Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,"

Transcription

1 a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow and bone marrow derived macrophages. c. Cell numbers of lung alveolar macrophages, neutrophils, dendrici cells, and inters99al macrophages. Error bars represent standard devia9on. All experiments were performed three 9mes with three mice per group.

2 mrna/18s WT Lysm mtor Lysm ARG1 YM1 CD26 Supplementary Figure 2. mtor LysM macrophages fail to generate M2 macrophages. RNA expression of the M2 markers YM1, Fizz1, and Arg1 by bone marrow derived macrophages skewed with IL4 and res9mulated with IL4 for 24hrs. Error bars represent standard devia9on. Experiments were performed three 9mes with five mice per group. Sta9s9cal significance was determined by Students-t tests performed with Bonferroni correc9on. = sta9s9cal significance where p<.5.

3 Wt LysM Rictor LysM mtor LysM Alveolar Inters99al Supplementary Figure 3. mtor LysM and Rictor LysM mice have similar numbers of lung macrophages following hookworm infec>on. Flow cytometry of lungs 5 days following subcutaneous injec9on of Nippostrongylus brasiliensis. Experiments were performed three 9mes with ten mice per group.

4 a. b. c. Supplementary Figure 4. mtor LysM and Rictor LysM mice do not have increased lung damage following hookworm infec>on. a. Diffusion capacity of mice 21 days following hookworm infec9on. b. Lung compliance of mice 21 days following hookworm infec9on. c. Lung resistance of mice 21 days following hookworm infec9on. Error bars represent standard devia9on. Experiments were performed three 9mes with eight mice per group.

5 Supplementary Figure 5. mtor LysM and Rictor LysM brown fat macrophages do not express M1 genes. RNA analysis of M1 genes in BAT following six-hour cold challenge. Error bars represent standard devia9on. Experiments were performed three 9mes with four mice per group.

6 Wt LysM 3 C Wt LysM 4 C mtor LysM 3 C mtor LysM 4 C Rictor LysM 3 C Rictor LysM 4 C Supplementary Figure 6. mtor LysM and Rictor LysM mice have normal percentages of brown fat macrophages. Representa9ve flow cytometry of Wt LysM, mtor LysM, and Rictor LysM Brown fat Macrophages. Experiments were performed three 9me with five mice per group.

7 Supplementary Figure 7. Brown fat macrophages do not proliferate during six-hour cold challenge. RNA Expression of Ki67 by Brown Fat following six-hour cold challenge. Error bars represent standard devia9on. Experiments were performed three 9mes with four mice per group.

8 Supplementary Figure 8. mtor LysM and Rictor LysM mice lose less weight during cold challenge. Weight change during six-hour cold challenge of Wt LysM, mtor LysM, and Rictor LysM. Error bars represent standard devia9on. Experiments were performed three 9mes with eight mice per group. Sta9s9cal significance was determined by 1-way ANOVA followed by Tukeys test. and ++ = sta9s9cal significance (p<.5)

9 a. b. c. d. Supplementary Figure 9. mtor LysM and Rictor LysM mice fail to upregulate thermogenic genes in WAT. a. RNA expression of Ppargc1 by WAT. b. RNA expression of Acox1, Acsl1, and UCP1 by WAT. c. M1 gene expression by WAT macrophages. d. Ki67 RNA Expression of WAT macrophages. Error bars represent standard devia9on. Experiments were performed three 9mes with five mice per group. Sta9s9cal significance was determined by 1-way ANOVA followed by Tukeys test. = sta9s9cal significance (p<.5)

10 kda -5-5 Supplementary Figure 1. mtor LysM and Rictor LysM adipocytes express the β-adrenergic receptor. Western blot analysis of the β-adrenergic receptor from white fat adipocytes. Experiments were performed two 9mes with three mice per group.

11 a. b. Supplementary Figure 11. mtor LysM and Rictor LysM mice demonstrate defec>ve lipolysis following cold challenge. a. Flow cytometry of tyrosine hydroxylase expression of white fat macrophages following six-hour cold challenge. b. Serum free fafy acid concentra9on in serum following six-hour cold challenge. Error bars represent standard devia9on. Experiments were performed three 9me with eight mice per group. Sta9s9cal significance was determined by either Students t test or 1-way ANOVA followed by Tukeys test. = sta9s9cal significance (p<.5).

12 Wt LysM Mtor LysM Rictor LysM 3 C 4 C Supplementary Figure 12. Defec>ve thermogenesis by mtor LysM and Rictor LysM mice is associated with depleted lipids from BAT following cold challenge. Oil red staining of BAT following six-hour cold challenge. Experiments were performed twice with five mice per group.

13 Antibody From Clone Dilution CD11b FITC ebiocience M1/7 1/5 F4/8 Percp ebioscience BM8 1/125 IL4R PE BD IL4R-M1 1/5 CD31 Percp Biolegend LOM-14 1/125 CD26 Biolegend Co68C2 1/25 CD11b AF7 BD M1/7 1/2 CD11c BV786 BD HL3 1/2 Siglec F PE-CF594 BD E /25 CD45 BV51 BD 3-F11 1/1 Siglec F APC BD E /2 CD11c APC ebioscience N418 1/5 CD45 APC ebioscience 3-F11 1/1 Ly6C APC BD AL21 1/5 F4/8 PE BD T /5 Ly6G BV421 BD 1A8 1/1 CD13 APC BD M29 1/5 MHC II BV65 BD M5/ /1 CD64 PE BD X54-5/ /5 CD24 FITC BD M1/69 1/5 Tyrosine Hydroxylase Origene 1/125 Supplementary Figure 13. Table of An>bodies u>lized.

14 ALVEOLAR MACROPHAGE 1 5 SSC-A 25K 2K 15K 1K 5K K1K15K2K25K FSC-A SSC-A 25K 2K 15K 1K 5K <APC-Cy7-A>: LIVE DEAD <PE-A>: CD64 INTERSTITIAL MACROPHAGE <PE-A>: CD FSC-A 25K 2K 15K 1K 5K K1K15K2K25K FSC-H <BV65-A>: MHC II <BV65-A>: MHC II <BV51-A>: CD K1K15K2K25K FSC-H <APC-R7-A>: CD11B <BV786-A>: CD11C <BV786-A>: CD11C <APC-R7-A>: CD11B CD13+ DENDRITIC CELL <APC-A>: CD13 <PE-A>: CD64 <APC-R7-A>: CD11B <PE-CF594-A>: SIGLEC F NEUTROPHIL <BV421-A>: LY6G <BB515-A>: CD24 Supplementary Figure 14. Representa>ve FACS ga>ng strategy for lung alveolar macrophages, dendri>c cells, neutrophils and inters>>al macrophages

15 Figure 1d. Figure 1e. Supplementary Figure 15. Representa>ve western blots for Figure 1.

16 Figure 3c. Figure 3e. Figure 3f. Figure 3g. Supplementary Figure 15. Representa>ve western blots for Figure 3.

17 Supplementary Figure 15. Representa>ve western blots for Supplemental figure 1.

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature19814 Figure 3e - - - Beads: Hep SA Sup Hep SA Sup Hep - SA - Sup 150 102 76 102 76 Blot: NP-1 Blot: MECA-32 Blot: VEGF Figure 3f Rbt IgG ctrl IP VEGF IP Extended

More information

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/- Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL5 and GM-CSF

Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL5 and GM-CSF A RT I C L E S Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL and GM-CSF Daniela F. Quail,7, Oakley C. Olson,7, Priya Bhardwaj, Logan A. Walsh, Leila Akkari,,,

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells

Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells Immunity, Volume 4 Supplemental Information Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells Steven J. Van Dyken, Alexander Mohapatra,

More information

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik SUPPLEMENTARY FIGURES 1-19 T H 2 response to cysteine-proteases requires dendritic cell-basophil cooperation via ROS mediated signaling Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder

More information

SUPPORTING INFORMATIONS

SUPPORTING INFORMATIONS SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor

More information

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Immunity Supplemental Information Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Brian D. Hondowicz, Dowon An, Jason M. Schenkel, Karen S. Kim, Holly R. Steach, Akshay

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver

More information

Post- Selection Purity Spleen VAT Spleen <B576/26-A>: B220

Post- Selection Purity Spleen VAT Spleen <B576/26-A>: B220 B Cells Promote Insulin Resistance through Modulation of T Cells and Production of Pathogenic IgG Antibodies Daniel A. Winer*, Shawn Winer*, Lei Shen*, Persis P. Wadia, Jason Yantha, Geoffrey Paltser,

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

Optimizing Intracellular Flow Cytometry:

Optimizing Intracellular Flow Cytometry: Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors Presented by Jurg Rohrer, PhD, BD Biosciences 23-10780-00 Outline Introduction Cytokines Transcription

More information

Fisher et al. Supplemental Figure 1

Fisher et al. Supplemental Figure 1 Supplemental Figure 1 A TNF IL-1 IL-6 CCL2 CCL5 CXCL10 pg/mg total protein 50 30 10 4,000 3,000 2,000 1,000 n.d. 1 1 14,000 12,000 10,000 8,000 6,000 4,000 2,000 6,000,000 CT26 5,000 16,000 B16 4,000 12,000

More information

New Frontiers in Atherosclerotic Disease and Myocardial Infarction: From local inflammation to systemic stem and progenitor cell reaction

New Frontiers in Atherosclerotic Disease and Myocardial Infarction: From local inflammation to systemic stem and progenitor cell reaction New Frontiers in Atherosclerotic Disease and Myocardial Infarction: From local inflammation to systemic stem and progenitor cell reaction Matthias Nahrendorf MGH Center for Systems Biology http://csb.mgh.harvard.edu/investigator/matthias_nahrendorf

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,

More information

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD) SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of

More information

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD) Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,

More information

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV)

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV) A mln NK Cells(x ) 6 1 * ndln NK Cells (x ) ns C Lung NK Cells(x ) 1 1 7 * D LN NK Cells (x ) 1 7 1 7 Days post-infection (A/PR/8) * * E Liver NK Cells (x ) 1 7 Days post-infection (A/PR/8) * * * 1 7 Days

More information

Supplemental Information. The Therapeutic Effect. of Anti-HER2/neu Antibody Depends. on Both Innate and Adaptive Immunity CONTENTS:

Supplemental Information. The Therapeutic Effect. of Anti-HER2/neu Antibody Depends. on Both Innate and Adaptive Immunity CONTENTS: Cancer Cell, Volume 18 Supplemental Information The Therapeutic Effect of Anti-HER2/neu Antibody Depends on Both Innate and Adaptive Immunity SaeGwang Park, Zhujun Jiang, Eric D. Mortenson, Liufu Deng,

More information

Supporting Information

Supporting Information Supporting Information Aldridge et al. 10.1073/pnas.0900655106 Fig. S1. Flow diagram of sublethal (a) and lethal (b) influenza virus infections. (a) Infection of lung epithelial cells by influenza virus

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along

More information

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in 9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade

More information

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3

Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3 Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. Supplementary Tale i: Primers used for RT-PCR. References are provided under Source, except for primers

More information

Recommended Protocols for Phospho Protein Detection in Human Cells

Recommended Protocols for Phospho Protein Detection in Human Cells Recommended Protocols for Phospho Protein Detection in Human Cells Depending on subcellular localization of the phospho protein of interest, as well as epitope susceptibility to cell fixing and permeabilizing

More information

This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S.

This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S. This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S., Weiss, S. Neutrophils responsive to endogenous IFN-β

More information

Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.

Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo. T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8

More information

Do Your Flow Cytometric LDTs. Validation Guidelines? Fiona E. Craig, MD University of Pittsburgh School of Medicine

Do Your Flow Cytometric LDTs. Validation Guidelines? Fiona E. Craig, MD University of Pittsburgh School of Medicine Do Your Flow Cytometric LDTs Conform to the ICSH ICCS Validation Guidelines? Fiona E. Craig, MD University of Pittsburgh School of Medicine How should LDTs be validated? Accuracy Specificity Sensitivity

More information

Differential Response of Respiratory Dendritic Cell Subsets to Influenza Virus Infection

Differential Response of Respiratory Dendritic Cell Subsets to Influenza Virus Infection JOURNAL OF VIROLOGY, May 2008, p. 4908 4919 Vol. 82, No. 10 0022-538X/08/$08.00 0 doi:10.1128/jvi.02367-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Differential Response

More information

Alternatively Activated Macrophages Determine the Repair of the Infarcted

Alternatively Activated Macrophages Determine the Repair of the Infarcted Alternatively Activated Macrophages Determine the Repair of the Infarcted Adult Murine Heart (Shiraishi et al.) List of Supplemental Materials Supplemental Methods Supplemental Figure 1. Cardiac CD206

More information

Effect of Antiretroviral Therapy on HIV-mediated Impairment of the Neutrophil

Effect of Antiretroviral Therapy on HIV-mediated Impairment of the Neutrophil Online Data Supplement Effect of Antiretroviral Therapy on HIV-mediated Impairment of the Neutrophil Antimycobacterial Response David M Lowe, Nonzwakazi Bangani, Rene Goliath, Beate Kampmann, Katalin A

More information

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs

More information

Supplementary Figure 1. Flow cytometry panels used for BD Canto (A) and BD Fortessa (B).

Supplementary Figure 1. Flow cytometry panels used for BD Canto (A) and BD Fortessa (B). Intra Immune nalysis Surface Supplementary Figure 1. Flow cytometry panels used for D Canto () and D Fortessa (). Name Fluorochrome ID F488 PE PerCp-Cy5.5 PC Paclue PE-Cy7 PC-H7 Lympho* 1 CD56 CD8 CD16

More information

T cell development October 28, Dan Stetson

T cell development October 28, Dan Stetson T cell development October 28, 2016 Dan Stetson stetson@uw.edu 441 Lecture #13 Slide 1 of 29 Three lectures on T cells (Chapters 8, 9) Part 1 (Today): T cell development in the thymus Chapter 8, pages

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal

More information

Heat-killed Lactobacillus casei

Heat-killed Lactobacillus casei Heat-killed Lactobacillus casei confers broad protection against influenza A virus primary infection and develops heterosubtypic immunity against future secondary infection Yu-Jin Jung, Young-Tae Lee,

More information

Inflammatory IL-15 is required for optimal memory T cell responses

Inflammatory IL-15 is required for optimal memory T cell responses The Journal of Clinical Investigation Research article Inflammatory IL-15 is required for optimal memory T cell responses Martin J. Richer, 1 Lecia L. Pewe, 1 Lisa S. Hancox, 1 Stacey M. Hartwig, 1 Steven

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21

More information

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells a CD11c Na + K + ATPase Na + K + ATPase CD11c x-y CD11c Na + K + ATPase Na + K + ATPase CD11c x-z c b x-y view BoNT NAPs CD11c BoNT CD11c NAPs BoNT NAPs CD11c 90 x-z view Apical Basolateral Supplementary

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Direct TLR2 Signaling Is Critical for NK Cell Activation and Function in Response to Vaccinia Viral Infection

Direct TLR2 Signaling Is Critical for NK Cell Activation and Function in Response to Vaccinia Viral Infection Direct TLR2 Signaling Is Critical for NK Cell Activation and Function in Response to Vaccinia Viral Infection Jennifer Martinez 1, Xiaopei Huang 2, Yiping Yang 1,2 * 1 Department of Immunology, Duke University

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/8/333/333ra47/dc1 Supplementary Materials for Androgen receptor antagonists compromise T cell response against prostate cancer leading to early tumor

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis

Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis Article Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis Kiana Mahdaviani 1,2, Ilan Y Benador 1,2, Shi Su 1, Raffi A Gharakhanian 1, Linsey Stiles 1,2, Kyle

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Flow cytometry leukocyte differential : a critical appraisal

Flow cytometry leukocyte differential : a critical appraisal Flow cytometry leukocyte differential : a critical appraisal Francis Lacombe Flow cytometry department University Hospital of Bordeaux, Pessac, France francis.lacombe@chu-bordeaux.fr 2008 HORIBA ABX, All

More information

Clinico-cytometric classification of PNH

Clinico-cytometric classification of PNH Clinico-cytometric classification of PNH Definition Clone size (by FCM) Hemolysis BMF Classic (or florid) Large + - PNH in the setting of other BM disorders Small, unable to counterbalance BMF + + Subclinical

More information

Adaptive Immunity. Lecture 14 Biology W3310/4310 Virology Spring Life is simple, but we insist on making it complicated CONFUCIUS

Adaptive Immunity. Lecture 14 Biology W3310/4310 Virology Spring Life is simple, but we insist on making it complicated CONFUCIUS Adaptive Immunity Lecture 14 Biology W3310/4310 Virology Spring 2016 Life is simple, but we insist on making it complicated CONFUCIUS Host defenses Intrinsic - Always present in the uninfected cell - Apoptosis,

More information

Cytokine therapy reverses NK cell anergy in MHC-deficient tumors

Cytokine therapy reverses NK cell anergy in MHC-deficient tumors The Journal of Clinical Investigation Research article Cytokine therapy reverses NK cell anergy in MHC-deficient tumors Michele Ardolino, 1 Camillia S. Azimi, 1 Alexandre Iannello, 1 Troy N. Trevino, 1

More information

Granulocyte and lymphocyte proteins

Granulocyte and lymphocyte proteins Granulocyte and lymphocyte proteins Hycult Biotech is a leading world-class manufacturer of research reagents in the field of innate immunity. We are a specialized partner in the development and manufacturing

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

DOI /art.38730

DOI /art.38730 Brief Report RUNNING HEAD: GM-CSF drives MSU inflammatory macrophages Arthritis & Rheumatism DOI 10.1002/art.38730 TITLE: GM-CSF drives MSU crystal-induced inflammatory macrophage differentiation and NLRP3

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

IL-15 regulates memory CD8 + T cell O-glycan synthesis and affects trafficking

IL-15 regulates memory CD8 + T cell O-glycan synthesis and affects trafficking Research article IL-15 regulates memory CD8 + T cell O-glycan synthesis and affects trafficking Jeffrey C. Nolz 1 and John T. Harty 1,2,3 1 Department of Microbiology, 2 Department of Pathology, and 3

More information

Nature Medicine: doi: /nm.4324

Nature Medicine: doi: /nm.4324 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression

More information

Felix Yarovinsky. Department of Immunology, UT Southwestern Medical Center. Innate immune defense to Toxoplasma gondii

Felix Yarovinsky. Department of Immunology, UT Southwestern Medical Center. Innate immune defense to Toxoplasma gondii Felix Yarovinsky Department of Immunology, UT Southwestern Medical Center Innate immune defense to Toxoplasma gondii Pathogen recognition by innate immune cells Pathogen Parasites Viruses Bacteria Initiator

More information

TIM-4, expressed by medullary macrophages, regulates respiratory tolerance by mediating phagocytosis of antigen-specific T cells

TIM-4, expressed by medullary macrophages, regulates respiratory tolerance by mediating phagocytosis of antigen-specific T cells nature publishing group TIM-, expressed by medullary macrophages, regulates respiratory tolerance by mediating phagocytosis of antigen-specific T cells LA Albacker 1,SYu 1, D Bedoret 1, W-L Lee 1,3, SE

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

a b Pml F/F Prrx1-cre f 1.4 n.s.

a b Pml F/F Prrx1-cre f 1.4 n.s. a b Pml F/F Prrx1-re X Prrx1-re-Pml F/F Relative CFU-F numbers 2. Prrx1-Cre-PML +/+ n.s. d early passages e f 1.4 n.s. Adsorbane Adsorbane.8.6.4.2.8.6.4.2 1 2 3 4 days in ulture late passages 2 4 6 8 1

More information

Physiology Unit 3 THE SPECIFIC IMMUNE RESPONSE

Physiology Unit 3 THE SPECIFIC IMMUNE RESPONSE Physiology Unit 3 THE SPECIFIC IMMUNE RESPONSE The Adap4ve Arm of the Immune System Specific Immune Response Internal defense against a specific pathogen Acquired as you are exposed to diseases The immune

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Type 1 angiotensin receptors on macrophages ameliorate IL-1 receptor mediated kidney fibrosis

Type 1 angiotensin receptors on macrophages ameliorate IL-1 receptor mediated kidney fibrosis Brief report Type 1 angiotensin receptors on macrophages ameliorate IL-1 receptor mediated kidney fibrosis Jian-dong Zhang, 1 Mehul B. Patel, 1 Robert Griffiths, 1 Paul C. Dolber, 2 Phillip Ruiz, 3 Matthew

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE a Control shrna#9 shrna#12 c Control shrna#9 shrna#12 e Control shrna#9 shrna#12 h 14 12 CFU-E BFU-E GEMM GM b Colony number 7 6 5 4 3 2 1 6 pm A pa pc CFU-E BFU-E GEMM GM pu pgm A p pg B d f CD11b-APC

More information

Chronic thoracic spinal cord injury impairs CD8 + T-cell function by up-regulating programmed cell death-1 expression

Chronic thoracic spinal cord injury impairs CD8 + T-cell function by up-regulating programmed cell death-1 expression Zha et al. Journal of Neuroinflammation 2014, 11:65 JOURNAL OF NEUROINFLAMMATION RESEARCH Open Access Chronic thoracic spinal cord injury impairs CD8 + T-cell function by up-regulating programmed cell

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

Licensing delineates helper and effector NK cell subsets during viral infection

Licensing delineates helper and effector NK cell subsets during viral infection Licensing delineates helper and effector NK cell subsets during viral infection Anthony E. Zamora, 1 Ethan G. Aguilar, 1 Can M. Sungur, 1 Lam T. Khuat, 1 Cordelia Dunai, 1 G. Raymond Lochhead, 2 Juan Du,

More information