SwissProt/ TrEmbl Acc. No. 1 Description. Found in Other Studies 5. MW (kda) 2 pi 3 Function 4

Size: px
Start display at page:

Download "SwissProt/ TrEmbl Acc. No. 1 Description. Found in Other Studies 5. MW (kda) 2 pi 3 Function 4"

Transcription

1 P02774 Vitamin D-binding protein precursor Cell communication c, a,b S,C P08833 Insulin-like growth factor binding protein 1 precursor Cell communication c, a P02760 AMBP protein precursor [Contains: Alpha-1-microglo Cell communication c, a,b S P02751 Fibronectin precursor Cell communication d S P00450 Ceruloplasmin precursor Cell communication c S,C P02763 Alpha-1-acid glycoprotein 1 precursor Cell communication a S,C P02452 Collagen alpha 1 (I) chain precursor Cell communication d S P02790 Hemopexin precursor Defense response c S,C P04217 Alpha-1B-glycoprotein precursor Defense response c, a S,C P01042 Kininogen precursor Enzyme activity c S,C P02749 Beta-2-glycoprotein I precursor Cell communication S,C P61769 Beta-2-microglobulin precursor Signal transduction c, a P02753 Plasma retinol-binding protein precursor Cell communication S P09486 SPARC precursor Development d S P19652 Alpha-1-acid glycoprotein 2 precursor Cell communication S P00747 Plasminogen precursor Enzyme activity S,C P02771 Alpha-fetoprotein precursor Cell communication b S P01236 Prolactin precursor Signal transduction P02461 Collagen alpha 1 (III) chain precursor Cell communication P02647 Apolipoprotein A-I precursor Cell communication d S,C P80370 Delta-like protein precursor Development P25311 Zinc-alpha-2-glycoprotein precursor Cell proliferation P20908 Collagen alpha 1 (V) chain precursor Cell communication P02765 Alpha-2-HS-glycoprotein precursor Metabolism a,d S,C P13727 Eosinophil granule major basic protein precursor Defense response P04196 Histidine-rich glycoprotein precursor Enzyme activity c S Q16610 Extracellular matrix protein 1 precursor Signal transduction S,C P01033 Metalloproteinase inhibitor 1 precursor Metabolism S P43652 Afamin precursor Cell communication S P08603 Complement factor H precursor Defense response c S,C P12111 Collagen alpha 3 (VI) chain precursor Cell communication c P41222 Prostaglandin-H2 D-isomerase precursor Cell communication S P23142 Fibulin-1 precursor Cell communication c S P17936 Insulin-like growth factor binding protein 3 precursor Development

2 P01034 Cystatin C precursor Enzyme activity P18065 Insulin-like growth factor binding protein 2 precursor Cell communication S Q16270 Insulin-like growth factor binding protein 7 precursor Cell communication d Q12841 Follistatin-related protein 1 precursor Cell proliferation c P01008 Antithrombin-III precursor Enzyme Activity c S,C P98160 Basement membrane-specific heparan sulfate proteo Cell communication c P10451 Osteopontin precursor Cell communication c P09466 Glycodelin precursor Development P12109 Collagen alpha 1 (VI) chain precursor Cell communication d P51884 Lumican precursor Cell communication c S Q14766 Latent transforming growth factor beta binding protein Enzyme activity P22692 Insulin-like growth factor binding protein 4 precursor Metabolism P62328 Thymosin beta Metabolism C Q12805 EGF-containing fibulin-like extracellular matrix protein Defense response S P10909 Clusterin precursor Signal transduction c S P04004 Vitronectin precursor Cell communication c S,C Q15582 Transforming growth factor-beta induced protein IG-H Cell proliferation d S P61626 Lysozyme C precursor Enzyme activity C P00751 Complement factor B precursor Metabolism c, a S P13987 CD59 glycoprotein precursor Defense response c C P35555 Fibrillin-1 precursor Development P08294 Extracellular superoxide dismutase [Cu-Zn] precurso Metabolism Q9HC84 Mucin-5B precursor Cell communication C P07998 Ribonuclease pancreatic precursor Enzyme activity P02788 Lactotransferrin precursor Defense response a S,C Q9UBC9 Small proline-rich protein FNA C P01344 Insulin-like growth factor II precursor Signal transduction Q14118 Dystroglycan precursor Signal transduction P00748 Coagulation factor XII precursor Enzyme activity S P07602 Proactivator polypeptide precursor [Contains: Saposi Metabolism P01019 Angiotensinogen precursor Metabolism c S P01833 Polymeric-immunoglobulin receptor precursor Cell communication c C P02766 Transthyretin precursor Cell communication c, a S P02768 Serum albumin precursor Cell communication b,d S,C

3 P05156 Complement factor I precursor Defense response S Q15113 Procollagen C-proteinase enhancer protein precurso Development S P11464 Pregnancy-specific beta-1-glycoprotein 1 precursor FNA c P29279 Connective tissue growth factor precursor Metabolism Q9UGM5 Fetuin-B precursor Metabolism P02671 Fibrinogen alpha/alpha-e chain precursor Cell proliferation S,C P00746 Complement factor D precursor Defense response S P02748 Complement component C9 precursor Defense response c S P07476 Involucrin Development C P05090 Apolipoprotein D precursor Metabolism c S P01243 Chorionic somatomammotropin hormone precursor Signal transduction a P08123 Collagen alpha 2(I) chain precursor Cell communication d P05362 Intercellular adhesion molecule-1 precursor Cell communication P24593 Insulin-like growth factor binding protein 5 precursor Cell communication P02679 Fibrinogen gamma chain precursor Cell proliferation c S,C Q07654 Trefoil factor 3 precursor Defense response P35321 Cornifin A Development C O95633 Follistatin-related protein 3 precursor FNA P31949 Calgizzarin Metabolism P61916 Epididymal secretory protein E1 precursor Metabolism O43278 Kunitz-type protease inhibitor 1 precursor Enzyme activity P04278 Sex hormone-binding globulin precursor Cell communication S P16070 CD44 antigen precursor Cell communication Q13421 Mesothelin precursor Cell communication c P01028 Complement C4 precursor Defense response c S,C P08174 Complement decay-accelerating factor precursor Defense response P31025 Von Ebner's gland protein precursor Defense response c, a Q10588 ADP-ribosyl cyclase 2 precursor Defense response S P03973 Antileukoproteinase 1 precursor Enzyme activity C P04080 Cystatin B Enzyme activity a C P02652 Apolipoprotein A-II precursor Metabolism S P10599 Thioredoxin Metabolism C Q96IY4 Carboxypeptidase B2 precursor Metabolism S P11684 Uteroglobin precursor Signal transduction

4 P55290 Cadherin-13 precursor Cell organization P22105 Tenascin-X precursor Cell communication S P80188 Neutrophil gelatinase-associated lipocalin precursor Cell communication S,C P01024 Complement C3 precursor Defense response c S,C P01860 Ig gamma-3 chain C region Defense response S P48745 NOV protein homolog precursor Development P03952 Plasma kallikrein precursor Enzyme activity S P17900 Ganglioside GM2 activator precursor Enzyme activity P04156 Major prion protein precursor Metabolism P07988 Pulmonary surfactant-associated protein B precursor Metabolism c P01215 Glycoprotein hormones alpha chain precursor Signal transduction Q14767 Latent transforming growth factor-beta-binding protei Signal transduction P00734 Prothrombin precursor Enzyme activity c S P02787 Serotransferrin precursor Defense response a,c,d S,C P09228 Cystatin SA precursor Enzyme activity Q03591 Complement factor H-related protein 1 precursor Cell communication S P12830 Epithelial-cadherin Cell communication P14543 Nidogen Cell communication P16949 Stathmin Cell communication P49747 Cartilage oligomeric matrix protein Cell communication S P protein epsilon Cell communication d P protein zeta/delta Cell communication d C P68871 Hemoglobin subunit beta Cell communication a S Q13908 Alpha-2 type V collagen Cell communication Q14036 Alpha-2 type I collagen Cell communication Q14112 Nidogen Cell communication Q5XKQ4 Alpha-2-glycoprotein 1, zinc Cell communication S Q6GRB6 Fetuin-B Cell communication S Q6GTW4 Cadherin 13, preproprotein Cell communication Insulin-like growth factor binding protein, acid labile Q8TAY0 subunit Cell communication S Q92496 Complement factor H-related protein Cell communication P35609 Alpha-actinin Cell organization P53485 Actin, cytoplasmic Cell organization

5 P68133 Actin, alpha skeletal muscle Cell organization S P02675 Fibrinogen beta chain Cell proliferation d, a S,C P60709 Actin, cytoplasmic Cell proliferation S,C P protein gamma Cell proliferation d P01011 Alpha-1-antichymotrypsin Defense response S,C P01595 Ig kappa chain V-I region Bi Defense response P01598 Ig kappa chain V-I region EU Defense response S P01603 Ig kappa chain V-I region Ka Defense response P01605 Ig kappa chain V-I region Lay Defense response P01621 Ig kappa chain V-III region NG Defense response S P01622 Ig kappa chain V-III region Ti Defense response S P01624 Ig kappa chain V-III region POM Defense response S P01625 Ig kappa chain V-IV region Len Defense response S P01766 Ig heavy chain V-III region BRO Defense response P01767 Ig heavy chain V-III region BUT Defense response P01857 Ig gamma-1 chain C region Defense response S,C P01859 Ig gamma-2 chain C region Defense response S,C P01861 Ig gamma-4 chain C region Defense response S,C P01876 Ig alpha-1 chain C region Defense response S,C P01877 Ig alpha-2 chain C region Defense response S,C P04083 Annexin A Defense response d S,C P04206 Ig kappa chain V-III region GOL Defense response S P04434 Ig kappa chain V-III region VH Defense response S P05109 Protein S100-A Defense response S,C P05155 Plasma protease C1 inhibitor Defense response c S P05164 Myeloperoxidase* Defense response C P06681 Complement C Defense response S P06702 Protein S100-A Defense response S,C P08571 Monocyte differentiation antigen CD Defense response S P08697 Alpha-2-antiplasmin Defense response c S P10643 Complement component C Defense response S P15814 Immunoglobulin lambda-like polypeptide Defense response P18135 Ig kappa chain V-III region HAH Defense response S P20160 Azurocidin* Defense response

6 P40121 Macrophage capping protein Defense response d P49913 Antibacterial protein FALL-39* Defense response Long palate, lung and nasal epithelium carcinomaassociated protein 1* Defense response C Q8TDL5 Q9UGM3 Glycoprotein 340* Defense response P05452 Tetranectin Development S P06741 Myosin light chain 3, skeletal muscle isoform Development P07355 Annexin A Development d S,C P07996 Thrombospondin Development S P36955 Pigment epithelium-derived factor Development c S Q9UBI9 Headcase protein homolog Development P30740 Leukocyte elastase inhibitor* Enzyme activity C P05543 Thyroxine-binding globulin Enzyme activity c S P05546 Heparin cofactor Enzyme activity S P08185 Corticosteroid-binding globulin Enzyme activity c S P09525 Annexin A Enzyme activity d Q02325 Plasminogen-related protein B Enzyme activity S P02750 Leucine-rich alpha-2-glycoprotein FNA S P13796 Plastin-2* FNA S,C Q2XP30 Mutant beta-globin FNA Q5SYV9 Lipocalin FNA Q6EMK4 Vasorin FNA Q92520 Protein FAM3C FNA Q9UJ14 Gamma-glutamyltransferase FNA Q9Y5Z4 Heme-binding protein FNA O00187 Mannan-binding lectin serine protease Metabolism S P00918 Carbonic anhydrase Metabolism P01023 Alpha-2-macroglobulin Metabolism S P06727 Apolipoprotein A-IV Metabolism c,d S P08709 Coagulation factor VII Metabolism P15144 Aminopeptidase N Metabolism S P18669 Phosphoglycerate mutase Metabolism d C P19440 Gamma-glutamyltranspeptidase Metabolism P22352 Glutathione peroxidase Metabolism

7 P36222 Chitinase-3-like protein Metabolism P43251 Biotinidase Metabolism S P55058 Phospholipid transfer protein Metabolism S P60174 Triosephosphate isomerase Metabolism d C P S ribosomal protein S27a Metabolism P S ribosomal protein L Metabolism P62988 Ubiquitin Metabolism C Q16819 Meprin A subunit alpha Metabolism S Q53XZ5 Tyrosine 3-monooxygenase/tryptophan 5- monooxygenase Metabolism Q5T986 Inter-alpha (Globulin) inhibitor, H2 polypeptide Metabolism CDNA FLJ32377 fis, clone SKMUS , highly similar to Polyubiquitin Metabolism Q96MH4 Q96PQ8 Factor VII active site mutant immunoconjugate Metabolism Q14406 Chorionic somatomammotropin hormone-like Signal transduction Q53YY1 Angiotensinogen Signal transduction S Q7Z7P3 Coagulation factor II, Signal transduction Q86VW7 Colony stimulating factor 1 receptor, Signal transduction Q8WZA4 Collectin placenta Signal transduction Proteins that were identified in experiment are listed with their SwissProt or TrEMBL accession 1. Molecular weight (kda) 2 and pi 3 calculated using CalPI/ tool available on SwissProt website. 4 Functional annotation is performed using procedure outlined in methods section. FNA-Function not assigned. 5 AF proteins that were also found in other amniotic fluid (a I,b II,c III ) and amnion cell (d IV ) studies are marked accordingly. 6 AF proteins that are also present in Serum (S) and Cervico-vagianl Fluid (C) are also marked (see results section for details). * Proteins identified in amniotic fluid with infection. I - Park, SJ et. al. Proteomics, 2006, 6, (1), ; II - Nilsson S et. al. J. Proteome Research, 2004, 3, (4), ; III - Michel, P. E. et. al. Electrophoresis, 2006, 7, 7.; IV- Tsangaris, G. et. al. Electrophoresis, 2005, 26, (6), ; Proteins are also color coded for their role in fetal biology (see results for details): Red-Complement and Coagulation cascades, Grey-Metabolism, Green - Defense response, Yellow-Signal transduction, Orange-Development, and Cyan- Transport

TECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive

TECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive TECHNICAL NOTE Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive In this technical note you will learn about: Step-by-step set-up of parallel reaction monitoring (PRM)

More information

Table S1. CRC case Pool Control Pool Name UniProt No. FC b VIP value d Spectral Counts Spectral Counts

Table S1. CRC case Pool Control Pool Name UniProt No. FC b VIP value d Spectral Counts Spectral Counts Table S1. page 1/4 Phase 1 Exploratory Study, List of proteins identified by LC-ESI-MS/MS after 1DE separation and their relative quantitation by spectral count UniProt Entry SwissProt- CRC case Pool Control

More information

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding

More information

Supporting Information. Synthesis of Zwitterionic Polymer Particles via Combined Distillation

Supporting Information. Synthesis of Zwitterionic Polymer Particles via Combined Distillation Supporting Information Synthesis of Zwitterionic Polymer Particles via Combined Distillation Precipitation Polymerization and Click Chemistry for Highly Efficient Enrichment of Glycopeptide Jianxi Liu,

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2018 Supporting Information Covalent functionalization of graphene oxide with

More information

GMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS

GMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS GMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS 2 Hypothesis. Proteomic study of first protein layer Post-implantation, the biomaterial becomes in contact with the blood,

More information

Ch. 45 Blood Plasma proteins, Coagulation and Fibrinolysis Student Learning Outcomes: Describe basic components of plasma

Ch. 45 Blood Plasma proteins, Coagulation and Fibrinolysis Student Learning Outcomes: Describe basic components of plasma Chapt. 45 Ch. 45 Blood Plasma proteins, Coagulation and Fibrinolysis Student Learning Outcomes: Describe basic components of plasma Inheritance of X-linked gene for Factor VIII hemophilia A Explain the

More information

Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma

Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma Jiejun Gao 1, Lu Lin 2, Alexander Wei 2,*, and Maria S. Sepúlveda 1,* 1 Department of Forestry and Natural

More information

Multiple High-Abundant Protein Removal for Proteomics. Dr. Cory Szafranski, Product Manager

Multiple High-Abundant Protein Removal for Proteomics. Dr. Cory Szafranski, Product Manager Multiple High-Abundant Protein Removal for Proteomics Dr. Cory Szafranski, Product Manager Agilent Multiple Affinity Removal System - What is it? H L High-Abundant Proteins (Albumin, IgG, IgA, Transferrin,

More information

ESTUDIO GMI. ESTUDIO PROTEÓMICO-COMPARACIÓN IMPLANTES DENTALES

ESTUDIO GMI. ESTUDIO PROTEÓMICO-COMPARACIÓN IMPLANTES DENTALES ESTUDIO GMI. ESTUDIO PROTEÓMICO-COMPARACIÓN IMPLANTES DENTALES 2 Hypothesis. Proteomic study of first protein layer Post-implantation, the biomaterial becomes in contact with the blood, resulting in protein

More information

Chapter 19 Cardiovascular System Blood: Functions. Plasma

Chapter 19 Cardiovascular System Blood: Functions. Plasma Chapter 19 Cardiovascular System Blood: Functions 19-1 Plasma Liquid part of blood. Colloid: liquid containing suspended substances that don t settle out of solution 91% water. Remainder proteins, ions,

More information

Chapter 19: Cardiovascular System: Blood

Chapter 19: Cardiovascular System: Blood Chapter 19: Cardiovascular System: Blood I. Functions of Blood A. List and describe the seven major homeostatic functions of blood: 1. 2. 3. 4. 5. 6. 7. II. Plasma A. Composition 1. It is a fluid consisting

More information

Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).

Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A). Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease

More information

Supplemental Information. Host-Microbiota Interactions in the Pathogenesis. of Antibiotic-Associated Diseases

Supplemental Information. Host-Microbiota Interactions in the Pathogenesis. of Antibiotic-Associated Diseases Cell Reports, Volume Supplemental Information Host-Microbiota Interactions in the Pathogenesis of -Associated Diseases Joshua S. Lichtman, Jessica A. Ferreyra, Katharine M. Ng, Samuel A. Smits, Justin

More information

Part IV Antithrombotics, Anticoagulants and Fibrinolytics

Part IV Antithrombotics, Anticoagulants and Fibrinolytics Part IV Antithrombotics, Anticoagulants and Fibrinolytics "The meaning of good and bad, of better and worse, is simply helping or hurting" Emerson Chapter 16: Blood Coagulation and Fibrinolytic System

More information

Blood. Plasma. The liquid part of blood is called plasma. 1. Pale yellow fluid; forms more than half the blood volume.

Blood. Plasma. The liquid part of blood is called plasma. 1. Pale yellow fluid; forms more than half the blood volume. 11 Blood FOCUS: Blood consists of plasma and formed elements. The plasma is 91% water with dissolved or suspended molecules, including albumin, globulins, and fibrinogen. The formed elements include erythrocytes,

More information

Proteomic studies in Collagen Induced Arthritis (CIA) rats

Proteomic studies in Collagen Induced Arthritis (CIA) rats V{tÑàxÜ@H Proteomic studies in Collagen Induced Arthritis (CIA) rats 5.1. Introduction Over the last few decades, both naturally occurring and genetically engineered animal models of human diseases have

More information

Chapter 11. Lecture and Animation Outline

Chapter 11. Lecture and Animation Outline Chapter 11 Lecture and Animation Outline To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off. Please Note: Once you have

More information

Chapter 19. Openstax: Chapter 18. Blood

Chapter 19. Openstax: Chapter 18. Blood Chapter 19 Blood Openstax: Chapter 18 Chapter 19 Learning Outcomes After completing Chapter 19, you will be able to: 1. Describe the components and major functions of blood and list the physical characteristics

More information

C-reactive protein. An ED perspective Greg Stevens May 2010

C-reactive protein. An ED perspective Greg Stevens May 2010 C-reactive protein An ED perspective Greg Stevens May 2010 Basic Biology Is a short Pentraxin Penta 5, ragos berries 224 residue protein 25106 Da Gene 1q21-q23 q23 History Tillett WS, Francis T Jr. Serological

More information

Chapter 19 Blood Lecture Outline

Chapter 19 Blood Lecture Outline Chapter 19 Blood Lecture Outline Cardiovascular system Circulatory system Blood 1. distribution 2. regulation 3. protection Characteristics: ph 7.4 38 C 4-6 L Composition: Plasma Formed elements Erythrocytes

More information

Branch of medicine that deals with blood, its formation and disorders is called. Three main functions of cardiovascular system are,, and.

Branch of medicine that deals with blood, its formation and disorders is called. Three main functions of cardiovascular system are,, and. Chapter 19 The Blood Human body must maintain a balance called. Body fluid inside the cells is called fluid; that outside is called or fluid. Two major fluid networks that help in connecting cells are

More information

The Cardiovascular System: Blood

The Cardiovascular System: Blood C h a p t e r 11 The Cardiovascular System: Blood PowerPoint Lecture Slides prepared by Jason LaPres Lone Star College - North Harris Introduction to the Cardiovascular System A circulating transport system

More information

FirePlex Multiplex Immunoassay product list

FirePlex Multiplex Immunoassay product list FirePlex Multiplex Immunoassay product list Contents Purchasing the assay Human - pre-designed panels Human list of analytes Human protein standard mixes Mouse - pre-designed panels Mouse list of analytes

More information

Connective tissue CONNECTIVE TISSUE Part I

Connective tissue CONNECTIVE TISSUE Part I Connective tissue CONNECTIVE TISSUE Part I Part 1 Connective Tissue Found everywhere in the body (app. 50% of body weight) Includes the most abundant and widely distributed tissues General features of

More information

Hemostasis. Learning objectives Dr. Mária Dux. Components: blood vessel wall thrombocytes (platelets) plasma proteins

Hemostasis. Learning objectives Dr. Mária Dux. Components: blood vessel wall thrombocytes (platelets) plasma proteins Hemostasis Learning objectives 14-16 Dr. Mária Dux Components: blood vessel wall thrombocytes (platelets) plasma proteins Hemostatic balance! procoagulating activity anticoagulating activity 1 Thrombocytes

More information

Blood Lecture Outline : Fluid Connective Tissue Part I of the Cardiovascular Unit

Blood Lecture Outline : Fluid Connective Tissue Part I of the Cardiovascular Unit Blood Lecture Outline : Fluid Connective Tissue Part I of the Cardiovascular Unit General Characteristics: Extracellular matrix ph Volume Functions of the blood: 1. Transport 2. Regulation 3. Protection

More information

Connective Tissue (CT)

Connective Tissue (CT) Connective Tissue (CT) YONG-MEI CHEN ( 陈咏梅 ) Dept. of Anatomy, Histology & Embryology Peking Union Medical College Tel:69156461 E-mail address: pumc_he@126.com Content Introduction of CT 1. Origin 2. Compositions

More information

AVAILABLE BIOMARKER ASSAYS

AVAILABLE BIOMARKER ASSAYS AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated

More information

Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding

Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding Aleksei Krasnov, Nofima FHFs fiskehelsesamling 1.-2. september 2015 Smoltifiction and breeding suppress immunity in

More information

BIOL 2458 CHAPTER 19 Part 1 SI 1. List the types of extracellular fluids. 2. Intracellular fluid makes up of the body fluids. Where is it found?

BIOL 2458 CHAPTER 19 Part 1 SI 1. List the types of extracellular fluids. 2. Intracellular fluid makes up of the body fluids. Where is it found? BIOL 2458 CHAPTER 19 Part 1 SI 1 1. Extracellular fluid makes up of the body fluids. List the types of extracellular fluids. 2. Intracellular fluid makes up of the body fluids. Where is it found? 3. In

More information

Agenda. Components of blood. Blood is Fluid Connective Tissue. Blood: General functions

Agenda. Components of blood. Blood is Fluid Connective Tissue. Blood: General functions Agenda Chapter 19: Blood Major functions Major Components Structure of RBCs and WBCs ABO Blood Types, and Rh Factor Lab 34.1 and Blood Typing Blood: General functions Transport of dissolved gases, nutrients,

More information

Tissue repair. (3&4 of 4)

Tissue repair. (3&4 of 4) Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid

More information

CH 11 Blood OUTLINE: Functions of Blood Composition of Blood Blood Cell Disorders Blood Types Blood Clotting Functions of Blood Transportation

CH 11 Blood OUTLINE: Functions of Blood Composition of Blood Blood Cell Disorders Blood Types Blood Clotting Functions of Blood Transportation 1 CH 11 Blood OUTLINE: Functions of Blood Composition of Blood Blood Cell Disorders Blood Types Functions of Blood Transportation Protection Regulation ph Temperature Composition of Blood Plasma: liquid

More information

CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems

CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven

More information

Cell-Derived Inflammatory Mediators

Cell-Derived Inflammatory Mediators Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,

More information

G. Types of White Blood Cells

G. Types of White Blood Cells 1. White blood cells are also called leukocytes. G. Types of White Blood Cells 2. White blood cells function to protect against diseases. 3. Two hormones that stimulate white blood cell production are

More information

Functional proteomic analysis of seminal plasma proteins in men with various semen parameters

Functional proteomic analysis of seminal plasma proteins in men with various semen parameters Sharma et al. Reproductive Biology and Endocrinology 2013, 11:38 RESEARCH Open Access Functional proteomic analysis of seminal plasma proteins in men with various semen parameters Rakesh Sharma 1, Ashok

More information

BIO 116 Practice Assignment 1 The Endocrine System and Blood This is not a required assignment but it is recommended.

BIO 116 Practice Assignment 1 The Endocrine System and Blood This is not a required assignment but it is recommended. BIO 116 Practice Assignment 1 The Endocrine System and Blood This is not a required assignment but it is recommended. 1. Match the following glands of the endocrine system with the appropriate label 1.

More information

WBCs production(leucopoiesis):

WBCs production(leucopoiesis): WBCs production(leucopoiesis): Note: this sheet contain only extra notes.j - leucopoiesis is the most complicated process in body because many reasons which are : 1- the production of many cells(monocyte,

More information

Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase

Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2

More information

THE BIOLOGY OF PLATELET-GEL THERAPY

THE BIOLOGY OF PLATELET-GEL THERAPY THE BIOLOGY OF PLATELET-GEL THERAPY The synopsis of normal healing includes a well known sequence of coordinated phases. The unique process leading to healing is ontologically partitioned in three sequential

More information

ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were

ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were Supplementary Figure 1. Characterization of EVs from intestine. (a, b) Intestinal tissues were ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were isolated by

More information

PPI. The Clinical Potential of the Human Plasma Proteome. The Plasma Proteome Institute

PPI. The Clinical Potential of the Human Plasma Proteome. The Plasma Proteome Institute The Clinical Potential of the Human Plasma Proteome Leigh Anderson Ph.D. Founder & CEO, Plasma Proteome Institute Board Member, Dade Behring The Plasma Proteome Institute Plasma is the largest, and deepest,

More information

Four melanocyte-stimulating hormones have the following amino acid sequences:

Four melanocyte-stimulating hormones have the following amino acid sequences: Assignment 14: Melanocyte-stimulating hormone belongs to a group called the melanocortins. This group includes ACTH, alpha-msh, beta-msh and gamma-msh; these peptides are all cleavage products of a large

More information

Blood. Biol 105 Lecture 14 Chapter 11

Blood. Biol 105 Lecture 14 Chapter 11 Blood Biol 105 Lecture 14 Chapter 11 Outline I. Overview of blood II. Functions of blood III. Composition of blood IV. Composition of plasma V. Composition of formed elements VI. Platelets VII. White blood

More information

LECTURE: 21. Title IMMUNOGLOBULINS FUNCTIONS & THEIR RECEPTORS LEARNING OBJECTIVES:

LECTURE: 21. Title IMMUNOGLOBULINS FUNCTIONS & THEIR RECEPTORS LEARNING OBJECTIVES: LECTURE: 21 Title IMMUNOGLOBULINS FUNCTIONS & THEIR RECEPTORS LEARNING OBJECTIVES: The student should be able to: Determine predominant immunoglobulin isotypes in serum. Determine the predominant immunoglobulin

More information

BLOOD. Dr. Vedat Evren

BLOOD. Dr. Vedat Evren BLOOD Dr. Vedat Evren Blood Liquid suspension of formed elements Blood = Blood cells + plasma Plasma = Coagulation factors + serum Cells = Erythrocytes + Leukocytes + Thrombocytes 8 % of the total body

More information

Supplementary Data. References

Supplementary Data. References Supplementary Data Materials and Methods Sample collection from acute kidney injury patients Urine samples were obtained from patients who had cardiac surgery at one academic medical center and two local

More information

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

PRP Basic Science. Platelets. Definition of PRP 10/4/2011. Questions that this talk aims to answer

PRP Basic Science. Platelets. Definition of PRP 10/4/2011. Questions that this talk aims to answer PRP Basic Science Peter J. Moley, MD Hospital for Special Surgery October 5, 2011 Questions that this talk aims to answer 1. What is PRP? 2. What blood components are NOT in PRP? 3. What are the active

More information

I) Choose the best answer: 1- All of the following amino acids are neutral except: a) glycine. b) threonine. c) lysine. d) proline. e) leucine.

I) Choose the best answer: 1- All of the following amino acids are neutral except: a) glycine. b) threonine. c) lysine. d) proline. e) leucine. 1- All of the following amino acids are neutral except: a) glycine. b) threonine. c) lysine. d) proline. e) leucine. 2- The egg white protein, ovalbumin, is denatured in a hard-boiled egg. Which of the

More information

4/5/17. Blood. Blood. Outline. Blood: An Overview. Functions of Blood

4/5/17. Blood. Blood. Outline. Blood: An Overview. Functions of Blood Outline Blood Biol 105 Chapter 11 I. Overview of blood II. Functions of blood III. Composition of blood IV. Composition of plasma V. Composition of formed elements VI. Platelets VII. White blood cells

More information

Ovarian Cancer-Biomarkers

Ovarian Cancer-Biomarkers Ovarian Cancer-Biomarkers Bobby Graham Deputy Director of the Stoller Biomarker Discovery Centre Discovery Validation Stoller Biomarker Discovery Centre Arginine R Glutamic acid E Leucine L Serine S Threonine

More information

Blood. BIOLOGY OF HUMANS Concepts, Applications, and Issues. Judith Goodenough Betty McGuire

Blood. BIOLOGY OF HUMANS Concepts, Applications, and Issues. Judith Goodenough Betty McGuire BIOLOGY OF HUMANS Concepts, Applications, and Issues Fifth Edition Judith Goodenough Betty McGuire 11 Blood Lecture Presentation Anne Gasc Hawaii Pacific University and University of Hawaii Honolulu Community

More information

Blood. Blood Composition Plasma Red blood cells -RBCs White Blood Cells- WBCs (leucocytes) Blood Platelets PLT (thrombocytes)

Blood. Blood Composition Plasma Red blood cells -RBCs White Blood Cells- WBCs (leucocytes) Blood Platelets PLT (thrombocytes) Blood Blood Composition Plasma Red blood cells -RBCs White Blood Cells- WBCs (leucocytes) Blood Platelets PLT (thrombocytes) Functions of the blood 1. Respiration - transport of oxygen from the lungs to

More information

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57 Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive

More information

What are the functions of blood?

What are the functions of blood? What are the functions of blood? Transportation: oxygen, nutrients, wastes, carbon dioxide, nitrogen from amino acids and hormones, lipoproteins HDL and LDL Hemoglobin carries oxygen and CO2, (CO poisoning)

More information

25 years of research excelence

25 years of research excelence Crystal Chem full product catalog 25 years of research excelence We're poud to be one of the top providers of research assays for the last 25 years product catalog See our full line of high quality assays

More information

Blood. The only fluid tissue in the human body Classified as a connective tissue. Living cells = formed elements Non-living matrix = plasma

Blood. The only fluid tissue in the human body Classified as a connective tissue. Living cells = formed elements Non-living matrix = plasma Blood Blood The only fluid tissue in the human body Classified as a connective tissue Living cells = formed elements Non-living matrix = plasma Blood Physical Characteristics of Blood Color range Oxygen-rich

More information

Functions of Blood. Transport. Transport. Defense. Regulation. Unit 6 Cardiovascular System: Blood

Functions of Blood. Transport. Transport. Defense. Regulation. Unit 6 Cardiovascular System: Blood Unit 6 Cardiovascular System: Blood Functions of Blood With each beat of the heart, approximately 75 ml of blood is pumped On average, the heart beats 70 times per minute Every minute, the heart pumps

More information

Chapter 13. Plasma Proteins and Enzymes. Lecturer: Dr Abeer Shnoudeh. Clinical Chemistry William Marshall

Chapter 13. Plasma Proteins and Enzymes. Lecturer: Dr Abeer Shnoudeh. Clinical Chemistry William Marshall Chapter 13 Plasma Proteins and Enzymes Lecturer: Dr Abeer Shnoudeh Clinical Chemistry William Marshall Introduction Measurement of Plasma Proteins Total Plasma Protein concentration of total protein in

More information

AAV Apolipoprotein D APOD Lipid transport AAA Complement C3 C3 Inflammatory response/complement

AAV Apolipoprotein D APOD Lipid transport AAA Complement C3 C3 Inflammatory response/complement Supplementry Tble 1. Smple 1 A25T + CSF. AAA52992.1 Immunoglobulin mu chin Inflmmtory response/complement 2 126 1.13 AAV38664.1 Apolipoprotein D APOD Lipid trnsport 2 150 0.82 AAA85332.1 Complement C3

More information

Antibody-Cytokine- Autoimmune

Antibody-Cytokine- Autoimmune Antibody-Cytokine- Autoimmune Surasak Wongratanacheewin, Ph.D Dean, Graduate School, KKU Microbiology, Faculty of Medicine, KKU sura_wng@kku.ac.th การอบรมหล กส ตรประกาศน ยบ ตรการข นทะเบ ยนช วว ตถ ว นท

More information

An#body structure & func#on

An#body structure & func#on An#body structure & func#on Objec&ves You should be able to: ü Define an&body ü Describe an&body structure ü Compare between different types or classes of an&body and their func&on An#bodies = Immunoglobulin

More information

Blood. Water compartments

Blood. Water compartments Blood Water compartments 2/8 about 60% of our body is water (young-old, male-female) water is located in compartments, movement is regulated intracellular : extracellular 2:1, i.e. 40:20% interstitial

More information

Blood coagulation and fibrinolysis. Blood clotting (HAP unit 5 th )

Blood coagulation and fibrinolysis. Blood clotting (HAP unit 5 th ) Blood coagulation and fibrinolysis Blood clotting (HAP unit 5 th ) Vessel injury Antithrombogenic (Favors fluid blood) Thrombogenic (Favors clotting) 3 Major systems involved Vessel wall Endothelium ECM

More information

Blood Cells Med Terms Quiz

Blood Cells Med Terms Quiz Blood Cells Med Terms Quiz Question Prompt: 1 Mononuclear white blood cells (agranulocyte) formed in lymph tissue, also a phagocyte and a precursor of macrophages are leukocytes. True False Question Prompt:

More information

Supplementary Table 1: Motor-clutch gene mrna expression Myosin Motors

Supplementary Table 1: Motor-clutch gene mrna expression Myosin Motors Supplementary Table 1: Motor-clutch gene mrna expression Myosin Motors Symbol Description Expression Rank MYL6 myosin, light chain 6, alkali, smooth muscle and non-muscle 11903 79 MYH9 myosin, heavy chain

More information

Chapter 19: The Cardiovascular System: The Blood. Copyright 2009, John Wiley & Sons, Inc.

Chapter 19: The Cardiovascular System: The Blood. Copyright 2009, John Wiley & Sons, Inc. Chapter 19: The Cardiovascular System: The Blood Blood Liquid connective tissue 3 general functions 1. Transportation Gases, nutrients, hormones, waste products 2. Regulation ph, body temperature, osmotic

More information

Blood clotting. Subsequent covalent cross-linking of fibrin by a transglutaminase (factor XIII) further stabilizes the thrombus.

Blood clotting. Subsequent covalent cross-linking of fibrin by a transglutaminase (factor XIII) further stabilizes the thrombus. Blood clotting It is the conversion, catalyzed by thrombin, of the soluble plasma protein fibrinogen (factor I) into polymeric fibrin, which is deposited as a fibrous network in the primary thrombus. Thrombin

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz )

Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Biochemistry Submitted by Marie Havlová on 8. February 2012-0:00 Syllabus of Biochemistry Mechanisms of enzyme catalysis.

More information

Primary Exam Physiology lecture 5. Haemostasis

Primary Exam Physiology lecture 5. Haemostasis Primary Exam Physiology lecture 5 Haemostasis Haemostasis Body s response for the prevention and cessation of bleeding. Broadly consists of: Primary Haemostasis - vascular spasm and platlet plug formation

More information

Chapter 1. General introduction

Chapter 1. General introduction Chapter 1 General introduction 8 Haemostasis All organs and tissues of higher organisms are provided with nutrients and oxygen through the bloodstream. The bloodstream is an extensive vascular system that

More information

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018 Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette Liz Mason Kunming, China 26 th October 2018 CONTENT 1. Background Biomarkers of exposure and effect

More information

Innate vs Adaptive Response

Innate vs Adaptive Response General Immunology Innate vs Adaptive Response Innate- non-specific (4 types of barriers) anatomic- ato mechanical ca (skin), ph, mucous, normal flora Physiologic- temperature, ph, chemicals (lysozyme,

More information

This slide belongs to iron lecture and it is to clarify the iron cycle in the body and the effect of hypoxia on erythropoitein secretion

This slide belongs to iron lecture and it is to clarify the iron cycle in the body and the effect of hypoxia on erythropoitein secretion This slide belongs to iron lecture and it is to clarify the iron cycle in the body and the effect of hypoxia on erythropoitein secretion Topics of today lectures: Hemostasis Meaning of hemostasis Mechanisms

More information

Mimi Roy, PhD Senior Director & Site Head Caprion Proteomics US LLC. ISBER, Orlando May 23, 2014

Mimi Roy, PhD Senior Director & Site Head Caprion Proteomics US LLC. ISBER, Orlando May 23, 2014 Controlled Analysis of Preanalytical Variables in CSF and Blood Sample Collection, Processing and Storage: Implications for Best Practices in Clinical Research Mimi Roy, PhD Senior Director & Site Head

More information

A. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters

A. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters A. Blood is considered connective tissue. RBC A. Blood volume and composition 1. Volume varies - average adult has 5 liters 2. 45% cells by volume called hematocrit (HCT) a. red blood cells (RBC) mostly

More information

Chapter 19(1) An Introduction to the Circulatory System and Blood

Chapter 19(1) An Introduction to the Circulatory System and Blood Chapter 19(1) An Introduction to the Circulatory System and Blood Circulatory System VS Cardiovascular System circulatory system = heart, blood vessels and blood cardiovascular system = heart and blood

More information

General Features. Originates mostly from mesoderm. Composed of cells, fibres and extracellular matrix. Highly vascular. Variable regenerative power.

General Features. Originates mostly from mesoderm. Composed of cells, fibres and extracellular matrix. Highly vascular. Variable regenerative power. Connective Tissue General Features Originates mostly from mesoderm. Composed of cells, fibres and extracellular matrix. Highly vascular. Variable regenerative power. Functions of Connective Tissue Support:

More information

Biology 218 Human Anatomy. Adapted form Martini Human Anatomy 7th ed. Chapter 20 The Cardiovascular System: Blood

Biology 218 Human Anatomy. Adapted form Martini Human Anatomy 7th ed. Chapter 20 The Cardiovascular System: Blood Adapted form Martini Human Anatomy 7th ed. Chapter 20 The Cardiovascular System: Blood Introduction The cardiovascular system functions as a system to transport numerous substances throughout the body

More information

10. Which of the following immune cell is unable to phagocytose (a) neutrophils (b) eosinophils (c) macrophages (d) T-cells (e) monocytes

10. Which of the following immune cell is unable to phagocytose (a) neutrophils (b) eosinophils (c) macrophages (d) T-cells (e) monocytes Chapter 2. Acute and chronic inflammation(6): 1. In acute inflammation, which events occur in the correct chronological order? (Remembered from 2000, 2004 exam.) p50 (a) transient vasoconstriction, stasis

More information

Healing & Repair. Tissue Regeneration

Healing & Repair. Tissue Regeneration Healing & Repair Dr. Srikumar Chakravarthi Repair & Healing: Are they same? Repair :Regeneration of injured cells by cells of same type, as with regeneration of skin/oral mucosa (requires basement membrane)

More information

Hemostasis and. Blood Coagulation

Hemostasis and. Blood Coagulation Hemostasis and Blood Coagulation Events in Hemostasis The term hemostasis means prevention of blood loss. Whenever a vessel is severed or ruptured, hemostasis is achieved by several mechanisms: (1) vascular

More information

PHASES OF HAEMOSTASIS

PHASES OF HAEMOSTASIS HAEMOSTASIS Maintains the integrity of a closed, highpressure circulatory system after vascular damage Vessel Wall Injury events in the vessel wall and in the blood which seal breach Delicate balance exists

More information

Connective Tissue Part-2. Dr. Heba Kalbouneh Assistant Professor of Anatomy and Histology

Connective Tissue Part-2. Dr. Heba Kalbouneh Assistant Professor of Anatomy and Histology Connective Tissue Part-2 Dr. Heba Kalbouneh Assistant Professor of Anatomy and Histology 1 Features Composed of cells, fibers and extracellular matrix. Highly vascular Variable regenerative power Originates

More information

INFLAMMATION & REPAIR

INFLAMMATION & REPAIR INFLAMMATION & REPAIR Lecture 7 Chemical Mediators of Inflammation Winter 2013 Chelsea Martin Special thanks to Drs. Hanna and Forzan Course Outline i. Inflammation: Introduction and generalities (lecture

More information

Separation of Main Proteins in Plasma and Serum

Separation of Main Proteins in Plasma and Serum BCH 471 Experiment (2) Separation of Main Proteins in Plasma and Serum PLASMA PROTEINS Mw The main plasma proteins are: þ Albumin (36-50 g/l), Mw 66.241kDa. þ Globulins (18-32 g/l), Mw of globulins Cover

More information

Analyte Specimen Demographic Reference Range Units

Analyte Specimen Demographic Reference Range Units Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3

More information

Supporting information. for. Facile synthesis of enzyme-inorganic hybrid nanoflowers and

Supporting information. for. Facile synthesis of enzyme-inorganic hybrid nanoflowers and Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Facile synthesis of enzyme-inorganic hybrid nanoflowers and their

More information

Like other Biological Macromolecules such as polysaccharides and nucleic acids, Proteins are essential parts of all living organisms and participate

Like other Biological Macromolecules such as polysaccharides and nucleic acids, Proteins are essential parts of all living organisms and participate Like other Biological Macromolecules such as polysaccharides and nucleic acids, Proteins are essential parts of all living organisms and participate in every process within cells. The RDA of protein intake

More information

The source of protein structures is the Protein Data Bank. The unit of classification of structure in SCOP is the protein domain.

The source of protein structures is the Protein Data Bank. The unit of classification of structure in SCOP is the protein domain. UNIT 14 PROTEINS DEFINITION A large molecule composed of one or more chains of amino acids in a specific order; the order is determined by the base sequence of nucleotides in the gene that codes for the

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

Cardiovascular System Blood

Cardiovascular System Blood Cardiovascular System Blood William T. Budd Virginia Commonwealth University Center for the Study of Biological Complexity Medical Careers College Objectives What is blood? Review metabolism Functions

More information

Development of B and T lymphocytes

Development of B and T lymphocytes Development of B and T lymphocytes What will we discuss today? B-cell development T-cell development B- cell development overview Stem cell In periphery Pro-B cell Pre-B cell Immature B cell Mature B cell

More information

CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products.

CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products. CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products Table of Contents Major Current And Emerging Cancer Diagnostic Tests 1. Introduction

More information

Journal Name RSC ARTICLE

Journal Name RSC ARTICLE Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2014 Journal Name RSC Significance of surface charge and shell material of Superparamagnetic

More information