Cyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK
|
|
- Harry Booth
- 6 years ago
- Views:
Transcription
1 3 rd Interntionl Conference nd Exhiition on Nutrition & Food Sciences Septemer 23-25, 214 Vlenci, Spin Cynidin-3-O-glucoside meliortes lipid nd glucose ccumultion in C57BL/6J mice vi ctivtion of PPAR-α nd AMPK Food Biomedicl Science L. Yoyo Ji Sep 23 th, 214
2 Bckground Nturl orgnic pigment Grpes Berries Cherries Apples Plums Red cge Red onion Antioxidnt Anti-inflmmtory effects Crdiovsculr Diseses Cncer Oesity Dietes To investigte the effects nd moleculr mechnisms of cynidin- 3-O-glucoside ()
3 Nucler Contining A Ftty Ftty Ftty Triglyceride Synthetic Endogenous Bckground Nucleus AMP:ATP rtio Exercise (muscle stimultion) Berries contining regulte lipid nd glucose metolisms lignds PPRE Thr172 P γ α β AMPK Lipid metolism Glucose metolism Peroxisome prolifertor-ctivted receptors (PPARs): receptors 3 isoforms: PPARα, PPARγ, PPARδ/β PPARα: mjor regultor of lipid metolism in the liver cid uptke (ftty cid trnsport) cid utiliztion (ftty inding nd ctivtion) cid ctolism (peroxisoml nd mitochondril ftty cid β-oxidtion) Ketogenesis turnover Lignds: lignds include the firte drugs (hyperlipidemi) lignds include ftty cids nd vrious ftty cid-derived compounds AMP-ctivted protein kinse (AMPK): An enzyme plys role in cellulr energy homeostsis Consists of three proteins (suunits): α, β, nd γ Three suunits together mke functionl enzyme AMPK: Stimulte: Ftty cid oxidtion Ketogenesis Inhiit: Lipogenesis Triglyceride synthesis Gluconeogenesis RXR: retinoid X receptor PPRE: peroxisome prolifertor hormone response elements
4 Experimentl design Moleculr trgets of BIAcore Surfce plsmon resonnce (SPR) Time resolution-fluorescence resonnce energy trnsfer (TR-FRET) coctivtor ssy AMPK ctivity ssy Animl/cell experimentl design HepG2 cells Lipid-loding for 24 h Tretment with for 24 h Scrifice Smple (plsm & orgns) collection Lipid contents Ftty cit oxidtion/synthesis Autophgy nlysis Gluconeogenesis : High ft diet (45%) : 1 mg/kg ody weight of fenofirte () : 1 mg/kg ody weight of cynidin-3-o-glucoside () Physiologicl relevnce & moleculr mechnisms of Body & orgn weight mesurement Plsm lipid, glucose, insulin & hormone mesurement Liver & dipose tissue histology & nlysis Liver lipid concentrtion mesurement Orl glucose tolernce test (OGTT) Insulin tolernce test (ITT) Autophgy pthwy nlysis qpcr & immunoloting
5 A 15 induces PPARα coctivtor ctivity vi direct inding to PPARα PPARα/ 8 PPARα/GW7647 Time resolution-fluorescence resonnce Surfce energy trnsfer Plsmon (TR-FRET) Resonnce coctivtor (BIAcore ssy SPR) Response Unit (RU) B Concentrtion (µm): Time (s) PPARγ/ Response Unit (RU) Concentrtion (µm): Time (s) PPARγ/TT Response Unit (RU ) C Response Unit (RU) D Concentrtion (µm): Time (s) PPARδ/β/ Concentrtion (µm): Time (s) PPARα GW7647 Response Unit (RU) Response Unit (RU) Concentrtion (µm): Time (s) PPARδ/β/GW742 Concentrtion (µm): Time (s) PPARγ Troglitzone (TT) K D vlues nd EC 5 vlues of nd positive controls PPARδ GW742 Positive controls PPARα PPARγ PPARδ PPARα PPARγ PPARδ GW7647 TT GW742 SPR 456 nm 1.36 µm 4.96 µm 13.2 nm 377 nm 12 nm TR-FRET 1126 nm 1.8 µm 3 µm 26.9 nm 82.3 nm 1.25 nm K D, the equilirium dissocition constnt ('inding constnt'); EC 5, Hlf mximl effective concentrtion TR-FRET Rtio Concentrtion (nm) EC 5 : = 1126 nm GW7647 = 26.9 nm TR-FRET Rtio Concentrtion (nm) EC 5 : = 185 nm TT = 82.3 nm TR-FRET Rtio 1..5 EC 5 : = 3146 nm GW742 = 1.25 nm Concentrtion (nm)
6 induces AMPKα1 ctivity vi direct interction with AMPKα1 A Luminescence (RLU) AMPK (α1/β1/γ1) ctivity Concentrtion (nm) A Luminescence (RLU) AMPK (α1/β1/γ1) ctivity (nm) + A (1 nm) + A (1 nm) B Luminescence (RLU) AMPK (α2/β1/γ1) ctivity Concentrtion (nm) A AMPK α γ β A EC 5 (nm) A1/B1/G1 A2/B1/G1 A directly ctivtes PPARα nd AMPK
7 reduces lipid ccumultion in mouse livers & heptocytes A Fold chnge 1..5 Intrcellulr Triglyceride B Triglyceride (mg/dl) Plsm triglyceride. Lipid (µm) GW7647 (µm) C 15 Heptic Triglyceride /dl) Triglyceride (mg/ 1 5 D 4 Plsm AST 2 Plsm ALT AST (U/L) ALT (U/L) c c AST, Asprtte Aminotrnsferse; ALT, Alnine Aminotrnsferse
8 induces heptic ftty cid oxidtion nd ketogenesis while decreses ftty cid synthesis vi regultion of PPARα & AMPKα1 A Fold chnge Ftty cid oxidtion Liver β-oxidtion (µmol/g/min) Ftty cid oxidtion c Lipid (µm) GW7647 (µm)o B Ftty cid synthesis Ftty cid synthesis C 4 Mlonyl CoA Fold chnge 1..5 fold chnge 1..5 ng/ml µm. (µm) (µm) O GW7647 (µm)o D. (µm) GW7647 (µm)o mrna expression in liver β-hydroxyutyrte reduces lipid ftty cid oxidtion,. inhiits ftty cid synthesis PPARα CPT1 LPL HMGCS2 E Fold chnge lipid ccumultion vi increses ketogenesis, wheres ACC, cetyl-coa croxylse CPT1, crnitine plmitoyltrnsferse 1; LPL, lipoprotein lipse; HMGCS2, 3-hydroxy-3-methylglutryl-CoA synthse 2
9 induces phosphoryltion of AMPK thus locks the mtor-s6k1 xis p-ampk T172 AMPK p-mtor T2446 mtor p-s6k1 T389 S6K1 β-ctin Fold chnge p-ampk/ampk p-mtor/mtor p-s6k1/s6k1 Fold chnge Fold chnge mtor, mmmlin trget of rpmycin; S6K1, P7-S6 Kinse 1
10 induces heptic utophgy pthwy A B C LC3I LC3II β-ctin GW7647 (µm) C LC3I LC3II α-tuulin Fold chnge LC3 II Fold chnge LC3 II Fluorescence (R Reltive Units) Autophgy c d. (µm) GW7647 (µm)o Tmoxifen (µm) (µm) D STF, STF No. of Autolysosomes/Cell Numer of Autolysosomes 5 reduces STF62247 (µm) lipid (µm) reduces lipid ccumultion vi ctivtes heptic utophgy pthwy
11 reduces plsm glucose & insulin concentrtions nd improves insulin sensitivity A Glucose (mg/dl) Plsm glucose c c ng/ml Plsm insulin B Plsm glucose level (mg/dl) OGTT AUC 1..5 AUC of OGTT Time(min). C Plsm glucose level (mg/dl) ITT Time(min) AUC AUC of ITT D Insulin-sensitive Index c c HOMA-IR c c HOMA-IR, Homeosttic Model Assessment - Insulin Resistnce; AUC, Are under the curve
12 A reduces gluconeogenesis B 25 2 Gluconeogenesis camp Metformin Compound C CE-TOF & QqQMS:Selected component nlysis
13 reduces gluconeogenesis vi increses plsm diponectin concentrtion & inhiits FOXO nd CREB ctivity A p-ampk AMPK HDAC5 p-crtc2 CRTC2 p-hdac5 HDAC5 β-ctin CRTC2 Fold chnge PEPCK X 1 G6Pse p-ampk/ampk Fold chnge p-crtc2/crtc2 Fold chnge p-hdac5/hdac5 B Luciferse ctivity (%) FOXO ctivity CRE-Luc ctivity mrna expression in liver. A (µm) Foskolin (µm) (µm) reduces 5 PEPCK G6Pse glucose Fold chnge 1..5 c c µg/ml Adiponectin FOXO1, Forkhed ox protein O1; CREB, camp response element-inding protein; HDAC5, Histone decetylse 5; CRTC2, CREB regulted trnscription coctivtor 2; PEPCK, Phosphoenolpyruvte croxykins; G6Pse, Glucose 6-phosphtse C reduces glucose ccumultion vi inhiits heptic gluconeogenesis
14 reduces ody weight, viscerl ft weight & dipocyte size A 5 Body weight B Body weight (g) 4 3 C Adipocyte size (µm 2 ) Weeks Adipocytes Orgn weight of mice Epididyml Ft (g) 2.45 ± ± ±.19 Viscerl Ft (g) 1.67 ± ±.9 c.98 ±.19 c Perirentl Ft (g) 2 ± ±.9 c 1.19 ±.15 c Totl White Adipose Tissue (WAT, g) 5.63 ± ±.42 c 4.58 ±.52 c Brown Adipose Tissue (BAT, g).29 ±.3.22 ±.3.36 ±.4 WAT/BAT 2.81 ± ± ±.87 Skeletl Muscle (g).68 ±.4.55 ±.8.76 ±.6 WAT/Skeletl Muscle 8.43 ± ± ±.8 Liver (g) 9 ± ± ±.17 Liver/Body weight.36 ±.2.4 ±.1.34 ±.3
15 increses energy expenditure vi induces thermogenesis gene expressions in rown dipose tissue (BAT) A VO2 (ml/min/kg) VO2 (ml/min/kg) Totl Light Drk CON CON RQ(Respirtory Quotient) RQ(Respirtory Quotient) CON Totl Light Drk CON Energy Expenditure (kcl/dy/kg) Energy Expenditure (kcl/dy/kg) CON Totl Light Drk CON B 4 mrna expression in BAT 3 2 reduces 1 energy rown PPARα PGC-1α dipose UCP1 Fold chnge reduces ody weight vi increses energy expenditure nd thermogenesis in rown dipose tissue PGC-1α, Peroxisome prolifertor-ctivted receptor gmm coctivtor 1-lph; UCP1, uncoupling protein 1
16 Conclusion Ftty cid oxidtion Ftty cid synthesis Insulin sensitivity Energy expenditure Autophgy Gluconeogenesis Body weight, viscerl ft weight & dipocyte size Lipid ccumultion in liver Glucose & insulin concentrtions in plsm Improves insulin sensitivity Atherosclerosis
17 Acknowledgement Food Biomedicl Science L. Ewh Women s University Supervisor Prof. Sung-Joon Lee FBS l. Memers Ji He Lee Chunyn Wu Boe kim Ji Ah Kim Soyoung Kim Borm Mok Prof. Young-Suk Kim Minyoung So Rurl Development Administrtion of Kore
18 Thnk you for your ttention!
* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationDOI /mnfr
3 Mol. Nutr. Food Res. 15, 59, 3 35 DOI 1.1/mnfr.1399 RESEARCH ARTICLE Ursolic cid improves lipid nd glucose metolism in high-ft-fed C57BL/6J mice y ctivting peroxisome prolifertor-ctivted receptor lph
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationNorthern blot analysis
Northern blot nlysis RNA SCD RNA SCD FAS C c-9 t-1 C c-9 t-1 PRE PI PDMI PRE PI PDMI PRE PDMI PIM An W c-9, t-11 t-1, c-12 C 5 2 4 1 um C 5 2 4 1 um Angus dipocytes expressed SCD higher thn Wgyu dipocyte
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More informationSupplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationCompound K attenuates glucose intolerance and hepatic steatosis through AMPK-dependent pathways in type 2 diabetic OLETF rats
ORIGINAL ARTICLE Koren J Intern Med 218;33:347-355 Compound K ttenutes glucose intolernce nd heptic stetosis through AMPK-dependent pthwys in type 2 dibetic OLETF rts Yoo-Cheol Hwng 1, D-Hee Oh 1, Moon
More informationA. Kinoshita 1, L. Locher 2, R. Tienken 3, U. Meyer 3, S. Dänicke 3, J. Rehage 4, K. Huber 5
Effects of dietry nicin supplementtion on heptic expression of FoxO nd genes involved in glucose production in diry cows during the trnsition period A. Kinoshit, L. Locher, R. Tienken 3, U. Meyer 3, S.
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationCauses and prevention of tamoxifen-induced accumulation. of triacylglycerol in rat liver
1 Cuses nd prevention of tmoxifen-induced ccumultion of tricylglycerol in rt liver Oddrun Anit Gudrndsen 1*, Therese Hlvorsen Rost 1, Rolf Kristin Berge Institute of Medicine, Section of Medicl Biochemistry,
More informationInstitute of Biomedical Research, College of Medical and Dental Sciences, University of Birmingham, Birmingham, UK 4
Antivirl Therpy 2009 14:1089 1100 (doi: 10.3851/IMP1457) Originl rticle Adipocyte differentition, mitochondril gene expression nd ft distriution: differences etween zidovudine nd tenofovir fter 6 months
More informationSynergistic effects of metformin, resveratrol, and hydroxymethylbutyrate on insulin sensitivity
Dietes, Metolic Syndrome nd Oesity: Trgets nd Therpy Open Access Full Text Article open ccess to scientific nd medicl reserch Originl Reserch Synergistic effects of metformin, resvertrol, nd hydroxymethylutyrte
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationBritish Journal of Nutrition
British Journl of Nutrition (2012), 108, 2166 2175 q The Authors 2012 doi:10.1017/s0007114512000347 Differentil effects of low-dose resvertrol on diposity nd heptic stetosis in diet-induced oese mice Su-Jung
More informationAMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis
SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd
More informationHormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.
Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,
More informationSESSIONE I: RELATORI. Ghrelin: from oroxigenic signal to metabolic master regulator?
SESSIONE I: RELATORI Ghrelin: from oroxigenic signl to metbolic mster regultor? Prof. Rocco Brzzoni Professore ssocito di Medicin Intern Università degli Studi di Trieste Ghrelin: d segnle oressizznte
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationR-α-Lipoic acid and acetyl-l-carnitine complementarily promote mitochondrial biogenesis in murine 3T3-L1 adipocytes
Dietologi (28) 51:165 174 DOI 1.17/s125-7-852-4 ARTICLE R-α-Lipoic cid nd cetyl-l-crnitine complementrily promote mitochondril iogenesis in murine 3T3-L1 dipocytes W. Shen & K. Liu & C. Tin & L. Yng &
More informationAlterations in the expression of genes involved in lipid metabolism during bovine oocyte maturation and at the blastocyst stage in vivo vs.
Chpter 5 Altertions in the expression of genes involved in lipid metolism during ovine oocyte mturtion nd t the lstocyst stge in vivo vs. in vitro O.A. Algriny 1, P.L.A.M. Vos 1, M.A. Sirrd 2, S.J. Dielemn
More informationEffects of Rosiglitazone on Inflammation in Otsuka Long-Evans Tokushima Fatty Rats
Originl Article Koren Dibetes J 21;34:191-199 doi: 1.493/kdj.21.34.3.191 pissn 1976-918 eissn 293-265 Effects of Rosiglitzone on Inflmmtion in Otsuk Long-Evns Tokushim Ftty Rts Jin Woo Lee 1, Il Seong
More informationBritish Journal of Nutrition
British Journl of Nutrition (), 6, q The Authors doi:.7/s75 Tretment with oligonol, low-moleculr polyphenol derived from lychee fruit, ttenutes dietes-induced heptic dmge through regultion of oxidtive
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationCurcumin attenuates Nrf2 signaling defect, oxidative stress in muscle and glucose intolerance in high fat diet-fed mice
Online Sumissions: http://www.wjgnet.com/1948-938of fice wjd@wjgnet.com doi:239/wjd.v3.i.94 World J Dietes 212 My 1; 3(): 94-14 ISSN 1948-938 (online) 212 Bishideng. All rights reserved. ORIGINAL ARTICLE
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationResearch Article Carvacrol Protects against Hepatic Steatosis in Mice Fed a High-Fat Diet by Enhancing SIRT1-AMPK Signaling
Hindwi Pulishing Corportion Evidence-Bsed Complementry nd Alterntive Medicine Volume 3, Article ID 9, pges http://dx.doi.org/.55/3/9 Reserch Article Crvcrol Protects ginst Heptic Stetosis in Mice Fed High-Ft
More informationRole of hydroxytyrosol in ameliorating effects of high fat
Role of hydroxytyrosol in meliorting effects of high ft diet on mle rts CNS Hyder A. N. Al-Zmely, Zen Shkir Mhmoud Al -Tmemi Dept. of physiology nd biochemistry, College of veterinry Medicine, AL-Qssim
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationEffect of processing on in vitro bioaccessibility of phenolics, flavonoids and antioxidant activity of vegetables with/without yoghurt
Effect of processing on in vitro ioccessiility of phenolics, flvonoids nd ntioxidnt ctivity of vegetles with/without yoghurt Assoc. Prof. Dr. Esr ÇAPANOĞLU GÜVEN Deprtment of Food Engineering Istnul Technicl
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationBritish Journal of Nutrition
British Journl of Nutrition (215), 113, 1862 1875 q The Authors 215 doi:1.117/s7114515121x Anormlities in myo-inositol metolism ssocited with type 2 dietes in mice fed high-ft diet: enefits of dietry myo-inositol
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationResearch Article Total 4EBP1 Is Elevated in Liver of Rats in Response to Low Sulfur Amino Acid Intake
Journl of Amino Acids Volume 2013, Article ID 864757, 11 pges http://dx.doi.org/10.1155/2013/864757 Reserch Article Totl 4EBP1 Is Elevted in Liver of Rts in Response to Low Sulfur Amino Acid Intke Angelos
More informationPrimers used for real time qpcr
Supplementry Tble 1. Primers used for rel time qpcr Gene Accession number Forwrd/reverse primers Tgfα Tgfβ1 Hgf Cyclin A2 Cyclin B1 Cyclin D1 Cyclin E1 FoxM1 p21 Lrt Cyp26A1 CrbpI Rrβ Bcmo1 Bcmo2 NM_31199
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationMolecular Pharmacology Fast Forward. Published on June 1, 2010 as DOI: /mol
Moleculr Phrmcology Fst Forwrd. Published on June 1, 2010 s DOI: 10.1124/mol.110.065508 Moleculr Phrmcology This rticle hs not Fst been Forwrd. copyedited nd Published formtted. The on finl June version
More informationBritish Journal of Nutrition
(11), 16, 1449 1456 q The Authors 11 doi:1.117/s71145111917 Fish oil comined with SCFA synergisticlly prevent tissue ccumultion of NEFA during weight loss in oese mice Miken H. Pedersen 1,, Lotte Luritzen
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationABSTRACT. Marek s disease virus (MDV) infection causes atherosclerosis, and prior
ABSTRACT Title of Document: Directed By: COMPARATIVE STUDY OF LIPOPROTEIN METABOLISM IN MAREK S DISEASE SUSCEPTIBLE AND RESISTANT LINES Ping Yun, Mster of Science, 2010 Assistnt professor Dr. Jiuzhou Song,
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationResearch Article Antidiabetic Effect of Morindacitrifolia (Noni) Fermented by Cheonggukjang in KK-A y Diabetic Mice
Evidence-Bsed Complementry nd Alterntive Medicine Volume 2012, Article ID 163280, 8 pges doi:10.1155/2012/163280 Reserch Article Antidietic Effect of Morindcitrifoli (Noni) Fermented y Cheonggukjng in
More informationAbstract. Introduction. V.I. Lushchak 1,*, T.V. Bagnyukova 1,*, J.M. Storey 2 and K.B. Storey 2
Brzilin Journl of Medicl nd Biologicl Reserch (2001) 34: 1055-1064 Effect of exercise on glycolytic enzymes in fish tissues ISSN 0100-879X 1055 Influence of exercise on the ctivity nd the distriution etween
More informationSupporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
More informationEffect of Sitagliptin and Glimepiride on Glucose Homeostasis and camp Levels in Peripheral Tissues of HFD/STZ Diabetic Rats
Americn Journl of Biomedicl Reserch, 2014, Vol. 2, No. 3, 52-60 Avilble online t http://pubs.sciepub.com/jbr/2/3/3 Science nd Eduction Publishing DOI:10.12691/jbr-2-3-3 Effect of Sitgliptin nd Glimepiride
More informationSUPPLEMENTARY INFORMATION. Cytochrome P450-2E1 promotes fast food-mediated hepatic fibrosis
SUPPLEMENTARY INRMATION Cytochrome P-E1 promotes fst food-medited heptic fibrosis Mohmed A. Abdelmegeed, Youngshim Choi, Grzegorz Godlewski b, Seung-Kwon H, Atryee Bnerjee, Sehwn Jng, nd Byoung-Joon Song
More informationOver-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
More informationInterleukin-4 Restores Insulin Sensitivity in Lipid-Induced Insulin-Resistant Adipocytes
ISSN 6-2979, Biochemistry (Moscow), 21, Vol. 3, No. 5, pp. 49-56. Pleides Pulishing, Ltd., 21. Originl Russin Text I. S. Stfeev, S. S. Michurin,3, N. V. Podkuychenko, A. V. Vorotnikov, M. Yu. Menshikov,
More informationInhibition of Serotonin Synthesis Induces Negative Hepatic Lipid Balance
Originl Article Obesity nd Metbolic Syndrome Dibetes Metb J Published online Apr 5, 8 https://doi.org/.9/dmj.7.8 pissn -679 eissn -687 DIABETES & METABOLISM JOURNAL Inhibition of Serotonin Synthesis Induces
More informationGlucagon-Like Peptide-1 Increases Mitochondrial Biogenesis and Function in INS-1 Rat Insulinoma Cells
Brief Report Endocrinol Met 215;3:216-22 http://dx.doi.org/1.383/enm.215.3.2.216 pissn 293-596X eissn 293-5978 Glucgon-Like Peptide-1 Increses Mitochondril Biogenesis nd Function in INS-1 Rt Insulinom
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationAMPK. Tomáš Kučera.
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol
More informationInduction of peroxisomal lipid metabolism in mice fed a high-fat diet
MOLECULAR MEDICINE REPORTS 4: 1157-1162, 2011 Induction of peroxisoml lipid metbolism in mice fed high-ft diet SACHI KOZAWA 1,4, AYAKO HONDA 1, NAOMI KAJIWARA 1, YASUHIKO TAKEMOTO 1, TOMOKO NAGASE 1, HIDEKI
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationFlaxseed Lignan Increased Glucose Uptake by Human Red Blood Cells
The Open Nutrceuticls Journl, 29, 2, 81-85 81 Open Access Flxseed Lignn Incresed Glucose Uptke y Humn Red Blood Cells Yeong Rhee * nd Ardith Brunt 351 EML, NDSU Dept. # 262, PO Box 65, North Dkot Stte
More informationBruna Paola Murino Rafacho 1,2, Camilla Peach Stice 1, Chun Liu 1, Andrew S. Greenberg 3, Lynne M. Ausman 1,4, Xiang-Dong Wang 1,4.
Originl Article Inhiition of diethylnitrosmine-initited lcohol-promoted heptic inflmmtion nd precncerous lesions y flvonoid luteolin is ssocited with incresed sirtuin ctivity in mice Brun Pol Murino Rfcho,2,
More informationMiglitol increases energy expenditure by upregulating uncoupling protein 1 of brown adipose tissue and reduces obesity in dietary-induced obese mice
Sugimoto et l. Nutrition & Metbolism 4, :4 RESERCH Open ccess Miglitol increses energy expenditure by upregulting uncoupling protein of brown dipose tissue nd reduces obesity in dietry-induced obese mice
More informationAMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kuc era Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze 2013 AMPK AMP-ACTIVATED PROTEIN KINASE present in all eukaryotic
More informationSignaling by IL-6 promotes alternative activation of macrophages to limit endotoxemia and obesity-associated resistance to insulin
Signling y promotes lterntive ctivtion of mcrophges to limit endotoxemi nd oesity-ssocited resistnce to insulin Nture Americ, Inc. All rights reserved. Jn Muer,9, Bhgirth Chursi,9, Juli Goldu, Merly C
More informationHIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
More informationAccepted 10 January 2006
The Journl of Experimentl Biology 9, - Pulished y The Compny of Biologists doi:./je. Glycerol production in rinow smelt (Osmerus mordx) my e triggered y low temperture lone nd is ssocited with the ctivtion
More informationOverview: The Cellular Internet. General Biology. 7. Cell Communication & Signalling
Course o: BG00 Credits:.00 Generl Biology Overview: The Cellulr Internet Cell-to-cell communiction is bsolutely essentil for multicellulr orgnisms Biologists hve discovered some universl mechnisms of cellulr
More informationResponses of skeletal muscle lipid metabolism in rat gastrocnemius to hypothyroidism and iodothyronine administration: a putative role for FAT/CD36
Am J Physiol Endocrinol Met 33: E1222 E1233, 212. First pulished Septemer 11, 212; doi:1.1152/jpendo.37.212. Responses of skeletl muscle lipid metolism in rt gstrocnemius to hypothyroidism nd iodothyronine
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationDe novo lipogenesis in human fat and liver is linked to ChREBP-b and metabolic health
Received 2 Aug 2 Accepted 23 Jn 213 Pulished 26 Fe 213 DOI: 1.13/ncomms253 De novo lipogenesis in humn ft nd liver is linked to ChREBP- nd metolic helth Leh Eissing 1, *, Thoms Scherer 2, *,w, Klus Tödter
More information1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
More informationCHAPTER- 3 ANALYSIS OF PATHOPHYSIOLOGICAL MARKER ENZYMES, LIPID AND PROTEIN PROFILES IN CONTROL AND EXPERIMENTAL ANIMALS
CHAPTER- 3 CHAPTER- 3 ANALYSIS OF PATHOPHYSIOLOGICAL MARKER ENZYMES, LIPID AND PROTEIN PROFILES IN CONTROL AND EXPERIMENTAL ANIMALS 3.1. INTRODUCTION The liver, hs vriety of trnsminse to synthesize nd
More informationBackground Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield.
Nnjing Agriculturl University Potssium enhnces the sugr ssimiltion in leves nd fruit y regulting the expression of key genes involved in sugr metolism of Asin pers Cixi Dong, Chngwei Shen, Yngchun Xu College
More informationRunning footline: PPARδ activation attenuates hepatic steatosis and inflammation
PPARδ ctivtion ttenutes heptic stetosis in Ldlr / mice y enhnced ft oxidtion, reduced lipogenesis nd improved insulin sensitivity Authors: Lzr A. Bojic, 1,2 Dwn E. Telford, 1,4 Morgn D. Fullerton, 5 Reecc
More informationIGF-1 vs insulin: Respective roles in modulating sodium transport via the PI-3 kinase/sgk1 pathway in a cortical collecting duct cell line
originl rticle http://www.kidney-interntionl.org & 27 Interntionl Society of Nephrology IGF-1 vs insulin: Respective roles in modulting sodium trnsport vi the PI-3 kinse/sgk1 pthwy in corticl collecting
More informationFig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
More informationThe Journal of Physiology
J Physiol 595.13 (2017) pp 4189 4206 4189 mtor folte sensing links folte vilility to tropholst cell function Fredrick J. Rosrio 1,TheresL.Powell 1,2 nd Thoms Jnsson 1 1 Division of Reproductive Sciences,
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationResearch Article Protective Effect of Short-Term Genistein Supplementation on the Early Stage in Diabetes-Induced Renal Damage
Meditors of Inflmmtion Volume 2013, rticle ID 510212, 14 pges http://dx.doi.org/10.1155/2013/510212 Reserch rticle Protective Effect of Short-Term Genistein Supplementtion on the Erly Stge in Dibetes-Induced
More informationSupplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
More informationMetformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state
Related Commentary, page 2267 Research article Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state Marc Foretz, 1,2 Sophie Hébrard,
More informationInflammatory responses in primary muscle cell cultures in Atlantic salmon (Salmo salar)
Pooley et l. BMC Genomics 213, 14:747 http://www.iomedcentrl.com/1471-2164/14/747 ESEACH ATICLE Open Access Inflmmtory responses in primry muscle cell cultures in Atlntic slmon (Slmo slr) Nichols J Pooley
More informationDietary fat source alters hepatic gene expression profile and determines the type of liver pathology in rats overfed via total enteral nutrition
Physiol Genomics 44: 173 189, 212. First published September 18, 212; doi:1.1152/physiolgenomics.69.212. Dietry ft source lters heptic gene expression profile nd determines the type of liver pthology in
More informationobesità nel bambino: epidemiologia e prevenzione
Obesità, Nutrizione e Stili di vit. Trento 31 Mrzo 27 obesità nel bmbino: epidemiologi e prevenzione Cludio Mffeis Diprtimento Mterno Infntile e Biologi-Genetic Sezione di Peditri - Università di Veron
More informationTargeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity
Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold
More informationPPARγ contributes to PKM2 and HK2 expression in fatty liver
Received Nov Accepted 9 Jn Published Feb DOI:.8/ncomms667 contributes to nd expression in ftty liver Gnn Pnsyuk,, Ctherine Espeillc,, Céline Chuvin,, Ludivine A. Prdelli,, Ysuo Horie, Akir Suzuki 6,7,
More informationControl 7 d cold 7 d CL
Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with
More informationTLR7 induces anergy in human CD4 + T cells
TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is
More informationMyricetin Ameliorates Defective Post-Receptor Insulin Signaling via
Evidence-Bsed Complementry nd Alterntive Medicine Volume 211, Article ID 15752, 9 pges doi:1.193/ecm/neq17 Originl Article Ameliortes Defective Post-Receptor Insulin Signling vi β-endorphin Signling in
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More informationThe different mechanisms of insulin sensitizers to prevent type 2 diabetes in OLETF rats
RESEARCH ARTICLE DIABETES/METABOLISM RESEARCH AND REVIEWS Dietes Met Res Rev 2007; 23: 411 418. Pulished online 30 My 2007 in Wiley InterScience (www.interscience.wiley.com).756 The different mechnisms
More informationFood & Function Accepted Manuscript
Food & Function Accepted Mnuscript This is n Accepted Mnuscript, which hs een through the Royl Society of Chemistry peer review process nd hs een ccepted for puliction. Accepted Mnuscripts re pulished
More informationThe role of insulin and glucose in goose primary hepatocyte triglyceride accumulation
1553 The Journl of Experimentl Biology 212, 1553-1558 Pulished y The Compny of Biologists 2009 doi:10.1242/je.022210 The role of insulin nd glucose in goose primry heptocyte triglyceride ccumultion Chunchun
More informationIn The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationInhibition of adipocyte differentiation in 3T3-L1 cell line by quercetin or isorhamnetin
Louisin Stte University LSU Digitl Commons LSU Mster's Theses Grdute School 2012 Inhibition of dipocyte differentition in 3T3-L1 cell line by quercetin or isorhmnetin Din Gbriel Crvjl-Aldz Louisin Stte
More informationResearch Article Experimental Hyperthyroidism Decreases Gene Expression and Serum Levels of Adipokines in Obesity
The Scientific World Journl Volume 22, Article ID 7889, 7 pges doi:./22/7889 The cientificworldjournal Reserch Article Experimentl Hyperthyroidism Decreses Gene Expression nd Serum Levels of Adipokines
More informationChromium Alleviates Glucose Intolerance, Insulin Resistance, and Hepatic ER Stress in Obese Mice
nture pulishing group rticles intervention AND prevention Chromium Allevites Glucose Intolernce, Insulin Resistnce, nd Heptic ER Stress in Oese Mice Nir Sreejyn, Feng Dong, Mchender R. Knddi,2, Xioping
More information