THE ROLE OF THE PARTIAL TANDEM DUPLICATION OF MLL (MLL PTD) IN LEUKEMOGENESIS

Transcription

1 THE ROLE OF THE PARTIAL TANDEM DUPLICATION OF MLL (MLL PTD) IN LEUKEMOGENESIS DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Graduate School of the Ohio State University By Adrienne M. Dorrance, B.S. ***** The Ohio State University 2008 Dissertation Committee: Dr. Michael A. Caligiuri, Advisor Dr. Denis Guttridge Dr. Laura J. Rush Dr. Danilo Perrotti Approved by: Advisor Graduate Program in Veterinary Biosciences

2

3 ABSTRACT Although many advances have been made in the treatment of cancer in recent years, there is still a lot more to discover in the hopes of generating better therapies. Understanding how recurring genetic mutations are contributing to disease allows us to potentially uncover new pathways to target with newly synthesized or even previously developed drug therapies. My work focuses on a mutation known as the partial tandem duplication of the MLL (Mixed-Lineage Leukemia) gene, that is found in ~4-11% of acute myeloid leukemia (AML) patients with no other apparent genomic disruptions, i.e. normal cytogenetics. Patients with the MLL PTD have an especially poor prognosis, and therefore, identifying novel therapies for this particular subgroup is especially important. In order to identify the downstream targets of the MLL PTD, we created a mouse model of the MLL PTD. This model provides us with a powerful genetic tool to identify disruptions in normal cell processes as a result of the PTD, as well as a model to test potential therapies. My first chapter introduces what is currently known about wild type (WT) MLL and mutations involving MLL. Chapter 2 focuses primarily on the initial characterization of the Mll PTD/wt mouse. Chapter 3 describes the consequences of losing the concomitant WT allele in our Mll PTD/wt mice. Chapter 4 focuses on recent preliminary data as well as future plans to further characterize the contribution of the Mll PTD in leukemogenesis. ii

4 Dedicated to Damian iii

5 ACKNOWLEDGMENTS First and foremost, I would like to first thank my mentor, advisor, and boss, Dr. Caligiuri whose support has allowed me to accomplish more than I thought possible. Whose guidance I will keep with me throughout my life and which I hope to pass on to others someday. All the members of the Caligiuri Lab, both past and present, who have helped me at the bench, in particular Lan Feng, Charlene Mao, and Dr. Martin Guimond. Thank you Drs Brian Becknell, Aharon Freud, and Susan Whitman for all of those great scientific discussions that I have truly enjoyed over the years. Also, Weifeng Yuan whose work and friendship was so helpful for so many years. I am also very lucky to have worked with so many talented collaborators (too many to mention individually) in our work, and whose help was so critical. Special thanks also to the many undergraduates who have passed through the Caligiuri Lab who have helped with different aspects of this project. I am also fortunate to have great committee members who are experts in their respective fields and whom were always willing to help, Dr. Rush, Dr. Perrotti, and Dr. Guttridge- I really appreciate the time each of you have spent in helping me complete my degree. Special thanks as well to Donna Bucci, Tamra Brooks, and Annie Dull for all of their administrative support over the years. My friends Emily and Mary, who were always there to listen to me when I was stressed out. Lastly, all of my family, who have supported me in my dream of obtaining this degree. I especially want to thank iv

6 Eric, Jordan, and Damian-who has been with me through it all. This research was partially supported by the Lady Tata Foundation for Leukemia Research and an R01 award from the National Cancer Institute. v

7 VITA January 9, Born- Pittsburgh, PA B.S.- MolecularGenetics The Ohio State University 2005-present...Graduate Research Associate Department of Veterinary Biosciences The Ohio State University PUBLICATIONS 1. Rosenbloom AJ, Pinsky MR, Napolitano C, Nguyen TS, Levann D, Pencosky N, Dorrance A, Ray BK, Whiteside T. Suppression of cytokine-mediated beta2-integrin activation on circulating neutrophils in critically ill patients. J Leukoc Biol Jul;66(1): Rosenbloom AJ, Linden PK, Dorrance A, Penkosky N, Cohen-Melamed MH, Pinsky MR. Effect of granulocyte-monocyte colony-stimulating factor therapy on leukocyte function and clearance of serious infection in nonneutropenic patients. Chest Jun;127(6): Whitman SP, Liu S, Vukosavljevic T, Rush LJ, Yu L, Liu C, Klisovic MI, Maharry K, Guimond M, Strout MP, Becknell B, Dorrance A, Klisovic RB, Plass C, Bloomfield CD, Marcucci G, Caligiuri MA. The MLL partial tandem duplication: evidence for recessive gain-of-function in acute myeloid leukemia identifies a novel patient subgroup for molecular-targeted therapy. Blood Jul 1;106(1): vi

8 4. Dorrance AM, Liu S, Yuan W, Becknell B, Arnoczky KJ, Guimond M, Strout MP, Feng L, Nakamura T, Yu L, Rush LJ, Weinstein M, Leone G, Wu L, Ferketich A, Whitman SP, Marcucci G, Caligiuri MA. Mll partial tandem duplication induces aberrant Hox expression in vivo via specific epigenetic alterations. J Clin Invest Oct;116(10): FIELDS OF STUDY Major Field: Veterinary Biosciences Area of Emphasis: Human Cancer Genetics vii

9 TABLE OF CONTENTS page Abstract.....ii Dedication.....iii Acknowledgements iv Vita... vi List of Tables. x List of Figures...xi Chapters: 1. BACKGROUND The Mixed Lineage Leukemia (MLL) gene and leukemia The Partial Tandem Duplication of MLL (MLL PTD) DEVELOPMENT AND CHARACTERIZATION OF THE Mll PTD MOUSE MODEL Introduction Results Discussion Experimental Procedures Tables, Figures, and Figure Legends 26 viii

10 3. DETERMINING THE ROLE OF THE Mll WILD TYPE (WT) IN MICE WITH THE Mll PTD Introduction Results and Discussion Experimental Procedures Tables, Figures, and Figure Legends PRELIMINARY DATA AND FUTURE DIRECTIONS Further characterization of our Mll PTD mice Cell Survival and Proliferation Competitive Repopulation Assays Enhanced Myelopoiesis Contribution of Hoxa7 and Hoxa9 Overexpression Introducing Secondary Mutations MLL PTD and FLT3 ITD Mutations in Leukemia Background on the Flt3 ITD/WT knock-in mice Preliminary data characterizing the Mll PTD/wt Flt3 ITD/wt mice Future experiments characterizing the Mll PTD/wt Flt3 ITD/wt leukemias BIBLIOGRAPHY 87 ix

11 LIST OF TABLES page Table 1. Assessment of Mendalian ratios for the Mll PTD allele 26 Table 2. Absolute quantification of Mll PTD and Mll wt transcripts..27 Table 3. Splenic progenitor cells grown in liquid culture 28 Table 4. Assessment of Mll ptd/wt and Mll wt/- phenotype compared to the Mll wt/wt genotype...29 Table 5. Genotyping and phenotyping primers for Mll ptd/wt mice 30 Table 6. Real time RT-PCR probe sequences..31 Table 7. Comparason of Mll genotypes 58 x

12 LIST OF FIGURES page Figure 1. Generation of Mll ptd/wt mice..33 Figure 2. Germ-line transmission and verification of correct targeting in mice heterozygous for the Mll PTD..35 Figure 3. Schematic demonstrating the real time RT-PCR strategy for detection and absolute quantification of the Mll wt and Mll PTD transcripts in bone marrow and spleen of Mll PTD mice...37 Figure 4. Skeletal analysis of Mll ptd/wt mice at 20 weeks of age..39 Figure 5. In situ hybridizations for Hoxa9 on E12.5 embryos 41 Figure 6. Evaluation of progenitor populations in Mll ptd/wt splenocytes compared to Mll wt/wt sex-matched littermate controls..44 Figure 7. Quantification of Hoxa7, Hoxa9, and Hoxa10 expression in hematopoietic tissues of Mll wt/wt and Mll ptd/wt mice.46 Figure 8. Assessment of an Mll target gene Hoxa9 acetylation and methylation of histones assessed by ChIP 48 Figure 9. Representative flow cytometric analyses of BM cells...50 Figure 10. Phenotypic characterization of the Mll PTD/- mice 60 Figure 11. Assessment of proliferative capacity in vivo..78 Figure 12. Assessment of increased ability of Mll ptd/wt stem cells to reconstitute recipient mice..80 Figure 13. Evaluation of progenitor populations. 82 Figure 14. WBCs at time of death...84 Figure 15. Extensive infiltration of Mll ptd/wt Flt3 ITD/wt leukemic cells 86 xi

13 CHAPTER 1 BACKGROUND 1.1. The Mixed Lineage Leukemia (MLL) Gene and Leukemia. While acute leukemic blasts may appear morphologically similar, the molecular program underlying their abnormal proliferation and survival may vary dramatically. Studies aimed to identify molecular lesions responsible for leukemic transformation have identified a particularly promiscuous region located at 11q23 that is frequently involved in chromosomal translocations 1-7. The gene residing at this locus is the Mixed-Lineage-Leukemia (MLL) gene. While other recurring leukemiaassociated gene fusions are consistent in their fusion partner, such as AML1-ETO, MLL is found fused with any one of more than 30 functionally divergent genes. These MLL chimeric fusions occur in approximately 5-10% of acute leukemia in adults 8,9 and approximately 60-80% of infant acute leukemia 10. Efforts to identify similarities among these MLL fusions have not determined if a common transforming mechanism exists among the numerable partner genes. However, in each of these fusions MLL retains its same N-terminal region which includes: three A-T Hook DNA binding domains, two repression domains-one of which displays homology to a DNA methyltransferase (DNMT1), and a region that contains 4 PHD zinc finger motifs 11,12. 1

14 1.2. The Partial Tandem Duplication of MLL (MLL PTD). Knowing the potent transforming ability of this N-terminal domain of MLL our lab and the Croce lab hypothesized that MLL gene fusions might also be present in leukemic blasts that lack chromosomal translocations. Indeed, it was discovered that MLL is found rearranged in 4-11% of patients with acute myeloid leukemia (AML) and normal cytogenetics, and in 35-90% of adult patients with de novo AML and trisomy 11 (+11) as a sole abnormality 13,14. This unique MLL rearrangement lacks a fusion partner but rather consists of a partial tandem duplication (MLL PTD) of the N-terminal region of MLL 15. This self-fusion is distinct in that it retains all of its normal functional domains without the contribution of the fusion partner, and instead has a defined segment of the N-terminus duplicated in tandem with the full length MLL gene. 2

15 CHAPTER 2 DEVELOPMENT AND CHARACTERIZATION OF THE Mll PTD MOUSE MODEL 2.1. Introduction MLL (ALL-1, HRX, HTRX) is the human homolog of Drosophila trx, and is a maintenance factor for the homeobox (Hox) group of proteins that play an important role in specifying cell fate during development and hematopoiesis 16. Approximately 4% of patients with de novo acute myeloid leukemia (AML) have balanced translocations or insertions that result in fusion of MLL at chromosome 11q23 with one of over 40 functionally divergent genes. Although a central mechanism responsible for malignant transformation as a result of these chromosomal translocations involving 11q23 is lacking, the N-terminus of MLL that contains the AT-hooks and a region homologous to DNA methyltransferase (DNMT) are always retained in the fusion protein while the C-terminus containing the activation and SET domains is always replaced by the fusion partner 17. Members of the Caligiuri lab discovered a rearrangement of MLL in AML patients whereby MLL is not fused with a partner gene but rather is consistently elongated with an in-frame partial tandem duplication (PTD) of exons 11-5 or 12-5 (former exon designations were 6-2 and 8-2) 13. In contrast to the myriad of MLL 3

16 fusions in AML that result from chromosomal translocations, AML blasts with the MLL PTD retain the protein s C-terminus that contains the activation and SET domains, and partially duplicates a region within the N-terminus containing the AT hooks and repression domains 17. Approximately 4-7% of AML patients with normal cytogenetics harbor the MLL PTD and carry an especially poor prognosis 18,19. HoxA genes are frequently overexpressed in leukemia 20. The mechanism by which the MLL PTD contributes to aberrant hematopoiesis and/or leukemogenesis is currently unknown, but given MLL s role as a maintenance factor for Hox proteins, one mechanism could involve deregulation of Hox gene expression. In in vitro model systems, wild type (WT) MLL regulates certain HOX gene expression via epigenetic modification at cis-regulatory regions, i.e., histone H3/H4 acetylation and H3 Lysine 4 (Lys4) methylation, the latter of which requires MLL s C-terminus SET domain 21,22. When the MLL-AF9 fusion is transduced into Mll -/- cells, Hoxa9 is overexpressed by an unknown mechanism that does not require binding of the MLL- AF9 fusion directly to the Hoxa9 promoter 22. However, in another in vitro study, transduction of the MLL-ENL and the MLL-FKBP fusions into Mll wt/wt cells increased Hoxa9 expression via H3 acetylation but without increased H3 (Lys4) methylation 23. Likewise, when the Mll-AF9 fusion was knocked-in as an endogenous allele, mice showed Hoxa9 overexpression and developed AML, but no epigenetic or other alteration could account for this overexpression 24,25. This suggests distinct mechanisms for induction of HOX genes by WT MLL and fusions of MLL resulting from balanced chromosomal translocations. 4

17 Taspase 1 cleaves the ~430 kda MLL protein into two smaller components, and this cleavage has been shown to be essential for normal MLL function and regulation 26,27. Absence or down regulation of Taspase 1 leads to absence or decreases in transcription of normal downstream targets of MLL such as the Hox genes 27. In virtually all cases involving reciprocal MLL translocations, the consensus sequences for Taspase 1 are lost and replaced by the fusion partner, resulting in one of the only known common features amongst all the reciprocal translocations involving MLL. However, the MLL PTD differs from translocations in that the consensus sequences for Taspase 1 are retained and the MLL PTD protein is cleaved 28. How these MLL mutations function with or without Taspase 1 cleavage is currently unsolved but highlights another important difference between MLL fusions and the MLL PTD. In this study, we created a mouse expressing the Mll PTD off of the endogenous Mll promoter and examined the molecular basis for its phenotype. We show this mouse has overexpression of certain HoxA genes, axial skeletal defects, and aberrant hematopoiesis, all compared to age- and sex-matched littermate controls. We also show that the Mll PTD is associated with increased histone H3/H4 acetylation and methylation of H3 (Lys4) at cis-regulatory HoxA sequences, providing what we believe to be the first in vivo evidence for a mechanism by which an MLL gene rearrangement can directly alter HoxA gene expression. 5

18 2.2. Results Mll PTD/wt mice are viable and express the fusion transcript. To study the in vivo consequences of the Mll PTD and to more closely model the monoallelic involvement seen in human AML with the MLL PTD 29, we employed homologous recombination in embryonic stem (ES) cells to introduce a genomic fragment containing exons 5 through 11 into intron 4 of Mll (Figure 1). Using two Mll PTD/wt (+) ES clones, we obtained 11 mice with germline transmission of the Mll PTD and backcrossed these mice with C57Bl/6J mice to obtain Mll PTD/wt mice on a pure (congenic) C57Bl/6J background. Southern blotting (Figure 2A) and DNA PCR (not shown) verified the presence of the Mll PTD/wt genotype. Southern blotting on one-day old pups from 5 matings also confirmed that Mll PTD/PTD homozygous mice are embryonic lethal (Table 1). Sequencing of the RT-PCR product from Mll PTD/wt mice demonstrated a correctly spliced, in-frame fusion transcript confirming the precise targeting of exons 5 through 11 within intron 4 of the Mll locus (Figure 2B). 6

19 Absolute quantification of WT and PTD transcripts in Mll PTD/wt mice using Real-time RT-PCR. Real-time primers and probes were designed and optimized, amplifying the unique 11-5 Mll PTD fusion present only in Mll PTD/wt mice, as well as the Mll exon-exon junction located outside the duplicated region and common to both the Mll PTD allele and the Mll wt allele. Using these probes in an absolute quantification assay 28, it was determined that the Mll PTD and Mll WT alleles were both expressed at low, near equivalent levels in the hematopoietic tissues of the Mll PTD/wt mice (Figure 3 and Table 2). Protein confirmation of this equal yet low level of gene expression by Western blot was not technically possible. Phenotypic abnormalities of Mll PTD/wt mice. Examination of Mll PTD/wt mice revealed skeletal abnormalities compared to Mll wt/wt age- and sex-matched littermate controls. Radiographic examination of Mll PTD/wt mice < 1 year of age identified axial skeleton malformations including a rudimentary or missing 13 th rib, indicative of a T13->L1 transformation (70% penetrance, n = 13), and a S1 vertebral duplication indicative of an S2->S1 transformation (63%, n = 11) (Figure 4B-C). Given the wt Mll s role in maintaining Hox expression during development, and the known association between HoxA expression, anterioposterior patterning and posterior axis elongation, we examined Hoxa9 expression during embryogenesis. In situ hybridization performed on E12.5 day Mll PTD/wt embryos demonstrated a shifted expression boundary of Hoxa9 within the paraxial mesoderm, compared to Mll wt/wt littermate controls (Figure 5). 7

20 Altered hematopoiesis in Mll PTD/wt mice is associated with aberrant HoxA expression. Lineage-specific colony forming unit (CFU) assays were performed for erythroid (BFU-E), myeloid (CFU-GM), and mixed (CFU-GEMM) progenitor populations using both Mll PTD/wt and Mll wt/wt splenocytes. The CFU number for each progenitor type was significantly increased in Mll PTD/wt mice compared to age- and sex-matched Mll wt/wt littermate controls (Figure 6A). A 5-20-fold increase in Mll PTD/wt spleen cells expressing the erythroid marker Ter119 was also noted, consistent with the observed increase in erythroid progenitor populations as measured by BFU-E (Figure 6B-C). However, extensive phenotypic analyses performed as previously described 30 on blood, spleen and bone marrow (BM) did not reveal any other differences in Mll PTD/wt mice compared to age- and sex-matched Mll wt/wt littermate controls (Figure 9). Primary CFUs were then harvested and used in two parallel secondary assays. In replating CFU assays, the total number of colonies per plate was not significantly different between Mll PTD/wt and Mll wt/wt splenocytes, yet the size of the Mll PTD/wt colonies was markedly increased over both Mll wt/wt colonies and those derived from Mll Af9/wt mice (Figure 6D-F). Secondary colonies from Mll PTD/wt mice were able to form tertiary and quaternary colonies while those from Mll wt/wt and Mll Af9/wt mice were not (not shown). The increase in size per Mll PTD/wt colony suggested an increase in progenitor cell proliferation compared to Mll wt/wt progenitor cells. Nonetheless, absolute in vivo cell counts in bone marrow, spleen and blood were not significantly different between Mll PTD/wt and Mll wt/wt mice, suggesting that enhanced proliferation in the Mll PTD/wt progenitor cells is accompanied by increased cell turnover. To verify this, primary CFU colonies were harvested and 8

21 maintained in liquid cultures supplemented with SCF, IL-3, and IL-6 for an additional 18 days, followed by cell counts, BrdU uptake for quantification of proliferation, and assessment of apoptosis by Annexin V and propidium iodide staining. The Mll PTD/wt hematopoietic progenitor cells did have a two-fold greater fraction of cells incorporating bromodeoxyuridine (BrdU) compared to Mll wt/wt progenitor cells (Figure 6G-H), but also showed a substantial amount (50%) of apoptosis (Figure 6I), such that absolute cell counts over this period of time were only modestly increased from the initiation of culture (Table 3). This near-maintenance of homeostasis could also explain the normal cell counts observed in bone marrow, spleen and blood of Mll PTD/wt mice in vivo. The lack of viable Mll wt/wt cells at day 18 in repeated assays (Table 3) precluded our ability to get statistically meaningful comparative data in repeated cultures. In contrast, Mll PTD/wt progenitor cells were sustained in liquid culture for > 4 months. Increased expression of HoxA genes in Mll PTD/wt mice. To establish a possible cause for the aberrant increases in both the number of primary colonies and increased proliferative capacity of replated progenitors from Mll PTD/wt mice, we quantified expression of Hoxa7, Hoxa9, and Hoxa10 within hematopoietic tissues. We found consistent and significant overexpression of each HoxA gene in BM, spleen and blood, when compared to their expression in matched Mll wt/wt littermate controls (Figure 7A-C). 9

22 Hoxa1 expression, a HoxA family member that is not regulated by Mll, was unaltered in any of the hematopoietic tissues examined while Hoxc8, a HoxC family member that has been shown to be positively regulated by WT MLL 22, was also not upregulated in any of the tissues examined (not shown). The lack of significant differences in cellular populations of blood, spleen and BM between Mll PTD/wt and Mll wt/wt mice as noted above suggested that the increased HoxA gene expression was due to an increase in the HoxA expression on a per cell basis. To confirm this, we sorted equal numbers of cells from BM of Mll PTD/wt and Mll wt/wt mice expressing different lineage markers: B220, CD3, CD11b, Gr-1, and Ter119. RNA was isolated from an equivalent number of cells and reverse transcribed into cdna. Using Real time RT-PCR, Hoxa9 was shown to be overexpressed in each of the Mll PTD/wt cell subsets when compared to the identical Mll wt/wt subset, consistent with an increase in HoxA gene expression on a per cell basis (Figure 7D). Epigenetic alterations at HoxA gene promoters in Mll PTD/wt mice. As noted earlier, HoxA gene overexpression has been noted in both in vitro and in vivo models of the MLL-AF9 fusion, but an in vivo mechanism to explain this upregulation in this or any MLL rearrangement associated with leukemia has yet to be provided 25. Two groups have shown that WT MLL has intrinsic histone H3 (Lys4) 10

23 methyltransferase activity within its C-terminus SET domain 21,22 which is retained in the MLL PTD. To test whether epigenetic modifications within HoxA promoters were responsible for HoxA overexpression in Mll PTD/wt hematopoietic tissues, chromatin immunoprecipitation (ChIP) was performed within promoter sequences known to be important for maintaining HoxA transcription, and compared to similar tissues in Mll wt/wt mice. Mll PTD/wt mice display an increase in histone H3 and H4 acetylation and H3 (Lys4) methylation, with a corresponding decrease in H3 (Lys9) methylation within the Hoxa9 (Figure 8A-B) and Hoxa7 (not shown) promoters. These epigenetic modifications associated with gene transcription establish a mechanistic link between the Mll PTD/wt genotype and the associated overexpression of Mll targets, Hoxa7 and Hoxa9. No such epigenetic changes were noted within the pertinent promoter region of Hoxa10. We further assessed whether the increased histone modifications associated with gene activation were due to a gain-of-function of the Mll PTD and not the result of losing a wild type Mll allele. H3/H4 acetylation and H3 (Lys4) methylation at the Hoxa7 and Hoxa9 promoters were therefore measured using ChIP in combination with Sybr green Real time PCR in Mll PTD/wt and Mll wt/- BM and spleen, and compared to similar measurements in Mll wt/wt BM and spleen. Results show no significant difference in the histone modifications at these promoters when comparing Mll wt/- and Mll wt/wt tissues. In contrast, Mll PTD/wt tissues showed significantly increased H3/H4 acetylation and H3(Lys4) methylation at the Hoxa7 and Hoxa9 promoters when compared to these other two genotypes (Figure 8C and D, and Table 4). These data 11

24 indicate that the histone modifications associated with gene activation in the Mll PTD/wt cells result from gain-of-function mutation involving the PTD and not simply the loss of a wild type Mll allele. It should also be noted that in data not shown, HoxA gene expression in Mll PTD/wt E17.5 fetal liver cells showed between a 5-10 fold increase in Hoxa7, a9 and a10 gene expression compared to either Mll wt/wt or Mll wt/- fetal liver cells. Finally, preliminary experiments comparing fetal liver cell HoxA gene expression obtained from Mll PTD/wt, Mll wt/-, and Mll PTD/- E17.5 embryos, strongly support the conclusion that the Mll PTD confers a gain-of-function mutation (A. Dorrance and M. Caligiuri, unpublished observation). Absence of leukemic transformation in Mll PTD/wt mice highlights important requirement for second hit. Despite the aberrant hematopoiesis, the mice have not developed leukemia with over two years of observation. Hoxa9 cooperates with overexpressed Meis1 in the induction of murine AML We therefore quantified Meis1 transcript in affected hematopoietic tissues but found no evidence of overexpression (not shown). Likewise, we have noted that AML blasts from patients harboring the MLL PTD consistently lack expression of the WT MLL allele 28, however hematopoietic tissues of the Mll PTD/wt mice showed near equivalent levels of WT and PTD transcript (Figure 2C). Thus, it is possible that these and/or other additional molecular alterations are required for malignant transformation and can explain the aberrant hematopoiesis in the absence of leukemic transformation in Mll PTD/wt mice. 12

25 2.3. Discussion In the current report we describe a mouse engineered with Mll PTD expression driven by its endogenous promoter. The Mll PTD/PTD genotype appears embryonic lethal and characterization of these embryos is ongoing. Mll PTD/wt mice are viable, are able to reproduce, and are without serious illness after two years of observation. However, Mll PTD/wt mice have a high penetrance of skeletal abnormalities that consist of a missing or rudimentary 13 th rib and a duplication of the S1 vertebral body. Hematopoietic abnormalities consist of significantly increased BFU-E, CFU-GM, and CFU-GEMM progenitors in cultures from Mll PTD/wt splenocytes when compared to age- and sex-matched Mll wt/wt littermate controls. Alterations in members of the homeobox or Hox family of genes could reasonably explain these seemingly diverse phenotypic findings in the Mll PTD mice, since certain Hox members are critical in axioskeletal and hematopoietic development, and maintenance of Hox expression is positively regulated by wt Mll 16. The current report documents the increased expression of selected HoxA genes that is coincident with the Mll PTD and, for the first time, provides a mechanism by which an Mll defect that is associated with AML causes deregulation of HoxA expression in vivo. Hox genes display spatiotemporal expression patterns that are colinear with respect to their location on the chromosome 34. Thus, for normal skeletal development to proceed, Hox genes must be expressed in the right cell type at the right time. Expression of these genes at incorrect times or locations leads to 13

26 disruptions in normal Hox expression boundaries resulting in altered cell fate and misspecification of segment identities To determine whether the malformations of the axial skeletons of our Mll PTD/wt mice were associated with alterations in Hox expression boundaries, we performed whole mount in situ hybridizations on E12.5 embryos and found the expression of Hoxa9 in the Mll PTD/wt embryos extended laterally in the somitic mesoderm when compared to Mll wt/wt littermate controls. This finding is consistent with other reports that have implicated Hoxa9 as an important gene for lumbo-sacral patterning 38. Restricted Hox expression is also vital for normal hematopoiesis, and deregulation in HoxA expression can result in aberrant hematopoiesis and malignant transformation 33, Following the observations of progenitor cell abnormalities in Mll PTD/wt spleen, we noted significant increases in Hoxa7, Hoxa9, and Hoxa10 transcripts in the spleen, BM, and blood of Mll PTD/wt mice when compared to Mll wt/wt littermate controls and compared to Mll wt/- mice. However, Hoxa1, a HoxA family member not regulated by Mll, showed no increase in its expression in tissues of the Mll PTD/wt mice. Likewise, Hoxc8, a member of the HoxC paralogous group that has been shown to be a direct target of MLL, was not increased within these tissues, indicating the specific effect of the Mll PTD on these HoxA genes. Further, as these HoxA family members are positively regulated by wt Mll, their consistent and significant overexpression in the tissues of Mll PTD/wt mice also suggests that the Mll PTD was operating in a gain-of-function fashion. 14

27 WT MLL has been shown to directly and indirectly modify histones at the promoters of certain HOX genes thereby maintaining gene transcription 21,22. Histone modifications are associated with gene activation and repression Histone acetylation is the predominant modification associated with gene activation as well as histone H3 (Lys4) methylation, while histone H3 (Lys9) methylation corresponds with gene repression. Enzymes known as histone acetyltransferases, such as CREBbinding protein (CBP), are responsible for histone acetylation and associate with MLL in a complex via its C-terminal transactivation domain that is uniquely preserved in the MLL PTD 49. There are genetic data showing evolutionarily conserved association of the MLL homolog trx with dcbp in the fly, thus demonstrating the importance of this protein interaction 50. Other complexes found within the MLL supercomplex function as either activators or repressors of transcription, some via acetylation 21,22. Examination of the histone acetylation states at Hoxa7 and Hoxa9 promoters in our study showed over acetylation of histone H3/H4 in spleen and BM of Mll PTD/wt mice, explaining at least one mechanism by which the Mll PTD is mediating HoxA overexpression. The specific complexes associating with the Mll PTD that are responsible for this observation and the direct or indirect mechanism by which this is accomplished have yet to be elucidated. Like the transactivation domain, the SET domain is also retained in the C- terminus of the MLL PTD, again in contrast to all other MLL gene fusions found in AML. The SET domain of MLL has histone H3 (Lys4) methyltransferase activity essential for maintaining Hox expression 21,22. We hypothesized that histone H3 15

28 (Lys4) methylation might also contribute to upregulation of these HoxA genes. Indeed, ChIP experiments reveal a correlation between overexpression of both Hoxa7 and Hoxa9 transcript with increases of histone H3 (Lys4) methylation at these promoters in Mll PTD/wt tissues. These data and the absence of such an increase in same tissues of Mll wt/- mice support the notion that the Mll PTD has a direct gain-offunction role in transcriptional activation of these target genes. In contrast, the retroviral infection of Mll -/- murine embryonic fibroblasts with the MLL-AF9 fusion (lacking the SET domain) did not result in comparable Hoxa9 promoter modifications despite overexpression of the Hoxa9 transcript 21,22, Transductions using the MLL-ENL and MLL-FKBP fusions demonstrated binding to HoxA promoters, and increases in H3 acetylation, but no corresponding increases in H3 (Lys4) methylation 51. These experiments suggest distinct mechanisms of action in which Hoxa9 is positively regulated by different MLL gene fusions. In addition, our ChIP experiments showed a correlation between the overexpression of Hoxa7 and Hoxa9 and a decrease in the repression-associated methylation of histone H3 (Lys9) at each promoter, however, the domain and/or complex within the Mll PTD that is associated with this epigenetic modification is unknown. Interestingly, we did not find similar histone modifications at the Hoxa10 promoter, suggesting its mechanism of overexpression is distinct from our observations with Hoxa7 and Hoxa9 in Mll PTD/wt mice. 16

29 Exactly how the associated aberrant epigenetic modifications come about is unknown, but must be directly or indirectly related to the PTD itself. Several possible mechanisms are now conceivable with the recent evidence that WT MLL directly binds to the promoter of these HoxA target genes, together with its supercomplex of repressing and activating proteins 21,22. The duplication of the DNA-binding AT hooks domain within the Mll PTD may have conferred sustained and therefore excessive binding, and increased activation, at the relevant Hoxa7 and Hoxa9 promoters, or could in some way enhance the recruitment of the Mll PTD and its supercomplex to its target genes 52. Alternatively, the associated supercomplex of activating and repressing components may be altered by the PTD in a way that changes a critical balance between these various complexes, excessively favoring target gene activation. It is conceivable that the binding of the Mll PTD to the promoter of these HoxA genes may interfere with the recruitment of the repression machinery. Careful biochemical characterization of these regulatory regions within the promoters of downstream targets of Mll will provide further insights into the dynamic regulation of these gene products in vivo. Retroviral overexpression of Hox genes, including HoxA members, have been associated with massive deregulation of hematopoiesis and leukemia 42. Despite the sometimes substantial overexpression of the same HoxA genes observed in our Mll PTD/wt mice, they displayed no signs of malignant transformation at two years of age. The increase in Mll PTD/wt progenitor cell number and proliferation during CFU and liquid culture assays, respectively, suggest that HoxA overexpression exerts its 17

30 effect on immature cells of the hematopoietic compartment, but by itself is insufficient to cause leukemic transformation. Overexpression of Hoxa7 or Hoxa9 rapidly induces AML in mice, but requires forced co-expression of the Hox-cofactor Meis1 31. Mll PTD/wt cells overexpressing Hoxa7 and Hoxa9 genes in our study did not display any increase in Meis1 transcript. Further, AML patients harboring the MLL PTD also undergo epigenetic silencing of their WT MLL allele in their leukemic blasts that contributes to enhanced cell survival 28. Our Mll PTD mice express the wt Mll allele, presumably because this later event requires cooperation with other alterations. Finally, the MLL PTD has been shown to occur simultaneously with tyrosine kinase mutations in AML such as the FLT3 ITD 53 and Rhe-PDGFRα fusion 54, neither of which have been detected in our Mll PTD/wt mice. Thus, the failure of our mice to develop frank leukemia is likely related to the absence of additional molecular aberrations that are critical for malignant transformation to occur in the presence of the Mll PTD. While it would seem most logical that we are observing the earliest events in a continuum of how the Mll PTD contributes to the leukemic phenotype, it must also be considered that some or all of the abnormalities we have observed may not be related to the leukemogenic process as it occurs in patients with AML and the MLL PTD. For example, while the excessive production of erythroid and megakaryocytic progenitor populations is consistent with the specific role of Hoxa10 in these lineages 43 and with Hoxa10 overexpression found in the Mll PTD/wt mice, AML patients with the MLL PTD rarely have blasts of erythroid or megakaryocyte lineage. Clearly, 18

31 additional work in combination with mice harboring other genetic defects, as described above, will need to be undertaken in order to shed light on the role of the Mll PTD in the genesis of leukemia. In summary, we have engineered a mouse with the Mll PTD driven off of its endogenous promoter. We provide what we believe to be the first in vivo evidence for a mechanism by which an Mll gene fusion (in this case, a self-fusion ) strongly associated with AML leads to aberrant target gene activation, i.e., increased histone H3/H4 acetylation and histone H3 (Lys4) methylation Experimental Procedures All primers and primers/probes used, are found in Tables 5 and 6. Development of the Mll PTD/wt mouse A P1 genomic clone containing the murine Mll genomic fragment was obtained from Incyte Corporation (formerly Genome Systems) of Palo Alto, CA. This was subcloned as two fragments (F1 and F2) into pbluescript II as BamHI fragments. The BamHI/SmeI fragment from F2 was then subcloned into the BamHI and SmeI sites of ploxpneo1. F1 was then subcloned into the BamHI site of ploxpneo containing F2. This generated a targeting vector with ploxpneo1 as the vector backbone and genomic Mll sequences spanning intron 4 through intron 11 (Figure 1) 19

32 Approximately 60 µg of the targeting vector was linearized within intron 4 of Mll using the unique SfiI restriction site and introduced into 30 million R1 ES cells. A plasmid vector expressing Cre recombinase from a CMV promoter (pcre) that conferred puromycin resistance was transiently transfected into C186 Mll PTD/wt ES cells by electroporation. Cells were cultured overnight and then transferred to a selective media containing 1 µg/ml of puromycin, grown further and subcloned. Following transient transfection, selection and expansion, DNA-PCR was performed using an upstream primer from intron 11 and a downstream primer from the ploxpneo vector. This amplified a 0.9-kb band suggesting that the pgk-neo cassette has been removed, and this was confirmed by sequencing. Next, two independently targeted ES cell clones were selected for generating chimeric mice. After verifying these clones were karyotypically normal and free of mycoplasma contamination, 15 ES cells from each clone were injected into 3.5 day-old blastocysts from pregnant C57Bl/6 female mice (Jackson Laboratories). Next, the chimeric embryos were transferred into pseudopregnant recipient Swiss-Webster female mice. Micromanipulations, blastocyst transfers and generation of chimeric mice were performed at the Transgenic Shared Resource of The Ohio State University Comprehensive Cancer Center. Backcrossing to a pure C57Bl/6 background was carried out in five generations using marker-assisted breeding, Speed Congenics (Jackson Laboratories). 20

33 Southern Blot Analysis High molecular weight DNA extracted from cells was digested with SbfI and NdeI (New England Biolabs) and Southern blotting was performed according to previously described techniques 15. The DNA was transferred to Hybond N+ nitrocellulose membrane (Amersham) and hybridized to a cdna fragment spanning the Mll intron 4/exon 5 junction. The predicted fragment size for the Mll PTD allele is 40 kb while the predicted fragment size for the wildtype Mll allele is 18 kb. Genotyping DNA was prepared from tail biopsies of adult and newborn mice using standard phenol/chloroform extraction. DNA PCR was performed using a forward primer located within intron 6 and a reverse primer located within the targeting vector backbone that amplifies a 900bp product. Total RNA was extracted from tissues using the RNeasy kit (Qiagen) and reverse transcriptase PCR (RT-PCR) was performed using MMLV reverse transcriptase (Invitrogen) with a forward primer located within exon 11 and a reverse primer located within exon 6 that generates a 335bp product. CFU-progenitor assays and liquid stem cell cultures Splenocytes were isolated from Mll PTD/wt, Mll wt/wt and Mll af9/wt (generously provided by Drs. Terry Rabbitts via Dr. John Kersey) mice. Single cell suspensions were prepared in Iscove's Modified Dulbecco's Medium (Gibco) containing 2% of fetal bovine serum (Hyclone) from n=6-8 mice per genotype. Cells were then plated 21

34 at a density of 1 x 10 5 cells/dish in M3434 methylcellulose (Stem Cell Technologies) to assess splenic progenitor populations. All colony assays were performed according to the manufacturer s protocol (Stem Cell Technologies). Secondary replating assays were enumerated and performed on day 14 of primary cultures. Cells were replated at a density of 10 4 cells/dish in M3434 methylcellulose (Stem Cell Technologies). Secondary cultures were also performed in liquid medium RPMI 1640 with glutamax (Gibco), plus 100ng/ml of stem cell factor, 10ng/ml of mil-3, and 20ng/ml of hil-6 (Stem Cell Technologies), and seeded simultaneously from primary CFU progenitor assays and in parallel with secondary replating assays at a density of 10 4 cells/ml. Chromatin Immunoprecipitation ChIP assays were performed using the Chromatin Immunoprecipitation Assay Kit (Upstate Biotechnology). Approximately cells were used per assay, and approximately 1% of the extracted chromatin solution was saved for use as input DNA. Immunoprecipitation with the following antibodies was performed: anti-acetyl- HistoneH4, anti-acetyl-histoneh3, and anti-dimethyl HistoneH3 (Lys4) and antidimethyl HistoneH3 (Lys9),(Upstate Biotechnology). The DNA was extracted using phenol-chloroform, precipitated with ethanol, and dissolved in water. Immunoprecipitations were analyzed by nested PCR using Gene Amp PCR System The cycle number and the amount of template were optimized to ensure that results were within the linear range of amplification. The PCR products were size fractionated through 1.0% agarose/ethidium bromide gels. 22

35 Quantification of histone acetylation and methylation at Hoxa7 and Hoxa9 promoters in Mll PTD/wt, Mll wt/- (generously provided by the late Dr. Stanley Korsmeyer), and Mll wt/wt DNA extracted from spleen and BM cells was undertaken using Real time quantitative PCR with SYBR green incorporation (Applied Biosystems). Primers were designed and optimized (Table 5) to amplify genomic sequences in the Hoxa7 and Hoxa9 promoters. Each reaction used 2 µl of DNA template, 12.5 µl SYBR Green PCR Master Mix (Applied Biosystems), and was normalized to input DNA. The specificity of PCR products was analyzed by addition of a melting curve cycle, which consisted of: 1 cycle of 60 C for 15 seconds, 95 C for 20 seconds, and 60 C for 15 seconds, followed by analysis on Dissociation Curve Analysis 1.0 software (Applied Biosystems). Comparative Real time RT-PCR Total RNA was extracted from mouse BM, spleen, and peripheral blood samples and cdna prepared as previously described 55. Primer and probe sets to detect murine Hoxa7, Hoxa9 and Hoxa10 transcripts were designed using PrimerExpress (Applied Biosystems, Inc.). Real time RT-PCR efficiency was optimized for each primer/probe set using established guidelines (User Bulletin, Applied Biosystems, Inc). Comparative Real time RT-PCR was performed following the manufacturer s suggested procedures and using the Prism 7700 Sequence Detection System (Applied Biosystems, Inc). To normalize for RNA content, the r18s primer/probe set was included in multiplex reactions. Data were analyzed using the SDS version 1.7a software (Applied Biosystems, Inc.) and reported as 2 -ΔΔCt 23

36 values normalized first to r18s and then to an Mll wt/wt sibling sample analyzed on the same 96-well plate. For cell sorting Real time RT-PCR experiments, whole BM cells were harvested and stained with antibodies to Ter119, CD71, Gr-1, CD11b, B220, and CD3. A minimum of cells positive for each lineage marker were isolated using a FACS Vantage (Becton Dickinson). Equivalent numbers of cells positive for each marker from Mll wt/wt and Mll PTD/wt were used to quantify HoxA gene expression. Real-time RT-PCR was then performed as described above. We used our previously published methodology to quantify absolute levels of Mll PTD and Mll wt transcripts present in BM, spleen, and blood of Mll PTD/wt mice by Real time RT-PCR 28. Primers and probes can be found in Tables 5 and 6. Flow cytometric analysis for lineage and subset determination, proliferation and apoptosis. Cell lineages and hematopoietic subsets within the BM, spleen, and peripheral blood were assessed using lineage specific antibodies as previously described 30,55. Immunofluorescent analysis of antigen expression was performed using a FACS Calibur (Becton Dickinson) and CellQuest software. For quantitative assessment of cellular proliferation BrdU incorporation was used and performed according the manufacturer s protocol (Phamingen). To assess differences in apoptosis, Annexin V and PI staining were used and performed according to manufacturer s protocol (Pharmingen). 24

37 Whole Mount in situ Whole mount in situ was performed on E12.5 embryos as previously described 16 using digoxygenin-labeled riboprobes generated according to manufacturer's protocols (Boehringer Mannheim). Primer pairs used to generate both sense and anti-sense can be found on Table 5 and were first standardized on wt embryos. Skeletal Analysis Intact skeletons were prepared using sex-matched Mll PTD/wt and Mll wt/wt mice 20 weeks of age using previously described methods 56. The micro-ct images were performed as follows: the sacral vertebrae specimens were mounted in 50 ml plastic test tubes filled with glycerol and imaged at 32 kv, 1 ma, and 1 sec exposure with image intensifier operating in 7" mode. The spatial resolution of the images is 60 micrometers. Statistical Analysis A Wilcoxon Signed Rank was used to compare differences in CFU growth between the Mll wt/wt and Mll PTD/wt splenocytes. The Hoxa7, Hoxa9, and Hoxa10 expression levels for each tissue were compared between Mll wt/wt and Mll PTD/wt mice using a two-sample t-test. 25

38 2.5. Tables, Figures, and Figure Legends Mll PTD/wt x Mll PTD/wt matings Total Mll wt/wt Total Mll PTD/wt Total Mll PTD/PTD # of Matings offspring (exp. freq: offspring (exp. offspring (exp. freq: Matings actual freq) freq: actual freq) actual freq) Mll PTD/wt x Mll PTD/wt 5 8 (25%: 30%) 19 (50%: 70%) 0 (25%: 0%) Table 1: Assessment of Mendelian ratios for the Mll PTD allele 26

39 Table 2 Genotype Mll unique amplicon (11-5 fusion) copy # Mll common amplicon (14-15 exons) copy # Ratio** Standard Deviation Mll PTD/wt Mll wt/wt **If both alleles are transcribed at equivalent rates, the common-to-unique amplicon copy number ratio would be ~2:1 in a sample with the Mll PTD/wt genotype, or ~1:1 if the Mll wt allele was silenced 28. N =3/genotype. Table 2: Absolute quantification of Mll PTD and Mll wt transcripts. 27

40 Table 3 cell numbers Genotype Day 0* Day 7 Day 18 Mll wt/wt 2.2 x x x 10 4 ( ) Mll wt/wt 7.5 x 10 4 all dead all dead Mll wt/wt 9.9 x x 10 5 all dead Mll ptd/wt 6.2 x x x 10 6 ( ) Mll ptd/wt 3.7 x x x 10 7 ( ) Mll ptd/wt 6.0 x x x 10 6 ( ) *signifies the start of liquid cultures with cells harvested from day 14 CFUs. Table 3: Splenic progenitor cells grown in liquid culture. 28

41 Table 4: Phenotype Mll ptd/wt * Mll wt/- Axial Skeleton S1 sacral duplication No sacral abnormalities ** Hematopoiesis Mll Function No cervical abnormalities Multiple cervical abnormalities ** Normal blood volume Anemia ** Normal numbers of normal B-cell Normal or B-cell populations populations ** Significantly increased H3/H4 acetylation and H3(Lys4) methylation at Hoxa7 & Hoxa9 promoters (see Fig. 8C & 8D) *as performed in our laboratory. **as reported by Yu et al (1). Normal or * (see Fig. 8C & 8D) Table 4: Assessment of Mll ptd/wt and Mll wt/- phenotype compared to the Mll wt/wt genotype. 29

42 Forward Reverse Primers DNA PCR for PTD RT-PCR for PTD GAGCCTTGGCCCGAATGAAACTGT CAGGCCAGAGCAAAGCAAGCA CCGGCGAACGTGGCGAGAAA CCCCAGGGAAGGTAGGAGGTC HoxA7 Real Time HoxA9 Real Time HoxA10 Real Time Hox C8 Real Time Hox A7 in situ HoxA9 in situ Hox A10 in situ Hox A7 External ChIP Hox A7 Internal ChIP TTCCGCATCTACCCCTGGAT TGAGAGCGGCGGAGACAA TGAGAGCGGCGGAGACAA AGCGAAGGACAAGGCCACTT AACCTGCCCTGCGCCTCCTACGAC GCCCGGTGCGCTCTCCTT AGGCAGCCGGGAAGGAGCGAGTC CGTCTGTGAGCCTCTTCCCCTTCC CGGGGGAGGGGGCGAGAT CGCAGTCCATCGCCAACTTTA GAGGTCAAGGTCGCAGACCA CGCAGACCACGAAGCAAGCACATT GGTTCCAGACTATGGCCGACAT CCTGTGCCTGGCCCTTTACTCCTC TTCATTTTCATCCTGTTCTGG AGCAAACAAACACCAAGCAAACAG CATTACACCCCCAGATTTACACCA TTTGTTGTCCGGCAGCTTTCAGTG Hox A9 External ChIP Hox A10 External ChIP Hox A10 Internal ChIP GGTCGGTAGCCCATTTTAGGTG GCAGCGGGTTGGGCACATTCTCT TGCCCGGCAGCTTCCTTTTC GGGTCCCGCGTGTGAGCA AGGGGCAGCAGCTTCTCCAC CTCCCTGGCGGCTTTGACATTGAT Table 5: Genotyping and phenotyping primers for the Mll PTD/wt mice. 30

43 Probe Target Sequence (5 3 ) Hoxa7 CAGTTCAGGACCCGACAGGAA Hoxa9 CCCATCGATCCCAATAACCCGG Hoxa10 AGGGACCCGTCAAGGTTTCCGC Hoxc8 CCATGGATGAGACCCCACGCTCCT Table 6: Real time RT-PCR probe sequences. 31

44 Fig. 1 Generation of Mll PTD/wt mice. The backbone of the targeting vector is ploxpneo1 and contains a genomic clone spanning Mll intron 4 through intron 11. Linearization of the vector at a unique SfiI site within intron 4 allows for recombination at the germline intron 4 of Mll. A plasmid vector expressing Cre recombinase from a CMV promoter (pcre) was used to excise the neo cassette. 32

45 Fig. 1 Generation of Mll PTD/wt mice. 33

46 Fig. 2 Germ-line transmission and verification of correct targeting in mice heterozygous for the Mll PTD. A) Southern blot analysis using high molecular weight DNA from spleens, digested with NdeI and hybridized to a probe that spans intron 4/exon 5 of Mll (I4E5 in Figure 1). This generates a single wild type band at 18 kb in Mll wt/wt mice, and two bands representing one wild type allele at 18kb and a band at 40kb representing the rearranged allele in Mll PTD/wt mice. B) The Mll PTD fusion transcript was amplified using an upstream primer from Mll exon 11 and a downstream primer from Mll exon 6 amplifying a single 335-bp unique fusion transcript in the Mll PTD/wt mouse (+), and is absent in the sample from the Mll wt/wt mouse (-). Sequencing of these PCR products from the Mll PTD/wt mice verified the presence of the exon 11-exon 5 fusion site. 34

47 Fig. 2 Germ-line transmission and verification of correct targeting in mice heterozygous for the Mll PTD. 35

48 Fig. 3 Schematic demonstrating the Real time RT-PCR strategy for detection and absolute quantification of the Mll wt and Mll PTD transcripts in bone marrow and spleen of Mll PTD mice. The predicted Mll PTD and Mll wt allelederived transcripts are shown, with the tandemly duplicated exons 5-11 present in the PTD transcript denoted with light gray boxes. Shown below the transcripts are sites for PCR primers and fluorogenic probes designed to amplify either the unique exon 11-exon 5 fusion (open rectangle) or exon 14 to 15 whose junction is common to the Mll wt and Mll PTD transcripts (closed rectangle). To determine if the equivalent amount of transcript was being produced from each allele in the Mll PTD/wt tissues, the Mll PTD unique fusion amplicon copy number was subtracted from the common amplicon (shared between both the Mll PTD and Mll wt alleles) copy number (see Table 2). 36

49 Fig. 3. Schematic demonstrating the Real time RT-PCR strategy for detection and absolute quantification of the Mll wt and Mll PTD transcripts in bone marrow and spleen of Mll PTD mice. 37

50 Fig. 4 Skeletal analysis of Mll PTD/wt mice at 20 weeks of age. A) Alizarian red staining of Mll PTD/wt (left) and Mll wt/wt (right) mice, show a rudimentary/missing 13th rib indicative of a T13 L1 transformation (penetrance of 70% in Mll PTD/wt mice, n=13). 3D micro-ct images of the sacral spine in a B) Mll PTD/wt mouse, and C) Mll wt/wt mouse. These images are viewed from the dorsal side and illustrate the duplication of the S1 vertebral body indicative of a S2 S1 transformation in the Mll PTD/wt mice (penetrance of 63%, n=11). 38

51 Fig. 4 Skeletal analysis of Mll PTD/wt mice at 20 weeks of age. 39

52 Fig. 5 In situ hybridizations for Hoxa9 on E12.5 embryos. A) Mll wt/wt and B) Mll PTD/wt embryos hybridized with a digoxygenin labeled probe for Hoxa9. Results demonstrate a notable ventral shift of the Hoxa9 expression boundary within the paraxial mesoderm of the Mll PTD/wt embryo compared to the Mll wt/wt littermate control (see inset for each figure). This figure represents one of three comparable hybridizations. 40

53 Fig. 5 In situ hybridizations for Hoxa9 on E12.5 embryos. 41

54 Fig. 6 Evaluation of progenitor populations in Mll PTD/wt splenocytes compared to Mll wt/wt sex-matched littermate controls. A) Results from colony forming units (CFU) assays to assess progenitors of erythroid (BFU-E), granulocytic, erythroid, monocytic, megakaryocytic (CFU-GEMM), and granulocyte, macrophage (CFU- GM) lineages show significantly increased CFUs derived from Mll PTD/wt vs Mll wt/wt splenocytes. *P =0.03, **P = Error bars indicate SD. Five Mll PTD/wt and five Mll wt/wt mice were sacrificed, 1 x 10 5 splenocytes were cultured/plate, and 3-30 colonies were enumerated per plate, each done in > duplicate. Splenocytes from B) Mll wt/wt and C) Mll PTD/wt mice (n=8 mice per genotype) show increased surface density expression of the erythroid progenitor marker Ter119 in Mll PTD/wt mice. Secondary splenic colonies from D) Mll wt/wt E) Mll Af9/wt, and F) Mll PTD/wt mice (n=6 mice per genotype, each plated in duplicate). While the numbers of secondary colonies per plate (~230) were similar between genotypes, the number of cells per colony is dramatically increased in Mll PTD/wt mice compared to Mll wt/wt or Mll Af9/wt mice, resulting in large differences in the overall size of these colonies. G-I): Primary CFU progenitor cells were harvested after 14 days and maintained in liquid cultures for an additional 18 days supplemented with SCF, IL-3, and IL-6, and in the presence of BrdU for the last 4 days. Cell staining on day 18 with an anti-brdu antibody gaited on viable cells demonstrates a smaller fraction of Mll wt/wt cells proliferating (G) compared to Mll PTD/wt cells (H). An assessment of programmed cell death (I, upper right and lower right quadrants) reveals a sizeable fraction (~50%) of 42

55 these Mll PTD/wt progenitors undergoing apoptosis during expansion. Thus, while a significant fraction of the Mll PTD/wt cells are proliferating, ~50% are undergoing apoptosis. In two additional experiments, the Mll wt/wt cells had already died by this time point in culture (see Table 3), thereby precluding a statistical comparison of these result in 6G-I. 43

56 Fig. 6 Evaluation of progenitor populations in Mll PTD/wt splenocytes compared to Mll wt/wt sex-matched littermate controls. 44

57 Fig. 7 Quantification of Hoxa7, Hoxa9, and Hoxa10 expression in hematopoietic tissues of Mll wt/wt and Mll PTD/wt mice. Cells were isolated from A) BM, B) spleen, and C) blood from both Mll wt/wt and Mll PTD/wt mice (n=10 mice per genotype). RNA and then cdna was prepared and quantified by Real time RT-PCR. Mll PTD/wt mice show increased expression of each of these HoxA genes in all three tissues compared to sex-matched littermate Mll wt/wt mice. D) Equal numbers of each sorted BM population expressing Gr-1, CD11b, CD3, B220 or Ter119 from Mll PTD/wt mice and Mll wt/wt mice were processed for RNA and then cdna. Absolute quantification of Hoxa9 expression was then determined by Real time RT-PCR and demonstrated that Mll PTD/wt cells have increased Hoxa9 expression within each population compared to the equivalent number of Mll wt/wt cells, indicating the Hoxa9 transcript levels are overexpressed on a per cell basis (values shown represent mean of n=3 mice per genotype + SD; P<0.03). 45

58 Fig. 7 Quantification of Hoxa7, Hoxa9, and Hoxa10 expression in hematopoietic tissues of Mll wt/wt and Mll PTD/wt mice. 46

59 Fig. 8 Assessment of an Mll target gene Hoxa9 acetylation and methylation of histones assessed by ChIP. Using A) bone marrow cells and B) splenocytes derived from Mll PTD/wt and Mll wt/wt mice., results show an increase at the Hoxa9 promoter in histone H3/H4 acetylation, as well as histone H3 (lys4) methylation and a corresponding decrease in histone H3 (Lys9) methylation in Mll PTD/wt bone marrow and spleen compared to the same Mll wt/wt tissues. Results are representative of 3 independent experiments. Similar results were obtained at the Hoxa7 promoter but were not seen at the Hoxa10 promoter (not shown). C) BM cells and D) splenocytes derived from Mll PTD/wt, Mll wt/-, and Mll wt/wt mice. Absolute quantification by SYBR green Real time PCR shows a significant increase at the Hoxa9 promoter in histone H3/H4 acetylation, as well as histone H3 (lys4) methylation in Mll PTD/wt BM and spleen compared to the same Mll wt/-, and Mll wt/wt tissues (n=3 mice per genotype, P < 0.05). There was no significant difference between Mll wt/- and Mll wt/wt tissues. 47

60 Fig. 8 Assessment of an Mll target gene Hoxa9 acetylation and methylation of histones assessed by ChIP. 48

61 Fig.9 Representative flow cytometric analyses of BM cells. A) Mll PTD/wt and B) Mll wt/wt BM cellstaken between weeks 12-20, demonstrating no significant differences between these two genotypes. These data are also representative of results obtained in spleen and blood from these two genotypes, with the exception of Ter119 expression in spleen as shown above in Figure 6B and 6C. Staining and analysis were performed on N = 5 mice/genotype as previously described 57,58. 49

62 Fig 9. Representative flow cytometric analyses of BM cells. Mll PTD/wt A (CONTINUED) 50

63 Fig.9: CONTINUED Mll wt/wt B 51

64 CHAPTER 3 THE ROLE OF THE Mll WILD TYPE (WT) IN MICE WITH THE MLL PTD 3.1. Introduction Approximately 5-10% of patients with AML and normal cytogenetics present with rearrangement of the Mixed-Lineage Leukemia, (MLL, also known as ALL1 or HRX) gene as the result of a partial tandem duplication within a single MLL allele 13,59. In AML blasts harboring the somatic MLL PTD mutation, the MLL wild type (WT) allele is not expressed and when re-expressed, leukemic cell death was observed 28. We previously reported on the Mll PTD/WT knock-in mice that are fully viable with modest developmental defects, have aberrant gene expression and altered hematopoiesis, but do not develop leukemia 60. These mice express both the Mll PTD and WT Mll alleles. Thus, to partially recapitulate what is observed in human primary AML blasts regarding the MLL-PTD and absence of MLL-WT expression, we generated mice that harbor a Mll-PTD but lack Mll-WT (Mll PTD/- ) in the germline. We then asked how loss of function of Mll WT in the context of Mll-PTD would affect HoxA gene expression, developmental and hematological abnormalities previously observed in Mll PTD/WT mice and, eventually, occurrence of leukemia. 52

65 3.2. Results and Discussion Results of the comparative analysis between the Mll WT/WT, Mll WT/-, Mll PTD/WT and Mll PTD/- mice are summarized in Table 6. In terms of survival, the first three genotypes were all viable and born at expected Mendelian ratios, however, although present at normal Mendelian ratios, 100% of the pups having the Mll PTD/- genotype died on postpartum day 1 (P1). Interestingly, Mll -/- mice are also non-viable, but die around E These results indicate the Mll PTD itself provides, albeit insufficient, compensation for embryonic development in the absence of both Mll WT alleles. Mll regulates Hox genes that are important for skeletal development. Disruptions in Hox gene expression can result skeletal deformities 61,62. CT-scans performed on day P1 Mll PTD/- pups revealed extensive fusions within their cervical vertebra (Figure 9A), most likely accounting for their premature death as there we no other defects noted on gross and histologic examination of these pups at autopsy. Mll WT/- mice also display gross disruptions in cervical spine development 5,7 while Mll WT/WT and Mll PTD/WT mice do not (Figure 9A and Table 6). These data suggest that such developmental defects result from a loss of WT Mll, i.e., gene dosage, rather than the presence of the Mll PTD. Conversely, the S1 duplication within the sacral spine was only found in the Mll PTD/WT mice, indicative of a requisite cooperation between the Mll PTD and the Mll WT alleles in causing this defect. 53

66 With regards to HoxA gene expression, we found in E17.5 fetal liver cells that the Mll PTD is required for aberrant over expression of HoxA genes. Mll PTD/WT and Mll PTD/- mice showed nearly equivalent levels of HoxA over-expression, while Mll WT/- fetal liver cells express HoxA levels that are consistently lower but not significantly different from the expression levels found in Mll WT/WT fetal liver cells (Figure 1B). Thus the over-expression of HoxA is associated with the Mll PTD itself, and is not dependent on the presence or absence of the Mll WT allele. Although premature death of the Mll PTD/- mice precluded assessment of leukemia development, we did examine fetal livers for any alterations in normal hematopoiesis. We performed colony forming unit (CFU) assays to assess fetal hematopoietic liver function in vitro using E17.5 fetal liver cells obtained from each of the four genotypes. Significant increases in the CFU-GM, BFU-E and the more immature CFU-GEMM were seen in cells obtained from the Mll PTD/WT mice compared to Mll WT/WT mice (P<.01, P<.01 and P<.05, respectively), suggesting that the Mll PTD may cooperate with the Mll WT allele at an early stage of hematopoiesis such as the common myeloid progenitor cell. In contrast, fetal liver cells obtained from Mll PTD/- mice had increases in the CFU-GM and BFU-E populations compared to Mll WT/WT mice (P<.05 and P<.05, respectively), but not in the CFU-GEMM population (Figure 1C). This is consistent with the notion that the Mll PTD itself is required and sufficient for abnormal expansion at a later stage of progenitor cell differentiation. These results also support two recent reports that showed the role of Mll WT in hematopoietic stem cells is distinct from its role in hematopoietic progenitor cells 9,10. 54

67 The differences between Mll PTD/WT and Mll PTD/- mice suggest that Mll WT cooperates with the Mll PTD in the genesis of some, but not all of the phenotypic abnormalities found in the Mll PTD/WT mice, while similar phenotypic abnormalities found in these two genotypes supports the notion that the Mll PTD by itself is capable of dysregulating downstream targets and can therefore behave as a true gain-offunction mutation. Going beyond the Mll PTD, we speculate that the consequences of some human leukemia-associated MLL mutations may vary depending not only on whether MLL WT is present but also on the cell type and/or on the downstream target being examined. These possibilities should be considered when investigating the role of MLL mutations in the genesis and progression of leukemia. 55

68 3.3. Experimental Procedures Generation of Mll PTD/- mice. Mll WT/- mice 61 (generously provided by the late Dr. Stanley Korsmeyer), were crossed with the Mll PTD/WT mice 60, to generate the Mll PTD/- genotype. Comparative Real time RT-PCR. Total RNA was extracted from E17.5 fetal liver cells from Mll PTD/WT, Mll PTD/WT, Mll WT/-, and Mll WT/WT. cdna was prepared and Hoxa7, Hoxa9 and Hoxa10 transcripts were quantified by comparative real time RT- PCR as previously described 55,60. CFU-progenitor assays. To assess the different hematopoietic progenitor populations, fetal liver cells from E17.5 were isolated from Mll PTD/-, Mll PTD/WT, Mll WT/- and Mll WT/WT embryos. Single cell suspensions were prepared in Iscove's Modified Dulbecco's Medium (Invitrogen) containing 2% of fetal bovine serum (Invitrogen). Cells were then plated at a density of 5x 10 4 cells/dish in M3434 methylcellulose (Stem Cell Technologies). All colony assays were performed according to the manufacturer s protocol (Stem Cell Technologies) and methods as previously described

69 Skeletal Analysis. Intact skeletons from Mll PTD/WT, Mll PTD/-, and Mll WT/WT E17.5 embryos were prepared. Specimens were mounted in 50 ml plastic test tubes filled with glycerol and micro-ct images were obtained at 32 kv, 1 ma, and 1 sec exposure with image intensifier operating in 7" mode. The spatial resolution of the images was 60 micrometers. Statistics. To evaluate whether significant differences in CFU-GEMM, CFU-GM, BFU-E existed between mouse genotypes as indicated in the Figure legend, paired t- tests were carried out using siblings. 57

70 3.4. Tables, Figures, and Figure Legends Characteristic Mll PTD/WT Mll PTD/- Mll WT/- Mll WT/WT Ectopic ossification of C2 no yes yes 16 no Premature Death no yes* no no HoxA expression increased increased but n.s. normal Increased CFU-GM yes yes no - Increased BFU-E yes yes no - Increased CFU-GEMM yes no no - Sacral Duplication yes no no no n.s., not significant at alpha level = comparator genotype * 100% mortality on P1 in > 8 liters Table 7. Comparison of Mll genotypes. 58

71 Figure Legend Figure 10. Phenotypic characterization of the Mll PTD/- mice. A.) Mll PTD/- mice exhibit abnormalities in cervical vertebral development. CT-scans were performed on Mll PTD/- and Mll WT/WT E17.5 embryos fixed in 10% buffered formalin. Mll PTD/- embryos showed cervical vertebral fusions (arrow) while Mll PTD/WT (not shown) and Mll WT/WT embryos did not show any abnormalities of the cervical vertebrae (n=5 mice per genotype, p<0.002). B.) Increased HoxA gene expression in Mll PTD/- E17.5 fetal liver cells. Using real time RT-PCR, Hoxa7, Hoxa9, and Hoxa10 were shown to be overexpressed in E17.5 fetal liver cells from Mll PTD/- and Mll PTD/WT embryos compared to both Mll WT/- and Mll WT/WT littermate controls. Error bars show standard deviation. C.) E17.5 fetal liver hematopoietic progenitor populations were assessed by colony forming unit (CFU) assays. Mll PTD/WT mice showed increases in CFU-GM, BFU-E and CFU-GEMM compared to Mll WT/WT, while Mll PTD/- mice showed increases in CFU-GM and BFU-E compared to Mll WT/WT. Error bars represent standard error of the means. *P<0.05, **P<

72 Fig.10. Phenotypic characterization of the Mll PTD/- mice. A (CONTINUED) 60

73 Fig.10: CONTINUED Mll WT/WT Mll WT/- Mll PTD/WT Mll PTD/ Hoxa7 Hoxa9 Hoxa10 B (CONTINUED) 61

74 Fig.10. (CONTINUED) C 62

75 CHAPTER 4 PRELIMINARY DATA AND FUTURE DIRECTIONS 4.1. Further characterization of our Mll PTD/wt mice Our initial studies characterizing the Mll PTD/wt mice have demonstrated that pathways that involve HPC self-renewal and proliferation are disrupted as a direct result of the Mll PTD in these cell types. Identifying several aberrant pathways would provide us multiple avenues that we could potentially target using novel or even previously developed therapies Cell Survival and Proliferation In a preliminary assessment of the proliferative capacity of the Mll PTD in vivo, drinking water was supplemented with bromodeoxyuridine (BrdU) a nucleotide analog that incorporates into the DNA of proliferating cells. BM, spleen, and PB cells were harvested and analyzed by flow cytometry, showing that after 7 days of ingestion, the Mll PTD/wt mice have a higher proliferative index in spleen and PB. By 7 days, the BM was saturated as the majority of cells had taken up BrdU in both genotypes. Thus, only a small increase in proliferating cells was seen in the BM of the Mll PTD/wt mice (Figure 11). Our BrdU (Figure 11) and CFU data (Figure 6) demonstrate a significant increase in the proliferative and self-renewal capacity of cells harboring the Mll PTD. 63

76 To assess whether this increase in proliferation occurs within a specific cell population(s) in the Mll PTD/wt mice compared to Mll wt/wt littermate controls, mice will need to be dosed for 1, 3, and 7 days with BrdU. After harvesting cells from the BM, spleen, and peripheral blood BrdU incorporation can be measured using the BrdU detection kit (BD Biosciences) and standard flow cytometric analysis. To measure the proliferation of these populations in vivo, an extensive flow panel, which includes the following lineage markers: CD44, CD8, CD4, CD62L, CD44, CD71, Ter119, c-kit, ScaI, ScaII, Gr-1, CD41, CD11b, CD3, CD45, DX5, CD135, should be used along with an anti-brdu antibody. To evaluate the more immature cell populations such as the HSC (lin - /Thy1.1 low /c-kit high /Sca-1 high ), CMP (lin - /Thy1.1 - /Il7R - /c-kit high /Sca-1 - /CD34 + /FcγR low ), GMP (lin - /Thy1.1 - /Il7R - /c-kit high /Sca-1 - /CD34 high /FcγR high ), MEP (lin - /Thy1.1 - /Il7R - /c-, they should be co-stained with the anti-brdu. From our preliminary in vivo BRDU experiments (Figure 11) we would expect certain specific populations within these tissues to be proliferating at an increased rate in the Mll PTD/wt mice compared to Mll wt/wt mice. Furthermore, preliminary data looking at the progenitor (Figure 6) and HSC populations (discussed below, Figure 12) suggest that the rate of proliferation is increased in the more immature cell types within the Mll PTD/wt hematopoietic compartments. Since the Mll PTD/wt mice are still able to maintain normal homeostasis despite the increase in proliferation, we suspect an increase in cell turnover occurs concomitantly with the increase in cell proliferation of the Mll PTD/wt mice. To determine whether this is the case for the Mll PTD/wt mice, detection and quantification of apoptosis can be performed using Annexin V and propidium idodide (PI) staining. 64

77 This method determines the percentage of MNCs from whole BM, splenocytes, and peripheral blood that are actively undergoing apoptosis. In order to evaluate more mature cell populations, co-staining with Annexin V and PI, along with lineage specific antibodies including: CD44, CD8, CD4, CD62L, CD44, CD71, Ter119, c- Kit, ScaI, ScaII, Gr-1, CD41, CD11b, CD3, CD45, DX5, CD135 can be used. The more immature lineage- (lin-) populations can be assessed using their respective lineage markers HSC (lin - /Thy1.1 low /c-kit high /Sca-1 high ), CMP (lin - /Thy1.1 - /Il7R - /c- Kit high /Sca-1 - /CD34 + /FcγR low ), GMP (lin - /Thy1.1 - /Il7R - /c-kit high /Sca-1 - /CD34 high /FcγR high ), MEP (lin - /Thy1.1 - /Il7R - /c-kit high /Sca-1 - /CD34 - /Fc R low ), and CLP (lin, c-kit LO, Sca-1 LO, IL-7Rα + ) 30,63 and co-stained with AnnexinV and PI. Annexin V-positive/PI-negative population includes those intact cells undergoing early apoptosis, while Annexin V-positive/PI-positive population includes necrotic cells, which represent those cells disrupted during harvesting, or late apoptotic cells. If an increase in turnover compensates for the increase in proliferative ability of one or more populations in the Mll PTD/wt hematopoietic compartment, we would expect an increase in the apoptotic fraction in the Mll PTD/wt mice as compared to matched Mll wt/wt mice. We expect that the Mll PTD confers only one-hit in the pathogenesis of leukemia and that these mice still retain a compensatory mechanism, i.e., increased turnover, such that a gross aberrant hematopoietic phenotype does not develop. 65

78 Competitive Repopulation Assays Our colony data (Figure 6) suggest increases in multiple immature cell populations in the Mll PTD/wt mice. Functional differences in these immature cell types can be determined using a competitive repopulation unit (CRU) assay and limiting dilution analysis (LDA) 64. These experiments test whether the Mll PTD confers a selective growth advantage in vivo over WT cells. In a preliminary experiment using n=3 mice per genotype, 1x10 6 whole BM cells from Mll PTD/wt -Ly5.2 mice were mixed with 1x10 6 whole BM cells from WT-Ly5.1 mice. These cells were then adoptively transferred to lethally irradiated WT-Ly5.1 recipients (Figure 12). After 16 weeks, the mice were bled, and the percentage of cells derived from WT-Ly5.1 and PTD- Ly5.2 BM cells were analyzed using anti-ly5.2-fitc and anti-ly5.1-pe antibodies and flow cytometry. In all three recipients, the majority of the cells (>80%) in the peripheral blood were derived from the PTD-Ly5.2 BM cells (Figure 12). To repeat the CRU experiments and further determine the ability of the Mll PTD HSCs and HPCs to reconstitute the hematopoietic system, the lin+ populations should be depleted. Next, using10 5 lin - BM HSCs/HPCs from 4-6 week old Mll PTD/wt and Mll wt/wt Ly5.2 mice, these cells should be co-transplanted through direct intrafemoral injection into anesthetized and lethally irradiated 6-week-old syngeneic WT-Ly5.1 mice. Donor-derived reconstitution can be determined through flow cytometric analysis (Ly5.2 vs Ly5.1). To evaluate the differences between Mll PTD/wt and Mll wt/wt HSCs in reconstituting the hematopoietic system, limiting dilutions of 0 (PBS only), 25, 50, 100, or 200 Ly5.2 Mll PTD/wt sorted HSCs (lin - /Thy1.1 low /c- Kit high /Sca-1 high ) from BM, together with 10 5 twice serially transplanted Ly5.1 BM 66

79 cells, can be injected into lethally irradiated WT-Ly5.1 recipients. At 10 weeks posttransplantation, the PB of each recipient should be examined with FACS to determine Ly5.2 vs Ly5.1 donor- vs. recipient-derived reconstitution. The limiting dilution can be determined by plotting the proportion of donor-derived reconstituted recipients against the number of lin - BM cells that are transplanted. Next, to determine the phenotype of the HSC, serial transplantation experiments can be performed by transplanting 2.0 X 10 6 Ly5.2 BM mononuclear cells (MNCs) from Mll PTD/wt and Mll wt/wt mice into lethally irradiated WT-Ly5.1 recipients. Eight weeks after transplantation, the same number of BM MNCs can be collected from primary transplants and re-transplanted >5 additional times. Utilizing both the CRU and LDA as quantitative assays detects whether differences in the in vivo reconstituting ability of the Mll PTD cells are due to increased HSC numbers or due to increases in the proliferative and/or self-renewal capacity of the Mll PTD HSCs. While HSCs are thought to be capable of self-regeneration in vivo over a lifetime without an apparent limit under homeostatic conditions, it is well known that the repopulating ability of HSCs can be significantly compromised in transplant recipients. 30 Studies by several laboratories have demonstrated that the functional HSC units reach only 4% to 10% of normal levels after each transplantation; consequently, serial BM transfer can only sustain hematopoiesis for 4 to 6 rounds in irradiated mouse recipients. The limited repopulating ability of HSCs during serial transplantation has led to one view that the self-renewal ability of HSCs is intrinsically limited 60. We would expect that a lower number of Mll PTD/wt BM cells will be needed to repopulate the 67

80 hematopoietic compartment of WT-Ly5.1 compared to Mll wt/wt BM cells, since there is a greater proportion of reconstituting cells within the hematopoietic compartment of Mll PTD/wt mice. We would also expect that Mll PTD/wt BM cells will have greater capacity to serially reconstitute the hematopoietic system of lethally irradiated recipients compared to Mll wt/wt BM cells, since we have seen the increased capacity for self-renewal of the HPCs in our in vitro experiments Enhanced Myelopoiesis One reason for the increased progenitor cell numbers in our Mll PTD/wt mice may also be due to an increased ability of a more committed progenitor cell to undergo sustained self-renewal. Recent work by Kristov et al. showed that introduction of the Mll-Af9 translocation into more committed granulocytemacrophage progenitor cells induced a self-renewal program in these lineagecommitted cells, and ultimately leukemic transformation 65. Furthermore, a study by Cozzio et al. showed that transduction of the Mll-Enl oncogene into HSCs, GMPs, and CMPs gave rise to leukemias with similar immunophenotypes 66. Transformation of the HSC and more mature CMP and GMP populations occurred with similar latency and at similar stages of development. These studies demonstrate the ability of these MLL fusions to contribute to increased self-renewal in multiple cell types that are ultimately capable of being leukemic. These studies not only contribute to our understanding of MLL-mediated leukemogenesis, but also contribute significantly to our general understanding of leukemia itself. 68

81 Previously, it was not clear which populations actually had the capacity to cause leukemia, and whether more mature progenitor cells were indeed capable of transformation. Studies like those described above demonstrate the importance of understanding not only a specific function of the Mll PTD, but also how exactly this mutation contributes to a disease phenotype within the cell-specific context in which the Mll PTD can exert these functions. To perform similar experiments with our Mll PTD/wt mice, the immature cell populations can be isolated from the spleens and bone marrow of Mll PTD/wt and Mll wt/wt mice (n=3 mice of each genotype). CMP and GMP cells can be sorted according to their cell surface markers: CMP (lin - /Thy1.1 - /Il7R - /c-kit high /Sca-1 - /CD34 + /FcγR low ), GMP (lin - /Thy1.1 - /Il7R - /c-kit high /Sca-1 - /CD34 high /FcγR high ). These cells would then be injected intra-femorally along with a radioprotective dose of 2.5 x 10 5 syngeneic WT-Ly5.1 BM cells into sub-lethally irradiated syngeneic WT-Ly5.1 (n=3 recipients per donor per organ). Since Mll PTD/wt progenitor cells display an increased capacity to self-renew, we would expect the Mll PTD/wt CMP and possibly GMP progenitor cells to sustain myelopoiesis in vivo longer than the Mll wt/wt CMPs and GMPs. Starting 2 weeks post-transplantation, bi-weekly bleeding and flow staining using the commercially available Ly5.2-FITC and Ly5.1-PE antibodies can help determine cell origin (donor vs. recipient), along with the myeloid specific lineage antibodies Gr-1 and CD11b. These studies can address whether the Mll PTD/wt transplanted cells are able to persist for a longer duration in vivo than the Mll wt/wt cells. 69

82 Contribution of Hoxa7 and Hoxa9 Overexpression. Hox gene overexpression is a common finding among different leukemia subgroups, especially the HoxA genes, 40-42,67,68 and in particular Hoxa7 and Hoxa9. We have shown previously that all hematopoietic compartments from Mll PTD/wt mice overexpress Hoxa7, Hoxa9, and Hoxa10 (Figure 7). We wanted to test the functional requirements for Hoxa7 and Hoxa9 in the Mll PTD-associated increase in HPC selfrenewal and proliferation. These experiments would elucidate whether these HoxA genes are essential downstream targets in MLL PTD AML and whether they would contribute to the poor prognosis of this subgroup. Hoxa7 and Hoxa9-deficient mice exhibit quantitative reductions in the frequency of phenotypically defined HPCs 69. Our understanding of leukemogenic mechanisms by MLL aberrancies will be enhanced by whether or not downstream targets like the aforementioned HoxA genes play a role in Mll PTD-mediated changes in hematopoiesis. Several studies have determined that leukemic cells with an MLL PTD are distinct from those with MLL translocations and that clinical outcome varies with some MLL fusions, i.e., t(9;11) 18,28,70. Studies looking at the role of Hoxa7 and Hoxa9 in leukemic transformation using two different Mll fusions gave different results 71,72. Lastly, several groups including our own show that MLL PTD+ AML is significantly associated with a French-British-American morphology of M2 73,74. This discovery contrasts with the majority of studies correlating MLL chimeric fusions that arise from balanced translocations with more differentiated M4/M5 FAB morphology. Identifying similar, as well as distinct contributing factors that function with the various MLL mutations will help develop better therapies targeting those factors. 70

83 In a preliminary experiment addressing the importance of the HoxA genes in Mll PTD-mediated leukemogenesis, we crossed our Mll PTD/wt mice with the Hoxa7 and Hoxa9 knock-out mice. In these experiments, we performed CFU assays on these Mll PTD/wt Hoxa7 -/- and Mll PTD/wt Hoxa9 -/- splenocytes, and observed that the number of HPCs were still increased in cells with the PTD even without Hoxa7 or Hoxa9 overexpression (Figure 13). Our results suggest that unlike some Mll translocations, Mll PTD progenitor cell aberrancies most likely result from dysregulation of targets other than these HoxA genes. In order to have more confidence in these results, it would be necessary to repeat these experiments with enough mice to have a minimum of 85% statistical power. We will continue to cross the Hoxa9 +/- and Hoxa7 +/- mice to our Mll PTD/wt mice to assess the hematopoietic populations. Experiments like those performed in chapter 2 (Figure 6) should be performed to assess the self-renewal and differentiation capacity of populations within the BM, spleen, and PB of the Mll PTD/wt Hoxa7 -/- and Mll PTD/wt Hoxa9 -/- mice. Since Hoxa10 is also aberrantly expressed in Mll PTD/wt HPC (Figure 7), and Hoxa10 -/- females have implantation and decidualization failure, 75 it is not possible to cross our Mll PTD/wt mice with these knock-out mice. Therefore, RNAi can be used to down-regulate Hoxa10 expression in our mice. Other labs have successfully knocked down Hoxa9 expression in Mll-Cbp mice, demonstrating that Hoxa9 is required for enhanced proliferation in Mll-Cbp mice, 76 thereby providing suggestive evidence that this method of Hoxa10 down-regulation should be feasible. 71

84 4.2. Introducing Secondary Mutations Despite the lack of malignant disease in our Mll PTD/wt mouse model, much has been learned about the possible role of the Mll PTD in leukemogenesis. Our data demonstrate that the Mll PTD is not sufficient to cause overt malignant disease but instead imparts enhanced proliferation and self-renewal of immature blood cell types, and has allowed us to potentially identify the specific role of the Mll PTD in leukemic transformation. After our initial observations revealing that the Mll PTD has a role in aberrant self-renewal and proliferation of hematopoietic progenitor cells (HPCs), we next attempted to identify other cooperating events that are necessary/sufficient with the Mll PTD to cause or maintain malignant disease MLL PTD and FLT3 ITD Mutations in Leukemia We began to address this question by introducing a secondary mutation into cells which already harbor the Mll PTD. To make it relevant to what is seen in the human patients, we chose a mutation that has been shown to occur in MLL PTD+ AML patient blasts. Several studies have shown that the internal tandem duplication of FLT3 (Fms-Like Tyrosine Kinase 3), the FLT3 ITD, occurs with the MLL PTD in a fraction of patients with normal cytogenetics One study looking at the occurrence of FLT3 mutations in patients with the MLL PTD showed these FLT3 mutations were present in 54% of the MLL PTD positive cases, while FLT3 mutations occurred only 15% of the time in the more common MLL translocations (p< ) 80. Therefore, we hypothesized that the 72

85 simultaneous presence of mutations could lead to leukemic transformation in our mouse model. We obtained the FLT3 ITD/wt mice from the Gilliland lab and began mating these mice to our Mll PTD/wt mice Background on the FLT3 ITD/wt Knock-In Mice To generate the Flt3 ITD/wt mice Lee et al., used a human FLT3 ITD targeted to the endogenous Flt3 locus in mouse embryonic stem (ES) cells. Resulting mice were then bred onto the C57BL/6J background. Flt3 ITD/ITD and Flt3 ITD/WT mice breed normally and live a relatively normal life span, however, they present with enlarged livers and increased hemoglobin and platelet counts, splenomegaly, and increased monocyte and granulocyte populations. There is a block in B cell development characterized by an increase in B220 + CD43 - pre-b cells and a decrease in the mature B220 + IgM + cell types. Flt3 ITD/ITD and Flt3 ITD/WT mice also had increases in the number of HPCs as quantified by CFU assays. AnnexinV and propidium iodide (PI) staining as well as cell cycle analyses, revealed that increases in survival and proliferation of these myeloid progenitor cells most likely account for the higher number of these cells. Importantly, these progenitor cells did not display concomitant increases in self-renewal, as determined by serial re-plating assays Preliminary Data Characterizing the Mll PTD/wt Flt3 ITD/wt Mice Mll PTD/wt Flt3 ITD/wt mice are born at normal Mendalian rations with no signs of delayed growth. After ~30 weeks of age Mll PTD/wt Flt3 ITD/wt mice started dying prematurely. In fact no Mll PTD/wt Flt3 ITD/wt mice have survived past 60 weeks of age 73

86 (n>15 mice, p<0.001). Conversely the Mll PTD/wt and Flt3 ITD/wt littermate controls all lived normal life spans (>90 weeks). After these initial observations, mice were monitored weekly for loss of activity and/or weight. In early litters, mice showed no visible signs of disease, making it exceedingly difficult to catch the Mll PTD/wt Flt3 ITD/wt mice shortly before death. In subsequent litters, mice were observed daily while complete blood counts (CBCs) and weights were taken weekly. In fact, mice display normal activity up to ~24 hours before death, demonstrating the acute nature of the disease. At time of death mice present with anemia and with a greater than 20 fold-increase in WBCs compared to littermate controls (Figure 14). Cytospins of BM and spleen, as well as blood smears all show 20-80% blasts present. Extensive infiltration of leukemic cells in multiple organs have been seen in all Mll PTD/wt Flt3 ITD/wt tissues examined to date (Figure 15), all consistent with acute leukemia. The lineage determination of the leukemia is currently pending further analysis Future Experiments Characterizing the Mll PTD/wt Flt3 ITD/wt Acute Leukemias. One of the obstacles in characterizing these acute leukemias is the confounding variable of the increased granulocytes and neutrophils characteristic of the Flt3 ITD/wt mice. Since the Flt3 ITD/wt mice display increases in granulocyte and monocyte populations, it is important to differentiate between the increased myeloid cells as a result of the ITD, from the leukemic blasts which are responsible for the pervasive organ infiltration and death. Therefore, immuno-histochemistry will be performed using lineage specific antibodies to determine if the malignant cells are 74

87 myeloid, lymphoid, or a mixed immunophenotype. Extensive flow cytometry will also be performed to fully evaluate the expression of cell surface markers on the diseased cells using the following lineage markers: CD44, CD8, CD4, CD62L, CD44, CD71, Ter119, c-kit, ScaI, ScaII, Gr-1, CD41, CD11b, CD3, CD45, DX5, and CD135. Leukemic cells will then be isolated using flow cytometric cell sorting and subsequently transplanted into sub-lethally irradiated syngeneic WT-Ly5.1 recipient mice. To perform these experiments, 1 x Ly5.2 malignant cells will be infused into n=6 recipient mice that have been given 5.0Gy of total body irradiation. Transplantation experiments using leukemic cells helps to identify the degree of malignancy and excludes any possibility that the lesion is reactive 82. In another mouse model, the Mll-Af9 and Flt3-ITD were co-infected into lin- BM cells and then transplanted into lethally irradiated recipient mice, a rapid leukemia developed with a disease latency of ~30 days. To determine the percentage of leukemia stem cells (LSCs) within the malignant cells, serial dilutions (10 4, 10 3, 10 2, 10 1 ) of the malignant cells were transplanted into secondary recipients. It was found that the frequency of LSCs was much higher than what is seen for other leukemia. Typically, 10 4 cells must be transplanted to induce disease in secondary recipients, however, in the case of the Mll-Af9 Flt3-ITD leukemia, only 100 cells were needed in secondary recipients to induce leukemia that was phenotypically identical to the disease seen in primary animals 83. Therefore, it would be of interest to determine if the leukemia we are studying had increased numbers of LSCs within the malignant cell populations. To perform these experiments, 10 4, 10 3, 10 2, and

88 cells from the BM and spleen of leukemic mice will be isolated and transplanted into sub-lethally irradiated recipients (n=3 mice/dilution). We expect that like the Mll-Af9 Flt3-ITD leukemia, that the Mll PTD/wt Flt3 ITD/wt leukemia will also have a higher frequency of LSCs within the malignant cell population, thus a smaller number of cells would need to be transplanted into secondary recipients to induce the same disease seen in primary mice. By generating this leukemic Mll PTD/wt mouse model, many new avenues of research are now possible. Previously, it has been very difficult to isolate a homogenous cell population within the hematopoietic compartment of the Mll PTD/wt mice expressing the Mll PTD transcript at levels high enough to begin looking at some of the biochemistry of the Mll PTD. It is our hope that further studies fully characterizing this model of acute leukemia will lead to the identification of new or altered pathways that could potentially be targeted by novel therapies for leukemia patients harboring the MLL PTD. 76

89 Fig.11 Assessment of proliferative capacity in vivo. Drinking water was supplemented with bromodeoxyuridine (BrdU) that incorporates into DNA of proliferating cells. BM, spleen, and PB cells were harvested and analyzed by flow cytometry, showing that after 7 days of ingestion, the Mll PTD/wt mice have a higher proliferative index in spleen and PB. 77

90 Fig.11 Assessment of proliferative capacity in vivo. Mll PTD/wt Mll wt/wt 78

91 Fig.12 Assessment of the increased ability of Mll PTD/wt stem cells to reconstitute recipient mice. Using n=3 mice per genotype, 1x10 6 whole BM cells from Mll PTD/wt - Ly5.2 mice were mixed with 1x10 6 whole BM cells from Mll wt/wt -Ly5.1 mice. These cells were then adoptively transferred to lethally irradiated Mll wt/wt -Ly5.1 recipients. After 16 weeks mice were bled and percentage of cells derived from Mll wt/wt -Ly5.1 and Mll PTD/wt -Ly5.2 BM cells were analyzed using Anti-Ly5.2-FITC and anti-ly5.1- PE antibodies and flow cytometry. In all three recipients, the majority of the cells in the peripheral blood were derived from Mll PTD/wt -Ly5.2 BM cells. 79

92 Fig.12 Assessment of the increased ability of Mll PTD/wt stem cells to reconstitute recipient mice. Mll wt/wt -Ly5.1 Mll wt/wt -Ly5.1 Mll wt/wt -Ly5.2 Mll PTD/wt -Ly5.2 80

93 Fig.13 Evaluation of progenitor populations. Results from colony forming units (CFU) assays to assess progenitors of erythroid (BFU-E), granulocytic, erythroid, monocytic, megakaryocytic (CFU-GEMM), and granulocyte, macrophage (CFU- GM) lineages shows that there are increases in Mll PTD/wt, Mll PTD/wt Hoxa7 -/-, and Mll PTD/wt Hoxa9 -/- splenic progenitor populations compared to Mll wt/wt. Error bars indicate SD. 81

94 Fig.13 Evaluation of progenitor populations Mll wt/wt Mll PTD/wt Mll PTD/wt HoxA7 -/- Mll PTD/wt HoxA9 -/ CFU-GEMM CFU-GM BFU-E 82

95 Fig.14 WBCs at time of death. WBCs at time of death show a greater than 20 fold increase in the number of WBCs in the Mll PTD/wt Flt3 ITD/wt mice compared to littermate controls. 83

96 Fig.14 WBCs at time of death WT PTD ITD PTD/ITD 84

97 Fig.15 Extensive infiltration of Mll PTD/wt Flt3 ITD/wt leukemic cells. A.) BM shown here at 40X demonstrates how the disease cells have completed infiltrated and taken over the BM space. B.) The adrenal gland shown here at 4X demonstrates large masses of diseased cells. 85

98 Fig.15 Extensive infiltration of Mll PTD/wt Flt3 ITD/wt leukemic cells. A B 86