Wnt signaling enhances the activation and survival of human hepatic stellate cells
|
|
- Charlene Anthony
- 6 years ago
- Views:
Transcription
1 FEBS Letters 581 (2007) Wnt signling enhnces the ctivtion nd survivl of humn heptic stellte cells Sun Jung Myung, Jung-Hwn Yoon, *, Geum-Youn Gwk, Won Kim, Jeong-Hoon Lee, Kng Mo Kim, Chn Soo Shin, J June Jng, Sung-Hee Lee, Soo-Mi Lee, Hyo-Suk Lee Deprtment of Internl Medicine nd Liver Reserch Institute, Seoul Ntionl University College of Medicine, Seoul, Repulic of Kore Deprtment of Pthology, Seoul Ntionl University College of Medicine, Seoul, Repulic of Kore Received 25 Jnury 2007; revised 9 My 2007; ccepted 18 My 2007 Aville online 29 My 2007 Edited y Veli-Pekk Lehto Astrct Wnt signling ws implicted in pulmonry nd renl firosis. Since Wnt ctivity is enhnced in liver cirrhosis, Wnt signling my lso prticipte in heptic firogenesis. Thus, we determined if Wnt signling modultes heptic stellte cell (HSC) ctivtion nd survivl. Wnt3A tretment significntly ctivted humn HSCs, while this ws inhiited in secreted frizzled-relted protein 1 () overexpressing cells. Wnt3A tretment significntly suppressed TRAIL-induced poptosis in HSCs versus over-expressing cells. Prticulrly, cspse 3 ws more ctivted in over-expressing cells following TRAIL nd Wnt3A tretment. These oservtions imply tht Wnt signling promotes heptic firosis y enhncing HSC ctivtion nd survivl. Ó 2007 Federtion of Europen Biochemicl Societies. Pulished y Elsevier B.V. All rights reserved. Keywords: Heptic stellte cell; Firosis; Wnt; Secreted frizzled-relted protein 1; Apoptosis 1. Introduction Heptic firosis is common wound-heling response to chronic liver injuries, including persistent virl infection, lcoholic or drug toxicity nd hereditry metl overlod [1]. Activted heptic stellte cells (HSCs) re the most importnt source of extrcellulr mtrix proteins during this firotic process [2]. Therefore, the mjority of nti-firotic therpies re designed to inhiit the ctivtion, prolifertion, or synthetic products of HSCs. More recently, the selective induction of HSC poptosis y TRAIL (tumor necrosis fctor-relted poptosis-inducing lignd) hs een proposed s n nti-firotic tretment [3]. Verterte Wnt nd Drosophil wingless re homologous genes, nd their protein products hve een shown to prticipte in the regultion of cellulr differentition, prolifertion, nd polrity [4]. More recently, Wnt signling ws implicted in humn firosing diseses, such s pulmonry nd renl firosis [5,6]. Given tht Wnt ctivity is enhnced in liver cirrhosis [7], it is lso likely tht Wnt signling prticiptes in heptic firogenesis. Secreted frizzled-relted proteins (sfrps) re solule proteins tht re cple of inding to Wnt nd its receptor, frizzled (Fz), * Corresponding uthor. Fx: E-mil ddress: yoonjh@snu.c.kr (J.-H. Yoon). nd therey, interfere with Wnt signling [8]. Diverse sfrp fmily memers exhiit distinctive expression ptterns, nd modulte vrious spects of Wnt signling. In prticulr, plys prominent role in the regultion of cellulr poptosis, differentition, nd ngiogenesis [4,8]. If Wnt ctivtion promotes heptic firosis, the inhiition of this signling y sfrp is likely to ttenute the Wnt-dependent ctivtion of heptic firosis. In the present study, we hypothesized tht Wnt signling promotes heptic firosis, nd tht the inhiition of this signling y sfrp ttenutes the Wnt-dependent ctivtion of heptic firosis. To test this hypothesis, we formulted the following questions: (i) Are Wnt receptors expressed in humn HSCs? (ii) Does Wnt signling enhnce the ctivtion or nti-poptotic signling of HSCs? And if so, (iii) Does sfrp inhiit these Wntdependent processes in HSCs? Collectively, our results demonstrte tht Wnt signling does prticipte in heptic firosis y enhncing HSC ctivtion nd survivl, nd tht this process is effectively prevented y over-expression, thus suggesting tht the selective interruption of this signling pthwy my provide n efficient nti-firotic strtegy in heptic firosis. 2. Mterils nd methods 2.1. Cell culture nd regents LX-2 cells, n immortlized humn HSC line, were used in this study, nd were cultured in Dulecco s modified Egle medium (DMEM) supplemented with 10% fetl ovine serum, 100,000 U/L penicillin, 100 mg/l streptomycin, nd 100 nm insulin. Cells were plted t cells/well in 1 ml of medi or 10 6 cells in 5 ml of medi in 6-well plte or 100-mm culture dish, respectively. Wnt3A-conditioned or medium ws prepred from stly trnsfected mouse L cell clone, which secreted solule Wnt3A proteins into the medium, or L cells, respectively, s previously descried with minor modifiction [9], nd ws diluted to finl concentrtion of 30%. TRAIL ws purchsed from Alexis (Sn Diego, CA) Isoltion of HSCs from norml humn liver tissues HSCs were isolted from norml dult liver specimen otined during the surgicl resection of metsttic tumor y collgense/pronse digestion, followed y density grdient centrifugtion using Nycodenz, s descried previously [10]. The purity of the isolted HSCs, s determined y vitmin A utofluorescence, ws more thn 97% t 24 h fter plting. The humn mteril used in this study ws normlly discrded specimen, nd the study protocol ws pproved y the Institutionl Review Bord of Seoul Ntionl University Hospitl Reverse trnscription-polymerse chin rection (RT-PCR) Totl RNA ws extrcted from cells using Trizol Regent (Invitrogen, Crlsd, CA). cdna templtes were prepred using oligo-dt rndom primers nd MoMLV (Moloney Murine Leukemi Virus) /$32.00 Ó 2007 Federtion of Europen Biochemicl Societies. Pulished y Elsevier B.V. All rights reserved. doi: /j.feslet
2 S.J. Myung et l. / FEBS Letters 581 (2007) reverse trnscriptse. PCR ws performed using primers specific for the Fz genes (forwrd, 5 0 -cgcgtcttgcccgccgtcc; reverse, ctgcgccgctcttcgtgtcctg) [11]. To exclude the possiility of the presence of genomic DNA in the rection, we performed rections without the RT step. RT-PCR products were sucloned using TOPO TA cloning kits (Invitrogen). Positive clones were sequenced using n ABI PRISM Ò 377 Genetic Anlyzer (Applied Biosystems, Sn Frncisco), nd genes were identified y BLAST serching Vectors The cdna clone ws gift from Dr. Jeremy Nthns (Johns Hopkins University, Bltimore, MD). A hemgglutinin epitope ws incorported t the C-terminl of y PCR, nd then ligted into the BglII/EcoRI site of pmscv-ires-gfp retrovirl vector ( gift from Neil A. Clipstone, Northwestern University, Chicgo, IL) upstrem of IRES to give pmscv--ires-gfp Retrovirus genertion nd trnsduction For the trnsient genertion of VSV-G pseudo-typed retrovirus, 293T cells were trnsfected with pmd-gg-pol, pmd-vsvg (oth gifts from Dr. Richrd C. Mullign (Hrvrd Medicl School, Boston, MA)) nd the retrovirl vectors pmscv--ires-gfp or pmscv-ires-gfp using LipofectAMINE Plus regents (Invitrogen, Crlsd, CA). LX-2 cells were trnsduced with virus-contining superntnts in the presence of 8 lg/ml of Polyrene for 6 h nd cells were collected 48 h lter. GFP-positive frctions were FACS-sorted using BD FACS Vntge Cell Sorter (Frnklin Lkes, NJ) Reporter gene ssy Cells were cotrnsfected over 24 h using 20 ng TK Renill-CMV nd 0.2 lg TCF reporter plsmid (Upstte Biotechnology Inc., Lke Plcid, NY). Firefly nd Renill luciferse ctivities were quntitted using dul luciferse reporter ssy system (Promeg, Mdison, WI). Dt re expressed s rtios of firefly to Renill luciferse ctivity Rel-time PCR Totl RNA ws extrcted nd cdna templtes were prepred s descried ove. Collgen 1 mrna ws quntitted using rel-time PCR technology nd the following primers: forwrd, 5 0 -ctgccccgtg, reverse, 5 0 -cttgtttcctgtgtcttctgg. Universl 18S primers (Amion Inc., Austin, TX) were used s for RNA integrity nd s housekeeping gene. For quntittion, we used rel-time PCR (LightCycler, Roche Moleculr Biochemicls, Mnnheim, Germny) nd SYBR green s the fluorophore (Moleculr Proes, Eugene, OR) Apoptosis Apoptosis ws induced in LX2 cells using TRAIL [3], nd ssessed y exmining chrcteristic nucler chnges (i.e., chromtin condenstion nd nucler frgmenttion) using the nucler inding dye 4 0,6- dimidino-2-phenylindole dihydrochloride (DAPI) nd fluorescence microscopy (Zeiss, Germny) Immunolotting Cell lystes were resolved y SDS PAGE, nd lotted using pproprite primry ntiodies nd peroxidse-conjugted secondry ntiodies (Biosource Interntionl, Cmrillo, CA). The primry ntiodies used were; rit nti-cspse 9 from Cell Signling Technology Inc. (Beverly, MA); rit nti-cspse 8, mouse nti-cytochrome c nd rit nti-cspse 3 from Phrmingen (Sn Diego, CA); mouse nti--smooth muscle ctin from BioGenex (Sn Rmon, CA); nd rit nti- nd got nti--ctin from Snt Cruz Biotechnology Inc. (Snt Cruz, CA) Immunoprecipittion nlysis Cells were treted with Wnt3A-conditioned medi for 24 h, nd poptosis ws induced using TRAIL. The cell lystes otined were mixed with nti-ser for XIAP (X chromosome-linked inhiitor of poptosis protein) (Cell Signling Technology Inc.), nd then incuted overnight t 4 C. Immune complexes were immunoprecipitted with protein A/G PLUS-Agrose (Snt Cruz) nd then wshed for 5 10 min with 1 ml of wshing uffer. After wshing, polypeptides were resolved y oiling with Lemmli smple uffer, nd then immunolotted for cspse Sttisticl nlysis All numericl dt represent t lest three independent experiments using cells from minimum of three seprte isoltions nd re expressed s mens ± S.D. Groups were compred using two-tiled Student s t-tests. 3. Results 3.1. Identifiction of Wnt receptors in humn HSCs RT-PCR using primers tht ind to the conserved sequences of ll Fz genes were used to visulize the expressions of these genes in oth LX-2 cells nd primrily isolted humn HSCs (Fig. 1). PCR products from LX-2 cells were cloned using the TA cloning procedure, nd rndom clones were nlyzed y sequencing. Six out of sixteen clones sequenced were identified s contining Fz gene sequences, such s Fz-2, Fz-7, nd Fz-10, y BLAST serching (Fig. 1). These findings indicte tht humn HSCs re cple of responding to Wnt stimulus Estlishment of humn HSC line over-expressing To inhiit Wnt signling in HSCs, we estlished humn HSC line over-expressing y infecting LX-2 cells with n /GFP expression vector nd y the flow cytometric cloning of GFP-expressing cells. over-expression in these cells ws confirmed y immunolot nlysis (Fig. 2) Functionl nlysis of Wnt ctivity in humn HSCs We next evluted whether cnonicl Wnt signling is functionlly ctive in humn HSCs, nd whether this is inhiited in over-expressing cells. For this purpose, cells were stimulted using Wnt3A, which is cple of ctivting the cnonicl Wnt pthwy. Cnonicl Wnt signling ctivity ws evluted y TOPflsh TCF-luciferse reporter gene ssy. Following Wnt3A-conditioned medi tretment, twofold increse in TOPflsh reporter gene ctivity ws oserved in cells, wheres this ws significntly suppressed in over-expressing cells (Fig. 2). These findings indicte tht the cnonicl Wnt signling pthwy is functionlly ctive in humn HSCs Wnt regultion of HSC ctivtion The expressions of collgen 1 nd -smooth muscle ctin (firosis-relted mrkers during HSC ctivtion) were compred in nd over-expressing HSCs. Tretment of cells with Wnt3A-conditioned medi for 24 h incresed collgen 1 mrna levels, wheres this ws not oserved in over-expressing cells (Fig. 3). In similr wy, -smooth muscle ctin expression ws incresed in cells following Wnt3A tretment, wheres this ws not evident in over-expressing cells (Fig. 3). These findings indicte cnonicl Wnt signling prticiptes in HSC ctivtion Wnt signling in HSC poptosis We next evluted if Wnt signling modultes HSC survivl y regulting cellulr poptotic processes. When cells were
3 2956 S.J. Myung et l. / FEBS Letters 581 (2007) Fig. 1. Expression of Fz (frizzled) gene fmilies in humn HSCs. () Totl cellulr RNA ws isolted from LX-2 cells nd HSCs otined from resected humn liver. Reverse trnscription PCR ws performed using primers specific for the Fz gene. NC, negtive. () RT-PCR products of LX2 cells were sucloned nd sequenced. Expressed Fz genes were identified y BLAST serching. F/Rrtio β-ctin p < 0.05 p < KD Collgen α1/18s rtio p < 0.05 p < h Control Control h 0 Wnt3A-CM(-) Wnt3A-CM(+) Wnt3A-CM(+) Fig. 2. Estlishment of humn HSC line over-expressing. () LX-2 cells were either infected with retrovirl vector pmscv- IRES-GFP or pmscv--ires-gfp encoding. GFPexpressing cells were then flow cytometriclly cloned. Lystes of nd over-expressing cells were immunolotted with nti- nd nti--ctin ntiodies. () Control nd overexpressing cells were cotrnsfected with TK Renill-CMV nd TCF reporter plsmid. Cells were then treted with Wnt3A-conditioned medi (CM) for 24 h. Both firefly nd Renill luciferse ctivities were quntitted using dul luciferse reporter ssy system. Dt re expressed s rtios of firefly to Renill luciferse ctivity. α -smooth muscle ctin β-ctin Fig. 3. Wnt regultion of HSC ctivtion. () Control nd over-expressing cells were treted with Wnt3A-CM for the indicted times. Totl cellulr RNA ws isolted nd rel-time PCR ws then performed. Results re expressed s rtios of collgen 1 product copies/ml to 18S copies/ml, ssuming tht of the time 0 s 1. All dt re expressed s the mens ± S.D. of five individul experiments. () Control nd over-expressing cells were treted with Wnt3A- CM for the indicted times. Cells were then lysed nd immunolot nlysis ws performed for -smooth muscle ctin nd -ctin. treted with TRAIL, Wnt3A incution significntly suppressed cellulr poptosis in cells versus over-expressing cells (Fig. 4). As shown in Fig. 4, TRAILinduced cspse 8, cytochrome c, nd cspse 9 modultions were similr in nd over-expressing cells, wheres cspse 3 ctivtion ws more enhnced in over-expressing cells thn in cells (Fig. 4). To further chrcterize the mechnism underlying enhnced cspse 3 ctivtion in these cells, we immunoprecipitted XIAP from cell lystes, nd then immunolotted these precipittes with
4 S.J. Myung et l. / FEBS Letters 581 (2007) cspse 8 cytochrome c cspse 9 Control h 55KD 15KD 47KD 35KD TRAIL cspse 9 XIAP PC Control + _ + _ + 47KD 35KD 53KD cspse 3 β-ctin 18KD IP:XIAP Fig. 4. Wnt signling nd HSC poptosis. () Control nd over-expressing cells were incuted with or without Wnt3A-CM for 24 h. Cells were then incuted with TRAIL for 9 h. Apoptosis ws quntitted y DAPI stining nd fluorescence microscopy. Dt re expressed s the mens ± S.D. of three individul experiments. () Control nd over-expressing cells were treted with Wnt3A-CM for 24 h. Cells were then incuted with TRAIL (100 ng/ml) for the indicted times. Immunolotting ws performed using the indicted ntiodies. (c) Control nd over-expressing cells were treted with Wnt3A-conditioned medi for 24 h, nd then incuted with or without TRAIL (100 ng/ml) for 4 h. XIAP ws immunoprecipitted from whole cell lystes, nd these precipittes were immunolotted for cspse 9 nd XIAP. PC, positive, TRAILtreted whole cell lystes. cspse 9. As shown in Fig. 4c, TRAIL tretment induced complex formtion etween XIAP nd ctive cspse 9 in cells, wheres this ws diminished in over-expressing cells. Therefore, these oservtions collectively indicte tht cnonicl Wnt signling exerts n nti-poptotic effect in HSCs y regulting complex formtion etween XIAP nd cspse 9, thus enhncing HSC survivl. 4. Discussion The principl finding of this study reltes to Wnt signling during heptic firosis. Our results collectively demonstrte tht Wnt signling prticiptes in heptic firosis y enhncing HSC ctivtion nd y cting s n nti-poptotic signl in these cells. This study demonstrtes tht memrnous receptors for Wnt lignds, which re memers of the Fz gene fmily, re expressed in humn HSCs. In prticulr, t lest three different memers of Fz (Fz-2, -7, nd -10) re expressed in these cells. However, using the sme methodology used for detecting Fz gene expression, we were unle to detect Wnt gene expression in these cells (dt not shown). In view of the high sensitivity of RT-PCR, it is likely tht HSCs do not secrete Wnt proteins. However, since heptocytes re le to produce Wnt proteins [12], Fz expression in HSCs in this study implies tht these cells re likely to respond to Wnt proteins within the liver. Wnt proteins hve een grouped into two clsses, i.e., cnonicl nd non-cnonicl clsses. Cnonicl Wnts (e.g. Wnt1, Wnt3A nd Wnt8) stilize -ctenin, nd thus ctivte the trnscriptions of TCF/LEF trget genes, wheres noncnonicl Wnts (e.g., Wnt4, Wnt5A nd Wnt11) ctivte other signling pthwys, such s the plnr-cell-polrity-like pthwy nd the Wnt/C 2+ pthwy [13]. In ddition, the extrcellulr ntgonists of Wnt signling pthwy re clssified into two groups, i.e., the sfrp nd the Dickkopf fmily [8]. In this study, we used n -overexpressing system to inhiit Wnt signling, since hs previously een shown to ply prominent role in the regultion of cellulr poptosis, differentition nd ngiogenesis in mny tissues [4,8]. Moreover, our findings demonstrte tht TCF/LEF-dependent trnscriptionl ctivity ws incresed in HSCs treted with Wnt3A, nd tht this trnscriptionl ctivity ws significntly reduced in over-expressing cells. These oservtions, therefore, indicte tht cnonicl Wnt signling is ctive in HSCs, nd tht functions s cnonicl Wnt ntgonist in these cells. Moreover, the ctivtion of cnonicl Wnt signling in this study resulted in HSC ctivtion, which led to incresed collgen 1 nd -smooth muscle ctin expression. In ddition, our study demonstrted tht Wnt signl ctivtion ttenuted HSC poptosis. Thus these results collectively suggest tht cnonicl Wnt signling is ctive in HSCs nd tht it prticiptes in heptic firosis y enhncing HSC ctivtion nd survivl. It hs een rgued tht is likely to e iphsic modultor of Wnt signling [14]. However, over-expression in this study efficiently pertured cnonicl Wnt signl-dependent HSC ctivtion. In ddition, over-expression in the present study enhnced TRAIL-induced HSC poptosis. In ctivted HSCs, TRAIL induces poptosis y ctivting TRAIL receptor-dependent pro-poptotic signls [3]. We oserved tht TRAIL-induced cspse 8, cytochrome c, nd cspse 9 modultions were similr in nd -overexpressing cells, wheres cspse 3 ctivtion ws significntly
5 2958 S.J. Myung et l. / FEBS Letters 581 (2007) higher in over-expressing cells tht in s. Severl cytoplsmic proteins re criticlly involved in the regultion of the cytochrome c/apf-1 cspse ctivting pthwy. Inhiitors of poptosis proteins (IAPs) including XIAP hve een shown to ind procspse 9, preventing its ctivtion, nd to ind directly with nd inhiit ctive cspse 9 [15]. Therefore, it is likely tht complex formtion etween IAPs nd cspse 9 might e modulted in over-expressing cells. Indeed, the present study demonstrtes tht this complex formtion etween XIAP nd cspse 9 ws diminished in these cells. In prticulr, ctive cspse 9 (37, 35 KD) inding with XIAP ws reduced in these cells (Fig. 4c). This oservtion suggests tht more ctive cspse 9 cn ct on procspse 3 in these cells, nd tht this enhnces cspse 3 ctivtion. Therefore, these findings indicte tht cnonicl Wnt signling exerts n nti-poptotic effect in HSCs y regulting complex formtion etween XIAP nd cspse 9. In conclusion, our results demonstrte tht cnonicl Wnt signling is ctive in HSCs nd tht it prticiptes in heptic firosis y promoting HSC ctivtion nd survivl. Moreover, since this process ws effectively prevented y forced expression, the interruption of cnonicl Wnt signls my therpeuticlly e useful s n nti-firotic strtegy in the liver. References [1] Friedmn, S.L. (2000) Moleculr regultion of heptic firosis, n integrted cellulr response to tissue injury. J. Biol. Chem. 275, [2] Wells, R.G. (2005) The role of mtrix stiffness in heptic stellte cell ctivtion nd liver firosis. J. Clin. Gstroenterol. 39, S158 S161. [3] Timr, P., Higuchi, H., Kocov, E., Rippe, R.A., Friedmn, S. nd Gores, G.J. (2003) Activted stellte cells express the TRAIL receptor-2/deth receptor-5 nd undergo TRAIL-medited poptosis. Heptology 37, [4] Logn, C.Y. nd Nusse, R. (2004) The Wnt signling pthwy in development nd disese. Annu. Rev. Cell Dev. Biol. 20, [5] Morrisey, E.E. (2003) Wnt signling nd pulmonry firosis. Am. J. Pthol. 162, [6] Surendrn, K., McCul, S.P. nd Simon, T.C. (2002) A role for Wnt-4 in renl firosis. Am. J. Physiol. Renl. Physiol. 282, F431 F441. [7] Shckel, N.A., McGuinness, P.H., Aott, C.A., Gorrell, M.D. nd McCughn, G.W. (2001) Identifiction of novel molecules nd pthogenic pthwys in primry iliry cirrhosis: cdna rry nlysis of intrheptic differentil gene expression. Gut 49, [8] Kwno, Y. nd Kypt, R. (2003) Secreted ntgonists of the Wnt signlling pthwy. J. Cell Sci. 116, [9] Willert, K., Brown, J.D., Dnenerg, E., Duncn, A.W., Weissmn, I.L., Rey, T., Ytes 3rd, J.R. nd Nusse, R. (2003) Wnt proteins re lipid-modified nd cn ct s stem cell growth fctors. Nture 423, [10] Lim, Y.S., Kim, K.A., Jung, J.O., Yoon, J.H., Suh, K.S., Kim, C.Y. nd Lee, H.S. (2002) Modultion of cytokertin expression during in vitro cultivtion of humn heptic stellte cells: evidence of trnsdifferentition from epithelil to mesenchyml phenotype. Histochem. Cell Biol. 118, [11] Helmrecht, K., Kispert, A., von Wsielewski, R. nd Brnt, G. (2001) Identifiction of Wnt/et-ctenin signling pthwy in humn thyroid cells. Endocrinology 142, [12] Zeng, G., Awn, F., Otru, W., Muller, P., Apte, U., Tn, X., Gndhi, C., Demetris, A.J. nd Mong, S.P. (2007) Wnt er in liver: expression of Wnt nd frizzled genes in mouse. Heptology 45, [13] Gordon, M.D. nd Nusse, R. (2006) Wnt signling: multiple pthwys, multiple receptors, nd multiple trnscription fctors. J. Biol. Chem. 281, [14] Uren, A., Reichsmn, F., Anest, V., Tylor, W.G., Muriso, K., Bottro, D.P., Cumerledge, S. nd Ruin, J.S. (2000) Secreted frizzled-relted protein-1 inds directly to Wingless nd is iphsic modultor of Wnt signling. J. Biol. Chem. 275, [15] Roy, N., Deverux, Q.L., Tkhshi, R., Slvesen, G.S. nd Reed, J.C. (1997) The c-iap-1 nd c-iap-2 proteins re direct inhiitors of specific cspses. Emo J. 16,
Supplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationReduced WIF-1 Expression Stimulates Skin Hyperpigmentation in Patients with Melasma
See relted commentry on pg ORIGINAL ARTICLE Reduced WIF- Expression Stimultes Skin Hyperpigmenttion in Ptients with Melsm Ji-Young Kim, Te-Ryong Lee nd Ai-Young Lee The expression of Wnt inhiitory fctor-
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
More informationAnti-proliferative and pro-apoptotic effects of tectorigenin on hepatic stellate cells
Online Sumissions: http://www.wjgnet.com/17-9327office wjg@wjgnet.com doi:1.3748/wjg.v16.i31.3911 World J Gstroenterol 21 August 21; 16(31): 3911-3918 ISSN 17-9327 (print) 21 Bishideng. All rights reserved.
More informationSupplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationTLR7 induces anergy in human CD4 + T cells
TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationSupplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
More informationSUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
More information% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %
Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts
More informationTwo-step activation of FOXO3 by AMPK generates a coherent feed-forward loop determining excitotoxic cell fate
(22), 2 & 22 Mcmilln Pulishers Limited All rights reserved 35947/2 www.nture.com/cdd Twostep ctivtion of FOXO3 y AMPK genertes coherent feedforwrd loop determining excitotoxic cell fte D Dvil, NMC Connolly
More informationCD160 inhibits activation of human CD4 + T cells through interaction with herpesvirus entry mediator
CD16 inhiits ctivtion of humn CD4 + T cells through interction with herpesvirus entry meditor Guifng Ci, Anuknth Anumnthn, Juli A Brown, Edwrd A Greenfield, Bogong Zhu & Gordon J Freemn CD16, glycosylphosphtidylinositol-nchored
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationArachidonic acid induces ERK activation via Src SH2 domain association with the epidermal growth factor receptor
http://www.kidney-interntionl.org & 6 Interntionl Society of Nephrology originl rticle Archidonic cid induces ERK ctivtion vi Src SH2 domin ssocition with the epiderml growth fctor receptor LD Alexnder
More informationThe endoplasmic reticulum is the site of cholesterol-induced cytotoxicity in macrophages
The endoplsmic reticulum is the site of cholesterol-induced cytotoxicity in mcrophges Bo Feng 1, Pin Mei Yo 1, Ynkun Li 1, Cecili M. Devlin 1, Djun Zhng 1, Hether P. Hrding 2, Michele Sweeney 3, Jmes X.
More informationIN-1130, a novel transforming growth factor-b type I receptor kinase (ALK5) inhibitor, suppresses renal fibrosis in obstructive nephropathy
originl rticle http://www.kidney-interntionl.org & 26 Interntionl Society of Nephrology see commentry on pge 12 IN-113, novel trnsforming growth fctor- type I receptor kinse (ALK) inhiitor, suppresses
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationThe effect of thalidomide on non-small cell lung cancer (NSCLC) cell lines: possible involvement in the PPARg pathway
Crcinogenesis vol.25 no.10 pp.1805--1812, 2004 doi:10.1093/crcin/gh210 The effect of thlidomide on non-smll cell lung cncer (NSCLC) cell lines: possile involvement in the PPARg pthwy Kthleen L.DeCicco,
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationResearch Article Quercetin Induces Mitochondrial Mediated Apoptosis and Protective Autophagy in Human Glioblastoma U373MG Cells
Oxidtive Medicine nd Cellulr Longevity Volume 213, Article ID 596496, 1 pges http://dx.doi.org/1.1155/213/596496 Reserch Article Quercetin Induces Mitochondril Medited Apoptosis nd Protective Autophgy
More informationARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum,
DOI:.554/5YRTIMB..3 OPPOSITE MODELS OF EXPRESSION OF ANDROGEN RECEPTOR (AR) AND RETINOIC ACID RECEPTOR-α (RAR-α) IN THE ONSET OF MALE GERM CELL DEVELOPMENT IN HORMONALLY MANIPULATED RATS E. Pvlov, N. Atnssov,
More informationNdfip-mediated degradation of Jak1 tunes cytokine signalling to limit expansion of CD4 þ effector T cells
Received 4 Jul 15 Accepted 9 Fe 16 Pulished 18 Apr 16 DOI: 1.138/ncomms116 OPEN Ndfip-medited degrdtion of Jk1 tunes cytokine signlling to limit expnsion of CD4 þ effector T cells Clire E. O Lery 1, Christopher
More informationSUPPLEMENTARY INFORMATION
Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
More informationButyrate inhibits pro-proliferative mir-92a by diminishing c-myc-induced mir-17-92a cluster transcription in human colon cancer cells
Hu et l. Moleculr Cncer (25) 4:8 DOI.86/s2943-5-45-x RESEARCH Open Access inhiits pro-prolifertive mir-92 y diminishing -induced mir-7-92 cluster trnscription in humn colon cncer cells Shien Hu, Ln Liu
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationA Cell-penetrating Peptide Suppresses Inflammation by Inhibiting NF-κB Signaling
originl rticle A Cell-penetrting Peptide Suppresses Inflmmtion y Inhiiting NF-κB Signling Yu Fu Wng 1,2, Xing Xu 1, Xi Fn 1, Chun Zhng 1, Qing Wei 1, Xi Wng 1, Wei Guo 1, Wei Xing 1, Jin Yu 3, Jing-Long
More informationLeptin induces TGF-b synthesis through functional leptin receptor expressed by human peritoneal mesothelial cell
originl rticle http://www.kidney-interntionl.org & 2006 Interntionl Society of Nephrology Leptin induces TGF- synthesis through functionl leptin receptor expressed y humn peritonel mesothelil cell JCK
More informationPlatelet-derived growth factor-a receptor activation is required for human cytomegalovirus infection
Vol 455 18 Septemer 28 doi:1.138/nture729 LETTERS Pltelet-derived growth fctor- receptor ctivtion is required for humn cytomeglovirus infection Lilin Sorocenu 1, Armin Akhvn 1 & Chrles S. Cos 1,2 Humn
More informationDownregulation of Notch regulated Ankyrin Repeat Protein Exerts Antitumor Activities against Growth of Thyroid Cancer
Originl Article Downregultion of Notch regulted Ankyrin Repet Protein Exerts Antitumor Activities ginst Growth of Thyroid Cncer Bing Feng Chu 1,2, Yi Yu Qin 3, Sheng Li Zhng 2, Zhi Wei Qun 2, Ming Di Zhng
More informationLuteolin decreases IGF-II production and downregulates insulin-like growth factor-i receptor signaling in HT-29 human colon cancer cells
Lim et l. MC Gstroenterology 212, 12:9 http://www.iomedcentrl.com/1471-23x/12/9 RESERCH RTICLE Luteolin decreses IGF-II production nd downregultes insulin-like growth fctor-i receptor signling in HT-29
More informationIL-18 induction of IgE: dependence on CD4 + T cells, IL-4 and STAT6
ARTICLES IL-18 induction of IgE: dependence on CD4 + T cells, IL-4 nd STAT6 Tomohiro Yoshimoto 1,2,7, Hitoshi Mizutni 3, Hiroko Tsutsui 1, Nncy Noen-Truth 6, Kei-ichi Ymnk 3, Minoru Tnk 4, Shinzo Izumi
More informationEffects of colchicine on renal fibrosis and apoptosis in obstructed kidneys
ORIGINAL ARTICLE Koren J Intern Med 8;:568-576 https://doi.org/.9/kjim.6. Effects of colchicine on renl firosis nd poptosis in ostructed kidneys Sejoong Kim,, Eun Sook Jung, Jeonghwn Lee, Nm Ju Heo,, Ki
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationThe intrinsic prostaglandin E 2 EP 4 system of the renal tubular epithelium limits the development of tubulointerstitial fibrosis in mice
originl rticle http://www.kidney-interntionl.org & 1 Interntionl Society of Nephrology see commentry on pge 13 The intrinsic prostglndin E EP system of the renl tuulr epithelium limits the development
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationRas enhances TGF-β signaling by decreasing cellular protein levels of its type II receptor negative regulator SPSB1
Liu et l. Cell Communiction nd Signling (2018) 16:10 https://doi.org/10.1186/s12964-018-0223-4 RESEARCH Open Access Rs enhnces TGF-β signling y decresing cellulr protein levels of its type II receptor
More informationPossible new role for NF-κB in the resolution of inflammation
Possile new role for NF-κB in the resolution of inflmmtion TOBY LAWRENCE, DEREK W. GILROY, PAUL R. COLVILLE-NASH & DEREK A. WILLOUGHBY Deprtment of Experimentl Pthology, Willim Hrvey Reserch Institute,
More informationExpression of functional NK 1 receptors in human alveolar macrophages: superoxide anion production, cytokine release and involvement of NF-jB pathway
British Journl of Phrmcology (25) 45, 385 396 & 25 Nture Pulishing Group All rights reserved 7 88/5 $3. www.nture.com/jp Expression of functionl NK receptors in humn lveolr mcrophges: superoxide nion production,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationMicroRNA 17 5p induces drug resistance and invasion of ovarian carcinoma cells by targeting PTEN signaling
DOI 1.1186/s479-15-35-2 RESEARCH Open Access MicroRNA 17 5p induces drug resistnce nd invsion of ovrin crcinom cells y trgeting PTEN signling Ying Fng 1,2, Chngyn Xu 3 nd Yn Fu 1* Astrct Bckground: The
More informationGDF11 Protects against Endothelial Injury and Reduces Atherosclerotic Lesion Formation in Apolipoprotein E-Null Mice
originl rticle The Americn Society of Gene & Cell Therpy Protects ginst Endothelil Injury nd Reduces Atherosclerotic Lesion Formtion in Apolipoprotein E-Null Mice Wen Mei, Gungd Xing, Yixing Li 2, Hun
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationTumor Necrosis Factor- et Modulates Monocyte/Macrophage Apoprotein E Gene Expression
Tumor Necrosis Fctor- et Modultes Monocyte/Mcrophge Apoprotein E Gene Expression Hongwei Dun, Zhigo Li, nd Theodore Mzzone Deprtments of Medicine nd Biochemistry, Rush Medicl College, Chicgo, Illinois
More informationIGF-I and IGFBP-3 augment transforming growth factor-b actions in human renal carcinoma cells
originl rticle http://www.kidney-interntionl.org & Interntionl Society of Nephrology IGF-I nd IGFBP-3 ugment trnsforming growth fctor-b ctions in humn renl crcinom cells AH Rosendhl 1, nd G Forsberg 1
More informationDR. MARC PAGÈS Project Manager R&D Biologicals - Coccidia Projects, HIPRA
DR. MARC PAGÈS Project Mnger R&D Biologicls - Coccidi Projects, HIPRA Dr. Mrc Pgès Bosch otined Microiology nd Genetics degree t the University of Brcelon in 1998. He otined his PhD working on the synptoneml
More informationGlucose metabolism inhibits apoptosis in neurons and cancer cells by redox inactivation of cytochrome c
letters Glucose metolism inhiits poptosis in neurons nd cncer cells y redox inctivtion of cytochrome c Allyson E. Vughn 1 nd Mohnish Deshmukh 1,2,3 Neurons nd cncer cells use glucose extensively, yet the
More informationT cell intrinsic role of Nod2 in promoting type 1 immunity to Toxoplasma gondii
T cell intrinsic role of Nod in promoting type 1 immunity to Toxoplsm gondii Michel H Shw 1, Thornik Reimer 1, Crmen Sánchez-Vldepeñs, Neil Wrner 1, Yun-Gi Kim 1, Mnuel Fresno & Griel Nuñez 1 Nod elongs
More informationAspergillus fumigatus conidia inhibit tumour necrosis factor- or staurosporine-induced apoptosis in epithelial cells
Interntionl Immunology Advnce Access pulished Decemer 15, 2005 Interntionl Immunology 2005; 1 of 12 doi:10.1093/intimm/dxh356 ª The Jpnese Society for Immunology. 2005. All rights reserved. For permissions,
More informationIn Vivo AAV1 Transduction With hrheb(s16h) Protects Hippocampal Neurons by BDNF Production
originl rticle In Vivo AAV1 Trnsduction With hrhe(s16h) Protects Hippocmpl Neurons y BDNF Production Min-Te Jeon 1,2, Jin Hn Nm 3,4, Won-Ho Shin 5, Eunju Leem 1,2, Kyoung Hoon Jeong 1,2, Un Ju Jung 6,
More informationv-fps causes transformation by inducing tyrosine phosphorylation and activation of the PDGFb receptor
v-fps cuses trnsformtion y inducing tyrosine phosphoryltion nd ctivtion of the PDGF receptor Deorh H Anderson nd Preeti M Ismil Oncogene (1998) 16, 2321 ± 2331 1998 Stockton Press All rights reserved 95
More informationOvercoming EGFR T790M-based Tyrosine Kinase Inhibitor Resistance with an Allele-specific DNAzyme
Cittion: Moleculr Therpy Nucleic Acids (214) 3, e15; doi:1.138/mtn.214.3 214 The Americn Society of Gene & Cell Therpy All rights reserved 2162-2531/14 www.nture.com/mtn Overcoming T79M-sed Tyrosine Kinse
More informationGender difference in the activity but not expression of estrogen receptors a and b in human lung adenocarcinoma cells
Endocrine-Relted Cncer (26) 13 113 134 Gender difference in the ctivity ut not expression of estrogen receptors nd in humn lung denocrcinom cells Susn M Dougherty 1, Willird Mzhwidz 1, Aimee R Bohn 1,
More informationInhibition of ceramide redox signaling pathway blocks glomerular injury in hyperhomocysteinemic rats
originl rticle http://www.kidney-interntionl.org & 6 Interntionl Society of Nephrology Inhiition of cermide redox signling pthwy locks glomerulr injury in hyperhomocysteinemic rts FYi 1, AY Zhng 1,NLi
More informationComparison of pro- and anti-inflammatory responses in paired human primary airway epithelial cells and alveolar macrophages
Murk et l. Respirtory Reserch (2018) 19:126 https://doi.org/10.1186/s12931-018-0825-9 RESEARCH Comprison of pro- nd nti-inflmmtory responses in pired humn primry irwy epithelil cells nd lveolr mcrophges
More informationIrs-2 coordinates Igf-1 receptor-mediated β-cell development and peripheral insulin signalling
Irs-2 coordintes Igf-1 receptor-medited β-cell development nd peripherl insulin signlling Dominic J. Withers 1,2 *, Deorh J. Burks 1 *, Hether H. Towery 1, Shri L. Altmuro 1, Crrie L. Flint 1 & Morris
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
More informationMolecular Analysis of BRCA1 in Human Breast Cancer. Cells Under Oxidative Stress
Moleculr Anlysis of BRCA1 in Humn Brest Cncer Cells Under Oxidtive Stress Brin L. Gilmore 1, Ynping Ling 1, Crly E. Winton 1,2, Ky Ptel 1, Vsile Krgeorge 1, A. Cmeron Vrno 1,3, Willim Dernley 1, Zhi Sheng
More informationCalcineurin imposes T cell unresponsiveness through targeted proteolysis of signaling proteins
Clcineurin imposes T cell unresponsiveness through trgeted proteolysis of signling proteins Vigo Heissmeyer, Fernndo Mcián,5, Sin-Hyeog Im,5, Rjt Vrm 2, Stefn Feske, K Venuprsd 3, Hu Gu 4, Yun-Ci Liu 3,
More informationPolyxeni P Doumba 1,2, Marilena Nikolopoulou 2, Ilias P Gomatos 2, Manousos M Konstadoulakis 2 and John Koskinas 1*
Doum et l. BMC Gstroenterology 2013, 13:17 RESEARCH ARTICLE Open Access Co-culture of primry humn tumor heptocytes from ptients with heptocellulr crcinom with utologous peripherl lood mononucler cells:
More informationAntifibrotic Properties of Transarterial Oncolytic VSV Therapy for Hepatocellular Carcinoma in Rats With Thioacetamide-Induced Liver Fibrosis
originl rticle The Americn Society of Gene & Cell Therpy Antifirotic Properties of Trnsrteril Oncolytic Therpy for Heptocellulr Crcinom in Rts With Thiocetmide-Induced Liver Firosis Jennifer Altomonte
More informationARTICLE. J. E. Bowe & A. Chander & B. Liu & S. J. Persaud & P. M. Jones
Dietologi (23) 56:783 79 DOI.7/s25-2-2828-2 ARTICLE The permissive effects of glucose on receptor-operted potentition of insulin secretion from mouse islets: role for ERK/2 ctivtion nd cytoskeletl remodelling
More informationResearch Article. Mohammad Lalmoddin Mollah, Dong Ki Park, and Hye-Jin Park. 1. Introduction
Evidence-Bsed Complementry nd Alterntive Medicine Volume 212, Article ID 249217, 7 pges doi:1.1155/212/249217 Reserch Article Cordyceps militris GrownonGermintedSoybenInduces G2/M Cell Cycle Arrest through
More informationQuercetin modulates Nrf2 and glutathione-related defenses in HepG2. cells. Involvement of p38
Quercetin modultes Nrf2 nd glutthione-relted defenses in HepG2 cells. Involvement of p38 An Belén Grndo-Serrno, Mrí Angeles Mrtín, Lur Brvo, Luis Goy nd Soni Rmos* Deprtment of Metolism nd Nutrition Institute
More informationReactive oxygen species (ROS) have been proposed to serve
Protein Cronyltion s Novel Mechnism in Redox Signling Chi Ming Wong, mrit K. Cheem, Lihu Zhng, Yuichiro J. Suzuki strct Rective oxygen species serve s second messengers for signl trnsduction; however,
More informationTGF-b1 actions on FRTL-5 cells provide a model for the physiological regulation of thyroid growth
Oncogene (1998) 16, 1455 ± 1465 1998 Stockton Press All rights reserved 0950 ± 9232/98 $12.00 TGF-1 ctions on FRTL-5 cells provide model for the physiologicl regultion of thyroid growth Crmen Crneiro 1,
More informationAxl Promotes Cutaneous Squamous Cell Carcinoma Survival through Negative Regulation of Pro-Apoptotic Bcl-2 Family Members
ORIGINAL ARTICLE Axl Promotes Cutneous Squmous Cell Crcinom Survivl through Negtive Regultion of Pro-Apoptotic Bcl-2 Fmily Memers Emmnouil S. Ppdkis 1, Monik A. Cichoń 1, Jshmin J. Vys 1, Nkul Ptel 1,
More informationGene expression phenotypic models that predict the activity of oncogenic pathways
3 Nture Pulishing Group http://www.nture.com/nturegenetics Gene expression phenotypic models tht predict the ctivity of oncogenic pthwys Erich Hung,, Seiichi Ishid,7, Jennifer Pittmn,3, Holly Dressmn,,4,
More informationDendritic cells engineered to secrete anti-dcr3 antibody augment cytotoxic T lymphocyte response against pancreatic cancer in vitro
Submit Mnuscript: http://www.wjgnet.com/esps/ Help Desk: http://www.wjgnet.com/esps/helpdesk.spx DOI: 10.3748/wjg.v23.i5.817 World J Gstroenterol 2017 Februry 7; 23(5): 817-829 ISSN 1007-9327 (print) ISSN
More informationImmunoregulatory cytokines in bone marrow and peripheral blood stem cell products
Bone Mrrow Trnsplnttion, (999) 23, 53 62 999 Stockton Press All rights reserved 268 3369/99 $2. http://www.stockton-press.co.uk/mt Immunoregultory cytokines in one mrrow nd peripherl lood stem cell products
More informationSuppressor of cytokine signaling 1 regulates the immune response to infection by a unique inhibition of type I interferon activity
5 Nture Pulishing Group http://www.nture.com/ntureimmunology Suppressor of cytokine signling 1 regultes the immune response to infection y unique inhiition of type I interferon ctivity Jennifer E Fenner
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationTargeting Estrogen-Related Receptor Alpha Inhibits Epithelial-to-Mesenchymal Transition and Stem Cell Properties of Ovarian Cancer Cells
Acquired nd multigenic disese The Americn Society of Gene & Cell Therpy originl rticle Trgeting Estrogen-Relted Receptor Alph Inhiits Epithelil-to-Mesenchyml Trnsition nd Stem Cell Properties of Ovrin
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationPhosphorylated p70s6k in noninvasive low grade urothelial carcinoma of the bladder: correlation with tumor recurrence
(2014) 16, 611 617 2014 AJA, SIMM & SJTU. All rights reserved 1008-682X www.sindro.com; www.jndrology.com Mle Helth Open Access ORIGINAL ARTICLE Phosphorylted p70s6k in noninvsive low grde urothelil crcinom
More informationAntiproliferative Activity of the Chinese Medicinal Compound, Delisheng, Compared With Rg3 and Gemcitabine in HepG2 Cells
Reserch Pper Antiprolifertive Activity of the Chinese Medicinl Compound, Delisheng, Compred With Rg3 nd Gemcitine in HepG2 Cells S. H. WANG*, Y. C. WANG 1, Y. L. NIE, Y. N. HAI, H. F. SUN, Z. L. YUAN AND
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationA rapid switch in sympathetic neurotransmitter release properties mediated by the p75 receptor 2002 Nature Publishing Group
A rpid switch in sympthetic neurotrnsmitter relese properties medited y the p75 receptor Bo Yng *, John D. Slonimsky * nd Susn J. Birren Deprtment of Biology, Volen Center for Complex Systems, 415 South
More informationSignals for death and differentiation: a two-step mechanism for in vitro transformation of adult islets of Langerhans to duct epithelial structures
(23) 1, 987 996 & 23 Nture Pulishing Group All rights reserved 135-947/3 $25. www.nture.com/cdd Signls for deth nd differentition: two-step mechnism for in vitro trnsformtion of dult islets of Lngerhns
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationJu-Young Kim 1,2,3, Jong Min Baek 4, Sung-Jun Ahn 4, Yoon-Hee Cheon 1,4, Sun-Hyang Park 4, Miyoung Yang 3,4, Min Kyu Choi 3,4 and Jaemin Oh 1,2,4*
Kim et l. BMC Complementry nd Alterntive Medicine (2016) 16:301 DOI 10.1186/s12906-016-1300-0 RESEARCH ARTICLE Ethnolic extrct of Schizonepet tenuifoli ttenutes osteoclst formtion nd ctivtion in vitro
More information