the bladder: correlation with tumor recurrence (2014) 16, 611 617 2014 AJA, SIMM & SJTU. All rights reserved 1008-682X www.sindro.com; www.jndrology.com Mle Helth Open Access ORIGINAL ARTICLE Phosphorylted p70s6k in noninvsive low grde urothelil crcinom

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted

More information

The Journal of Physiology

The Journal of Physiology J Physiol 595.13 (2017) pp 4189 4206 4189 mtor folte sensing links folte vilility to tropholst cell function Fredrick J. Rosrio 1,TheresL.Powell 1,2 nd Thoms Jnsson 1 1 Division of Reproductive Sciences,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does

More information

Ndfip-mediated degradation of Jak1 tunes cytokine signalling to limit expansion of CD4 þ effector T cells

Ndfip-mediated degradation of Jak1 tunes cytokine signalling to limit expansion of CD4 þ effector T cells Received 4 Jul 15 Accepted 9 Fe 16 Pulished 18 Apr 16 DOI: 1.138/ncomms116 OPEN Ndfip-medited degrdtion of Jk1 tunes cytokine signlling to limit expnsion of CD4 þ effector T cells Clire E. O Lery 1, Christopher

More information

British Journal of Nutrition

British Journal of Nutrition (11), 16, 1449 1456 q The Authors 11 doi:1.117/s71145111917 Fish oil comined with SCFA synergisticlly prevent tissue ccumultion of NEFA during weight loss in oese mice Miken H. Pedersen 1,, Lotte Luritzen

More information

Background Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield.

Background Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield. Nnjing Agriculturl University Potssium enhnces the sugr ssimiltion in leves nd fruit y regulting the expression of key genes involved in sugr metolism of Asin pers Cixi Dong, Chngwei Shen, Yngchun Xu College

More information

4/16/2009. Gabler Laboratory Research Program. Long chain n-3 Fatty Acids, Fetal Programming and Swine. My Background. Swine Research Areas

4/16/2009. Gabler Laboratory Research Program. Long chain n-3 Fatty Acids, Fetal Programming and Swine. My Background. Swine Research Areas /1/9 Gler Lortory Reserch Progrm Nichols Gler Venktesh Mni (PhD. student) Emily Kuntz (BSc. student) Mrth Jeffrey (L. Mnger) Deprtment of Animl Sciences Iow Stte University L Troe University B. Agriculturl

More information

USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS

USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two

More information

Critical role of c-kit in beta cell function: increased insulin secretion and protection against diabetes in a mouse model

Critical role of c-kit in beta cell function: increased insulin secretion and protection against diabetes in a mouse model Dietologi (1) 55:14 5 DOI 1.17/s15-1-5-5 ARTICLE Criticl role of c-kit in et cell function: incresed insulin secretion nd protection ginst dietes in mouse model Z. C. Feng & J. Li & B. A. Turco & M. Riopel

More information

Invasive Pneumococcal Disease Quarterly Report July September 2018

Invasive Pneumococcal Disease Quarterly Report July September 2018 Invsive Pneumococcl Disese Qurterly Report July Septemer Introduction Since 17 Octoer 2008, invsive pneumococcl disese (IPD) hs een notifile to the locl Medicl Officer of Helth under the Helth Act 1956.

More information

Northern blot analysis

Northern blot analysis Northern blot nlysis RNA SCD RNA SCD FAS C c-9 t-1 C c-9 t-1 PRE PI PDMI PRE PI PDMI PRE PDMI PIM An W c-9, t-11 t-1, c-12 C 5 2 4 1 um C 5 2 4 1 um Angus dipocytes expressed SCD higher thn Wgyu dipocyte

More information

ARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum,

ARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum, DOI:.554/5YRTIMB..3 OPPOSITE MODELS OF EXPRESSION OF ANDROGEN RECEPTOR (AR) AND RETINOIC ACID RECEPTOR-α (RAR-α) IN THE ONSET OF MALE GERM CELL DEVELOPMENT IN HORMONALLY MANIPULATED RATS E. Pvlov, N. Atnssov,

More information

IGF-1 vs insulin: Respective roles in modulating sodium transport via the PI-3 kinase/sgk1 pathway in a cortical collecting duct cell line

IGF-1 vs insulin: Respective roles in modulating sodium transport via the PI-3 kinase/sgk1 pathway in a cortical collecting duct cell line originl rticle http://www.kidney-interntionl.org & 27 Interntionl Society of Nephrology IGF-1 vs insulin: Respective roles in modulting sodium trnsport vi the PI-3 kinse/sgk1 pthwy in corticl collecting

More information

AMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis

AMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd

More information

Extraction and Some Functional Properties of Protein Extract from Rice Bran

Extraction and Some Functional Properties of Protein Extract from Rice Bran Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein

More information

Suppressor of cytokine signaling 1 regulates the immune response to infection by a unique inhibition of type I interferon activity

Suppressor of cytokine signaling 1 regulates the immune response to infection by a unique inhibition of type I interferon activity 5 Nture Pulishing Group http://www.nture.com/ntureimmunology Suppressor of cytokine signling 1 regultes the immune response to infection y unique inhiition of type I interferon ctivity Jennifer E Fenner

More information

Supplementary Figure 1

Supplementary Figure 1 doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney

More information

Input from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer

Input from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA

More information

PROVEN ANTICOCCIDIAL IN NEW FORMULATION

PROVEN ANTICOCCIDIAL IN NEW FORMULATION PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules

More information

Paternal programming of breast cancer risk in daughters in a rat model: opposing effects of animal- and plant-based high-fat diets

Paternal programming of breast cancer risk in daughters in a rat model: opposing effects of animal- and plant-based high-fat diets Universidde de São Pulo Biliotec Digitl d Produção Intelectul - BDPI Deprtmento de Alimentos e Nutrição Experimentl - FCF/FBA Artigos e Mteriis de Revists Científics - FCF/FBA 216 Pternl progrmming of

More information

Chromium Alleviates Glucose Intolerance, Insulin Resistance, and Hepatic ER Stress in Obese Mice

Chromium Alleviates Glucose Intolerance, Insulin Resistance, and Hepatic ER Stress in Obese Mice nture pulishing group rticles intervention AND prevention Chromium Allevites Glucose Intolernce, Insulin Resistnce, nd Heptic ER Stress in Oese Mice Nir Sreejyn, Feng Dong, Mchender R. Knddi,2, Xioping

More information

Copy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2

Copy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2 Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry

More information

Check your understanding 3

Check your understanding 3 1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the

More information

A Comparison of Serum Magnesium Level in Pregnant Women with and without Gestational Diabetes Mellitus (GDM)

A Comparison of Serum Magnesium Level in Pregnant Women with and without Gestational Diabetes Mellitus (GDM) Brief Report J Bbol Univ Med Sci Vol 18, Issu 12; Dec 2016. P:71-75 A Comprison of Serum Mgnesium Level in Pregnnt Women with nd without Gesttionl Dibetes Mellitus (GDM) Z. Bouzri (MD) 1, F. Elmi(MD) 2,

More information

EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1

EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were

More information

Regulation of protein degradation pathways by amino acids and insulin in skeletal muscle of neonatal pigs

Regulation of protein degradation pathways by amino acids and insulin in skeletal muscle of neonatal pigs Surywn nd Dvis Journl of niml Science nd iotechnology 2014, 5:8 http://www.jssci.com/content/5/1/8 JOURNL OF NIML SCIENCE ND IOTECHNOLOGY RESERCH Open ccess Regultion of protein degrdtion pthwys y mino

More information

2018 American Diabetes Association. Published online at

2018 American Diabetes Association. Published online at Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,

More information

Inflammatory responses in primary muscle cell cultures in Atlantic salmon (Salmo salar)

Inflammatory responses in primary muscle cell cultures in Atlantic salmon (Salmo salar) Pooley et l. BMC Genomics 213, 14:747 http://www.iomedcentrl.com/1471-2164/14/747 ESEACH ATICLE Open Access Inflmmtory responses in primry muscle cell cultures in Atlntic slmon (Slmo slr) Nichols J Pooley

More information

Supplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2

Supplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2 Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,

More information

Comparison of pro- and anti-inflammatory responses in paired human primary airway epithelial cells and alveolar macrophages

Comparison of pro- and anti-inflammatory responses in paired human primary airway epithelial cells and alveolar macrophages Murk et l. Respirtory Reserch (2018) 19:126 https://doi.org/10.1186/s12931-018-0825-9 RESEARCH Comprison of pro- nd nti-inflmmtory responses in pired humn primry irwy epithelil cells nd lveolr mcrophges

More information

Community. Profile Carter County. Public Health and Safety Division

Community. Profile Carter County. Public Health and Safety Division Community Helth Profile 2015 Crter County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl Risk

More information

Supplementary Online Content

Supplementary Online Content Supplementry Online Content Zulmn DM, Pl Chee C, Ezeji-Okoye SC, et l. Effect of n intensive outptient progrm to ugment primry cre for high-need Veterns Affirs ptients: rndomized clinicl tril. JAMA Intern

More information

PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES

PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles

More information

ARTICLE. J. E. Bowe & A. Chander & B. Liu & S. J. Persaud & P. M. Jones

ARTICLE. J. E. Bowe & A. Chander & B. Liu & S. J. Persaud & P. M. Jones Dietologi (23) 56:783 79 DOI.7/s25-2-2828-2 ARTICLE The permissive effects of glucose on receptor-operted potentition of insulin secretion from mouse islets: role for ERK/2 ctivtion nd cytoskeletl remodelling

More information

INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA

INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA Pthology nd Hygiene INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA Kulcsár G. 1, Fáián K. 1 *, Brn T. 1, Virág Gy.

More information