Institut des Maladies Métaboliques et Cardiovasculaires de Rangueil, Rangueil Hospital, Toulouse, France;

Size: px
Start display at page:

Download "Institut des Maladies Métaboliques et Cardiovasculaires de Rangueil, Rangueil Hospital, Toulouse, France;"

Transcription

1 Beneficil Microes, 2014; 5(4): Wgeningen Acdemic P u l i s h e r s Potentil proiotic Bifidocterium nimlis ssp. lctis 420 prevents weight gin nd glucose intolernce in diet-induced oese mice L.K. Stenmn 1*, A. Wget 2, C. Grret 2, P. Klopp 2, R. Burcelin 2 nd S. Lhtinen 1 1 DuPont Nutrition nd Helth, Active Nutrition, Sokeritehtntie 20, Kntvik, Finlnd; 2 INSERM1048, Institut des Mldies Métoliques et Crdiovsculires de Rngueil, Rngueil Hospitl, Toulouse, Frnce; lott.stenmn@dupont.com Astrct Received: 3 Ferury 2014 / Accepted: 19 June Wgeningen Acdemic Pulishers RESEARCH ARTICLE Altertions of the gut microiot nd mucosl rrier re linked with metolic diseses. Our im ws to investigte the potentil enefit of the potentil proiotic Bifidocterium nimlis ssp. lctis 420 in reducing high-ft dietinduced ody weight gin nd dietes in mice. In the oesity model, C57Bl/6J mice were fed high-ft diet (60 energy %) for 12 weeks, nd gvged dily with B. lctis 420 (10 9 cfu) or vehicle. In the dietes model, mice were fed high-ft, ketogenic diet (72 energy % ft) for 4 weeks, with 6-week susequent tretment with B. lctis 420 ( cfu/dy) or vehicle, fter which they were nlysed for ody composition. We lso nlysed glucose tolernce, plsm lipopolyscchride nd trget tissue inflmmtion using only one of the B. lctis 420 groups (10 9 cfu/dy). Intestinl cteril trnsloction nd dhesion were nlysed in seprte experiment using n Escherichi coli gvge. Body ft mss ws incresed in oth oese (10.7±0.8 g (men ± stndrd error of men) vs. 1.86±0.21 g, P<0.001) nd dietic mice (3.01±0.4 g vs. 1.14±0.15 g, P<0.001) compred to helthy controls. Tretment with B. lctis 420 significntly decresed ft mss in oese (7.83 ± 0.67 g, P=0.007 compred to oese with vehicle) nd dietic mice (1.89 ± 0.16 g, P=0.02 for highest dose). This ws reflected s reduced weight gin nd improved glucose tolernce. Furthermore, B. lctis 420 decresed plsm lipopolyscchride levels (P<0.001), liver inflmmtion (P=0.04), nd E. coli dhesion in the distl gut (P<0.05). In conclusion, B. lctis 420 reduces ft mss nd glucose intolernce in oth oese nd dietic mice. Reduced intestinl mucosl dherence nd plsm lipopolyscchride suggest mechnism relted to reduced trnsloction of gut microes. Keywords: dietes, oesity, intestinl permeility, mice, proiotics 1. Introduction A drmtic rise in the incidence of oesity over the lst decdes hs given rise to n rry of oesity-ssocited metolic disturnces. Mny of these re suspected to stem from chronic low-grde inflmmtion, which hs ecome well-recognised risk fctor for metolic disese (Hotmisligil, 2006). The cuses of low-grde inflmmtion hve long een unknown, ut recent dvnces hve reveled mechnism relted to the lekge of inflmmtory molecules from cteril origin, such s lipopolyscchrides (LPS) (Cni et l., 2007) or peptidoglycn (Amr et l., 2011; Schertzer et l., 2011) from the gut. The rise in the sl concentrtion of lood LPS is known s metolic endotoxemi. However, constnt mildly elevted plsm concentrtion of LPS is proposed to cuse lowgrde inflmmtion nd predispose to metolic disese s cuslly demonstrted in the triggering of metolic inflmmtion in mice (Cni et l., 2007) nd ssocited to the disese in humn (Pussinen et l., 2011). Metolic endotoxemi cn e induced in mice using high-ft diet (HFD) (Cni et l., 2007, 2008; Crvlho et l., 2012; De l Serre et l., 2010; Everrd et l., 2012; Kim et l., 2012; Serino et l., 2012), ut the mechnisms for incresed LPS sorption nd trnsloction towrds tissues ssocited with HFD re unknown. Proposed hypotheses include chylomicron-fcilitted LPS-trnsport ISSN print, ISSN online, DOI /BM

2 L.K. Stenmn et l. (Ghoshl et l., 2009), decresed mucosl clernce of LPS y lkline phosphtse (De l Serre et l., 2010), nd gut rrier disruption y vrious mechnisms relted to the gut microiot, such s n overly ctive gut endocnninoid system (Muccioli et l., 2010), or ltered luminl ile cid profile (Stenmn et l., 2012, 2013). Recent findings from our lortory demonstrted the key role of metolic endotoxemi in incresing predipocyte nd mcrophge prolifertion in dipose tissue (Luche et l., 2013). Circulting LPS hs een cuslly linked to the development of mouse oesity (Cni et l., 2007). As germ-free mice re resistnt to oesity cused y HFD (Bckhed et l., 2007; Rot et l., 2010), the gut microiot nd gutderived endotoxins hve een proposed to prticipte in the development of diet-induced oesity in mice. The mouse knock-out for CD14, which is required for the recognition of LPS y toll-like receptor 4, is resistnt to oesity cused y sucutneously dministered LPS (Cni et l., 2007). The LPS-TLR4 pthwy my thus ply role in the development of oesity in HFD-fed mice. Hence, we recently proposed tht the trnsloction of cteri from the intestinl mucos towrds tissues such s the dipose depot ws responsile for the triggering of metolic inflmmtion (Amr et l., 2011). The trnslocted cteri nd cteril frgments stimulted the prolifertion of dipose tissue precursors nd fvoured ody weight gin through process ssocited with LPS-induced inflmmtion of dipose tissue mcrophges (Luche et l., 2013). Hence, the former nd ltter rguments strongly suggest tht treting mucosl microil ecology would meliorte energy metolism nd ody weight mngement. It is n on-going struggle to find effective tretment strtegies for oesity nd metolic syndrome. Among newly emerging pproches, proiotics hve shown potentil efficcy in improving glucose tolernce (Andresen et l., 2010; Asemi et l., 2013) nd weight gin (Kdook et l., 2010, 2013) in humns. As we hve shown in mouse model of HFDinduced dietes, Bifidocterium lctis 420 (B420) my improve glucose tolernce nd reduce tissue inflmmtory sttus (Amr et l., 2011), suggesting enefit in metolic disese. Our im ws to study whether B420 my tret or prevent diposity y reducing metolic endotoxemi nd gut cteril trnsloction in mice. These were investigted in diet-induced oese nd dietic niml models. 2. Mterils nd methods Animls Mle C57Bl/6J mice were purchsed from Chrles River (Sulzfeld, Germny), nd housed in stndrd niml fcility with food nd wter d liitum. At eight weeks of ge, mice were llocted to one of the two experimentl designs. Oesity nd weight-relted outcomes were studied in oth models, while mechnisms were explored in the dietic model only. The experimentl procedures were pproved y the locl ethics committee of the Rngueil Hospitl. Oesity model Mice were fed HFD contining 60 energy % ft or lowft diet with 12 energy % ft for 12 weeks (Reserch Diets, New Brunswick, NJ, USA). For the entire durtion of the experiment, mice were gvged dily with the proiotic B420 (ATCC: SD6685) (10 9 cfu/dy) or wter (controls). Dietes model Dietes ws induced with ketogenic diet (KD) contining 72 energy % ft (mize oil nd lrd), 28 energy % protein nd <1 energy % crohydrte (Sfe, Augy, Frnce), which ws given for four weeks. This diet hs een previously shown to cuse fsting hyperglycemi, glucose intolernce nd insulin resistnce fter one month of feeding (Burcelin et l., 2002). This diet impirs glucose induced insulin secretion. The mice re considered hypoinsulinemic, which strongly reduces HFD-induced oesity. The nimls of this model cn e considered to hve len dietes. They cn thus e compred with the oesity model to study the effects of proiotic tretment on glucose metolism without the impct of ody weight gin. Control mice were fed stndrd chow. After the four-week consumption of the experimentl diets, mice were gvged with either B420 (10 8, 10 9 or cfu/dy) or wter (control), for six more weeks. Only ody composition nlyses were mde for ll doses. Only the dose 10 9 cfu/dy ws used for further experimenttion. Body composition mesurements y EchoMRI The ody composition of the mice, including the ft nd len msses, ws nlysed y NMR using EchoMRI-100TM equipment (Echo Medicl Systems, Houston, TX, USA) fter six weeks (Oesity model) or four weeks (Dietes model) of tretment with or without proiotics. Intrperitonel glucose tolernce tests An intrperitonel glucose-tolernce test ws performed fter six (Oesity model) or four (Dietes model) weeks of tretment with B420 to otin n index of glucose mngement in mice. Briefly, 6-h fsted mice were injected with glucose (1 g/kg) into the peritonel cvity. The glycemi ws followed 30 min efore the glucose chllenge nd then every 30 min using glucose meter (Roche Dignostics, Bsel, Switzerlnd). An index for glucose-induced glycemi ws clculted s µm/min y dividing the men lood glucose t y 60 min. 438 Beneficil Microes 5(4)

3 B420, ft mss nd glucose intolernce in oese mice Anlysis of metolic endotoxemi Plsm LPS levels were mesured with kit sed on Limulus meocyte extrct (LAL kit; Cmrex BioScience, Wlkersville, MD, USA); smples were diluted 1:50 nd heted for 10 min t 70 C. Quntifiction of tissue inflmmtion mrkers RNA ws extrcted from sucutneous dipose tissue, liver nd skeletl muscle (vstus lterlis), reverse trnscried, nd nlysed with qpcr trgeting tumour necrosis fctor lph (TNF-α), interleukin (IL)-1β, IL-6 nd plsminogen ctivtor inhiitor-1 (PAI-1), with riosoml protein PL19 (RPL19) s endogenous control for reltive quntifiction. The primers used were: TNF-α forwrd CATCTTCTCAAAATTCGAGTGACAA, reverse TGGGAGTAGACAAGGTACAACCC; IL-1β forwrd TCGCTCAGGGTCACAAGAAA, reverse CATCAGAGGCAAGGAGGAAAAC; PAI-1 forwrd ACAGCCTTTGTCATCTCAGCC, reverse CCGAACCACAAAGAGAAAGGA; IL-6 forwrd TAGTCCTTCCTACCCCAATTTCC, reverse TTGGTCCTTAGCCACTCCTTC; RPL19 forwrd GAAGGTCAAAGGGAATGTGTTCA, reverse CCTTGTCTGCCTTCAGCTTGT. An index ws clculted s the men expression of ll inflmmtion mrkers for ech tissue seprtely. Quntifiction of the trnsloction nd mucosl dherence of Escherichi coli A seprte experiment with four mice per group ws performed for trnsloction nd dherence experiments. Mice were fed with KD nd gvged with B420 (10 9 cfu/dy) or vehicle. After five weeks of tretment, mice were gvged with 10 9 cfu Escherichi coli (isolted from mouse colon), nd scrificed 2 h lter. Liver, spleen, sucutneous nd mesenteric dipose tissue, nd the corresponding gnglions were hrvested, nd luminl nd mucosl contents of ech intestinl segment were seprted. Tissues were homogenised in Luri Broth (Gico; Life Technologies, Drmstdt, Germny), plted onto mpicillin-supplemented (100 µg/ml) Luri Broth gr, nd yellow colonies were enumerted fter overnight incution t 37 C. Sttisticl nlysis Dt were nlysed using GrphPd Prism 6 (GrphPd Softwre Inc., Sn Diego, CA, USA) nd SPSS Sttistics 21 (IBM, Armonk, NY, USA). All dt were nlysed with ANOVA. If the glol P ws significnt, Bonferroni s multiple comprisons test ws used to ssess differences etween groups. For dherence nd trnsloction, zero vlues were replced with hlf of the smllest possile vlue, nd logrithm trnsformtion ws run to otin Norml distriution efore sttisticl testing. All dt re expressed s men ± stndrd error of men, nd significnces re two-sided. Differences were considered sttisticlly significnt when P< Results Influence of Bifidocterium lctis 420 on weight nd ody ft mss The effect of B420 on diposity ws studied in two mouse models. In the oese prevention model, tretment with the potentil proiotic is initited together with the HFD (60 energy % ft). In this model, B420 significntly reduced weight gin compred to the high-ft control (Figure 1A). An nlysis of ody composition y EchoMRI reveled tht the increse in ody ft mss in diet-induced oese mice ws mrkedly prevented y B420 during six weeks of feeding (P=0.007), wheres there ws no effect on len mss (P=1.00) (Figure 1B). At seline, there hd een no differences in ody ft mss (Control 1.11±0.05 g, HFD 1.23±0.14 g, HFD+B ±0.19 g) or len mss (Control 19.09±0.34 g, HFD 20.44±0.24 g, HFD+B ±0.28 g). In the dietic tretment-model, mice ecome dietic following four-week induction phse eting KD (72 energy % ft). In this model, the KD group hd significntly more ft mss (P<0.001) (Supplementl Figure S1B), despite the lck of ody weight chnge (Supplementl Figure S1A). Ft mss expnsion ws meliorted y tretment with B420 t cfu/dy (P=0.020), nd there ws mrked trend of ft mss reduction y 10 9 cfu/dy (P=0.066). Len mss ws significntly reduced in ll mice on KD (P<0.01 for ll vs. control), nd ws not ffected y B420. Glucose tolernce in Bifidocterium lctis 420-treted mice We performed intrperitonel glucose tolernce tests to HFD mice fter six weeks of ftty diet with or without B420, nd to KD mice fter four weeks of tretment. In dietinduced oese mice, the B420-treted group demonstrted significntly lower glycemi compred to ft-fed mice (Figure 2A). Respectively, glucose-stimulted glycemi ws reduced y B420 tretment (Figure 2B). Interestingly, lso the fsting lood glucose in B420-treted mice (6.9±0.4 mm) ws significntly lower compred to HFD mice (8.2±0.4 mm, P<0.05), nd comprle to tht of control mice (6.7±0.3 mm). In the dietic model with KD, the glucose-stimulted glycemi in B420-treted mice ws similr to tht of control mice (P=1.00), lthough it did not significntly differ from tht of KD mice without B420 (P=0.16) (Figure 2C-D). Beneficil Microes 5(4) 439

4 L.K. Stenmn et l. A Delt ody weight (%) Control HFD HFD + B Weeks of tretment c Tissue weight (g) Control HFD HFD + B Ft mss Len mss Figure 1. (A) Body weight chnge nd (B) ody composition during Bifidocterium nimlis ssp. lctis 420 (B420) tretment in diet-induced oese mice. Oese mice were fed high-ft diet (HFD) with 60 energy % ft. Body composition ws mesured with EchoMRI. Vlues re men ± stndrd error of the men from 10 mice per group. Groups without common letter differ significntly from ech other (ANOVA nd Bonferroni s multiple comprisons). B c A Blood glucose (mm) Control HFD HFD + B c B Glycemic index min (µm/min) c C Blood glucose (mm), Minutes 25 Control KD 20 KD + B D Glycemic index min (µm/min) Control HFD HFD B , Minutes 440 Beneficil Microes 5(4) 0 Control KD HFD B Figure 2. Glucose tolernce of diet-induced oese mice fter six weeks of tretment with Bifidocterium nimlis ssp. lctis 420 (B420) (A-B) nd of diet-induced dietic mice fter four weeks of tretment (C-D) in n intrperitonel glucose tolernce test. Oese mice were fed high-ft 60 energy % ft diet (HFD), wheres dietic mice were fed ketogenic 72 energy % ft diet (KD). Dietes ws induced with KD for four weeks efore proiotic tretment. An index of glucose-induced glycemi ws clculted s men lood glucose per minutes during min fter glucose injection. Vlues re men ± stndrd error of the men from 10 mice per group (A-B) or 5-10 mice per group (C-D). Groups without common letter differ significntly from ech other (ANOVA nd Bonferroni s multiple comprisons).

5 B420, ft mss nd glucose intolernce in oese mice Mechnism of ction: intestinl cteril dherence nd trnsloction To investigte the possile role of metolic endotoxemi in the reduction of diposity y B420, we mesured plsm LPS levels, s well s mucosl dherence nd trnsloction of gvged E. coli in the dietic mouse model with KD. Plsm LPS levels were douled in the KD group (P<0.001) compred to control, ut restored to norml levels y B420 (P<0.001 compred to KD) (Figure 3A). Adherence ws clculted s the rtio of mucosl to luminl E. coli fter gvge. B420 sustntilly decresed mucosl dherence of gvged cteri in ileum nd cecum (P=0.034 nd P=0.021, respectively), ut not in duodenum nd jejunum (Figure 3B). There were no significnt differences in trnsloction of gvged E. coli, lthough ll tissues from B420-treted mice tended to give lower cfu counts compred to vehicle-treted mice (Figure 3C). Influence of Bifidocterium lctis 420 on heptic inflmmtion The KD incresed the expression of inflmmtory mrkers in liver (index +68% KD vs. Control, P=0.001) nd skeletl muscle (+64%, P=0.036), with tendency seen lso in sucutneous dipose tissue (+95%, glol P=0.099) (Tle 1). In B420-treted mice, ll men inflmmtory indices were lower thn in vehicle-treted KD mice (sucutneous ft -41%, liver -27%, skeletl muscle -8.3%), ut the difference ws significnt only in liver (P=0.041). A B Plsm LPS (EU/ml) E. coli dherence to mucos NS NS, Control KD KD + B , 0 Control KD KD + B Duodenum Jejunum Ileum Cecum C 1,000,000 NS E. coli cfu/g of tissues 100,000 10, Liver Spleen Sucut. dipose tissue Mesent. dipose tissue Sucut. gnglion Mesent. gnglion Figure 3. Gut rrier function in dietic mice fed with ketogenic diet (KD) nd treted with the potentil proiotic Bifidocterium nimlis ssp. lctis 420 (B420). (A) Plsm lipopolyscchride (LPS) levels were determined t week 6 of B420 tretment (n=9-10 per group). For (B) dhesion nd (C) cteril trnsloction, set of four mice per group were fed KD with concomitnt gvge of proiotic for five weeks, fter which they were gvged with Escherichi coli. Adherence ws clculted s mucosl/ luminl counts of E. coli. Trnsloction ws determined s cfu of E. coli in trget tissues. Groups without common letter differ significntly from ech other (ANOVA nd Bonferroni s multiple comprisons). Beneficil Microes 5(4) 441

6 L.K. Stenmn et l. Tle 1. Tissue inflmmtory mrkers in the diet-induced dietes mouse model. 1 Control KD KD + B ANOVA Sucutneous ft TNF-α 1.57± ± ± IL-1β 1.37± ± ± PAI ± ± ± IL ± ± ± Index ± ± ± Liver TNF-α 1.32± ± ±0.18, IL-1β 1.15± ± ±0.16, PAI ± ± ± IL ± ± ± Index 1.21± ± ± Skeletl muscle TNF-α 0.94± ± ± IL-1β 1.00± ± ±0.21, PAI ± ± ± IL ± ± ± Index 0.95± ± ±0.23, n=6-10 per group. KD = ketogenic diet; B420 = Bifidocterium nimlis ssp. lctis Men ± stndrd error of the men; groups without common letter differ significntly from ech other (Bonferroni s multiple comprisons). 3 Index ws clculted s men of the reltive expression of the four individul cytokines. 4. Discussion We hve shown for the first time tht chronic tretment with B420 reduces ody weight gin nd ft mss ccumultion, nd improves glucose tolernce in HFDfed mice. Furthermore, B420 reduced cteril dherence to the intestinl mucos, plsm LPS levels nd heptic inflmmtion, which together point to mechnism relted to decresed cteril trnsloction y the tretment with B420. To identify the metolic effect of B420 tretment on metolic diseses we compred two different niml models. In the first model, diet-induced oesity ws induced y high-ft (60 energy %) diet, nd B420 ws gvged dily during the entire experiment to prevent oesity nd dietes. In the second model, the impct of B420 ws tested in n niml model of dietes which does not feture mjor ody weight gin: the mice were fed high-ft, KD for four weeks to induce dietes, s previously descried (Burcelin et l., 2002). The dt of the present study demonstrte tht B420 oth prevented nd treted ft mss ccumultion in two different models. Our previous work hs demonstrted B420 to lso improve glucose tolernce in the dietic model (Amr et l., 2011), lthough we could not confirm it here, which could e due to difference in the impct of the diet on this group of nimls. Nevertheless, the present work shows effectiveness in mouse model of oesity. Hence, the metolic effects of B420 were not linked to specific pthogenesis. Assuming similr effect in clinicl setting, such feture would e eneficil in treting metolic disese, since it enles effective use of the tretment in roder popultion with rnge of different pthogeneses. The present study reinforces the concept tht certin proiotics my e used in the prevention nd/or tretment of oesity nd diposity. While some previous reports hve shown vrious lctocilli (Kim et l., 2013; Prk et l., 2013; Sto et l., 2008), ifidocteri (Cno et l., 2013; Chen et l., 2011; Kondo et l., 2010) nd their comintion (Ydv et l., 2013) to reduce ody weight or ft mss in rodents nd humns, the present study is the first to show n effect for B. lctis strin nd to present new potentil mechnism for ft mss reduction. Weight reduction is stte of negtive energy lnce, which cn e conferred y three mechnisms: (1) reducing energy intke; (2) stimulting energy expenditure; or (3) inhiiting energy hrvesting or sorption y modulting gut microiot or other luminl components. We previously demonstrted tht the B420 strin reduced the impct of ft-enriched diet on insulin resistnce (Amr et l., 2011). No chnges in food intke were oserved during the tretment (dt not shown), however, the impct on glycemi suggested tht glucose ws used s n energy source, which could, in cse of oxidtion, e dissipted nd 442 Beneficil Microes 5(4)

7 B420, ft mss nd glucose intolernce in oese mice no longer stored. This hypothesis could contriute to the prevention of ody weight gin. In other instnces, recent report demonstrted tht proiotic product, VSL#3 comintion of four different lctocilli; three non-lctis strins of ifidocteri nd one strin of Streptococcus thermophilus reduced ody weight gin in mice y decresing feed intke (Ydv et l., 2013). However, in this study energy expenditure ws not ssessed. We do elieve tht comintion of severl mechnisms such s reduced food intke, incresed energy expenditure nd reduction of chronic inflmmtion could e responsile for the potentil eneficil effect of proiotics on ody weight gin. In the present study, we show new evidence suggesting tht the effect of B420 on diposity is relted to n improvement of intestinl rrier function. According to previous study, circulting endotoxins my induce weight-gin (Cni et l., 2007). Further, we hve recently shown tht cteril frgments, such s LPS, cn directly trigger dipose tissue precursor prolifertion to increse the numer of predipocytes (Luche et l., 2013). The ltter will then differentite into dipocytes in the presence of lrge mount of energy ville (Luche et l., 2013). Here we show tht B420 remrkly reduced metolic endotoxemi, which my hve contriuted to the ccompnying ft mss reduction nd meliortion of weight gin. In previous studies, B420 prevented mucosl pthogen dhesion nd improved tight-junction integrity in vitro (Colldo et l., 2007; Putl et l., 2008). To test our hypothesis in vivo, we used commensl E. coli isolted from mouse intestinl microiot. Two hours fter gvge, B420 hd significntly reduced mucosl dherence of the E. coli in the distl intestine, which points to the improvement of the mucosl rrier in proiotic-treted mice. Luminl LPS my trnslocte through the gut epithelium vi t lest two different routes: the prcellulr route through the tight-junctions, or trnscellulrly through enterocytes nd engged with chylomicron synthesis (Ghoshl et l., 2009). Generlly, molecules s lrge s LPS re elieved to trnslocte only trnscellulrly. Indeed, in helthy ptients LPS trnsloctes only trnscellulrly, wheres in ilel Crohn s disese ptients LPS is lso found in the prcellulr spce (Keit et l., 2008). This would point towrds n opening of the prcellulr pthwy in pthologicl stte. It hs not een definitively shown which pthwy, or oth, re ctivted in diet-induced oesity. However, previous report shows tht reduced expression of intestinl tight-junction proteins correltes with elevted intestinl permeility when mesured with fluorescent proe in the dietic mouse model (Cni et l., 2008). We hve lso studied the effect of B420 on intestinl permeility in cell culture using trnsepithelil electricl resistnce s n indictor of the intestinl rrier (Putl et l., 2008). A cell-free superntnt of B420 incresed resistnce y 240%, indicting tht B420 produces compound tht enhnces the epithelil rrier. This compound, however, ws not ny short-chin ftty cid, since the short-chin ftty cid concentrtion of the superntnt did not differ from those in the superntnts of less effective strins. Puttive mechnisms y which proiotic strins my decrese intestinl permeility include upregultion of tight-junction protein expression, ntipoptotic ctivity, promotion of mucous secretion, induction of defensin relese, nd modultion of the sumucosl immune system (Bermudez-Brito et l., 2012). All these effects re communicted vi solule peptides or surfce lignds produced y the cterium. Such mechnisms for B420 re still uncovered. In ddition to improving gut rrier function, it is likely tht there re severl complicted mechnisms ehind the effect of B420 on diposity nd glucose tolernce. Improved glucose tolernce nd slightly reduced weight gin ws recently reported for Lctocillus rhmnosus GG in mice fed with 60 energy % HFD (Kim et l., 2013). The effect ws explined with incresed levels of diponectin nd consequent phosphoryltion of AMP-ctivted protein kinse (AMPK) in skeletl muscle. AMPK ctivtion induces ftty cid oxidtion, which could hve led to incresed energy expenditure contriuting to weight loss. Interestingly, it ws shown tht the conventionlistion of germ free mice modulted muscle AMPK ctivity demonstrting role of the microiot on this mster regultor of energy metolism (Bckhed et l., 2007). Involvement of similr mechnisms in the efficcy of B420 cnnot e ruled out y the present study. 5. Conclusions The findings of this study give rise to the hypothesis tht B420 could e used s complementry tretment for oesity nd impired glucose tolernce. Our results imply enefit for the potentil proiotic B420 in reducing oesity s well s glucose intolernce in diet-induced oese mice. Improved gut rrier function my contriute to the mechnisms of ction. Such metolic effects nd prmeters will still need to e evluted in clinicl setting. Supplementl mteril Supplementry mteril cn e found online t dx.doi.org/ /bm Figure S1. Body weight chnge nd ody composition during Bifidocterium nimlis ssp. lctis 420 tretment in dietic mice with ketogenic diet. Conflict of interest Dr. Stenmn nd Dr. Lhtinen re employees of DuPont, the mnufcturer of B420. Beneficil Microes 5(4) 443

8 L.K. Stenmn et l. Acknowledgements We thnk Y. Brreir nd S. LeGonidec from the Animl Cre Fcility of Rngueil Hospitl (UMS US006/Inserm) nd the Phenotyping fcilities of Rngueil Hospitl (UMS US006/ANEXPLO). We lso thnk J.-J. Moret nd F. Mrtins from the Quntittive Trnscriptomic Fcility (I2MC/UMR1048 prt of Toulouse Genopole). This study ws sponsored y DuPont. References Amr, J., Cho, C., Wget, A., Klopp, P., Vchoux, C., Bermudez- Humrn, L.G., Smirnov, N., Berge, M., Sulpice, T., Lhtinen, S., Ouwehnd, A., Lngell, P., Rutonen, N., Snsonetti, P.J. nd Burcelin, R., Intestinl mucosl dherence nd trnsloction of commensl cteri t the erly onset of type 2 dietes: moleculr mechnisms nd proiotic tretment. EMBO Moleculr Medicine 3: Andresen, A.S., Lrsen, N., Pedersen-Skovsgrd, T., Berg, R.M., Moller, K., Svendsen, K.D., Jkosen, M. nd Pedersen, B.K., Effects of Lctocillus cidophilus NCFM on insulin sensitivity nd the systemic inflmmtory response in humn sujects. British Journl of Nutrition 104: Asemi, Z., Smimi, M., Tssi, Z., Nghii Rd, M., Rhimi Foroushni, A., Khormmin, H. nd Esmillzdeh, A., Effect of dily consumption of proiotic yoghurt on insulin resistnce in pregnnt women: rndomized controlled tril. Europen Journl of Clinicl Nutrition 67: Bckhed, F., Mnchester, J.K., Semenkovich, C.F. nd Gordon, J.I., Mechnisms underlying the resistnce to diet-induced oesity in germ-free mice. Proceedings of the Ntionl Acdemy of Sciences of the USA 104: Bermudez-Brito, M., Plz-Diz, J., Munoz-Quezd, S., Gomez- Llorente, C. nd Gil, A., Proiotic mechnisms of ction. Annls of Nutrition nd Metolism 61: Burcelin, R., Crivelli, V., Dcost, A., Roy-Tirelli, A. nd Thorens, B., Heterogeneous metolic dpttion of C57BL/6J mice to high-ft diet. Americn Journl of Physiology: Endocrinology nd Metolism 282: E834-E842. Cni, P.D., Amr, J., Iglesis, M.A., Poggi, M., Knuf, C., Bstelic, D., Neyrinck, A.M., Fv, F., Tuohy, K.M., Cho, C., Wget, A., Delmee, E., Cousin, B., Sulpice, T., Chmontin, B., Ferrieres, J., Tnti, J.F., Gison, G.R., Csteill, L., Delzenne, N.M., Alessi, M.C. nd Burcelin, R., Metolic endotoxemi initites oesity nd insulin resistnce. Dietes 56: Cni, P.D., Biiloni, R., Knuf, C., Wget, A., Neyrinck, A.M., Delzenne, N.M. nd Burcelin, R., Chnges in gut microiot control metolic endotoxemi-induced inflmmtion in high-ft dietinduced oesity nd dietes in mice. Dietes 57: Cni, P.D., Neyrinck, A.M., Fv, F., Knuf, C., Burcelin, R.G., Tuohy, K.M., Gison, G.R. nd Delzenne, N.M., Selective increses of ifidocteri in gut microflor improve high-ft-dietinduced dietes in mice through mechnism ssocited with endotoxemi. Dietologi 50: Cno, P.G., Sntcruz, A., Trejo, F.M. nd Snz, Y., Bifidocterium CECT 7765 improves metolic nd immunologicl ltertions ssocited with oesity in high-ft diet-fed mice. Oesity 21: Crvlho, B.M., Gudgnini, D., Tsukumo, D.M., Schenk, A.A., Ltuf-Filho, P., Vssllo, J., Dis, J.C., Kuot, L.T., Crvlheir, J.B. nd Sd, M.J., Modultion of gut microiot y ntiiotics improves insulin signlling in high-ft fed mice. Dietologi 55: Chen, J.J., Wng, R., Li, X.F. nd Wng, R.L., Bifidocterium longum supplementtion improved high-ft-fed-induced metolic syndrome nd promoted intestinl Reg I gene expression. Experimentl Biology nd Medicine 236: Colldo, M.C., Meriluoto, J. nd Slminen, S., Role of commercil proiotic strins ginst humn pthogen dhesion to intestinl mucus. Letters in Applied Microiology 45: De l Serre, C.B., Ellis, C.L., Lee, J., Hrtmn, A.L., Rutledge, J.C. nd Ryould, H.E., Propensity to high-ft diet-induced oesity in rts is ssocited with chnges in the gut microiot nd gut inflmmtion. Americn Journl of Physiology: Gstrointestinl nd Liver Physiology 299: G440-G448. Everrd, A., Geurts, L., Vn Roye, M., Delzenne, N.M. nd Cni, P.D., Tetrhydro iso-lph cids from hops improve glucose homeostsis nd reduce ody weight gin nd metolic endotoxemi in high-ft diet-fed mice. PloS One 7: e Ghoshl, S., Witt, J., Zhong, J., de Villiers, W. nd Eckhrdt, E., Chylomicrons promote intestinl sorption of lipopolyscchrides. Journl of Lipid Reserch 50: Hotmisligil, G.S., Inflmmtion nd metolic disorders. Nture 444: Kdook, Y., Sto, M., Imizumi, K., Ogw, A., Ikuym, K., Aki, Y., Okno, M., Kgoshim, M. nd Tsuchid, T., Regultion of dominl diposity y proiotics (Lctocillus gsseri SBT2055) in dults with oese tendencies in rndomized controlled tril. Europen Journl of Clinicl Nutrition 64: Kdook, Y., Sto, M., Ogw, A., Miyoshi, M., Uenishi, H., Ogw, H., Ikuym, K., Kgoshim, M. nd Tsuchid, T., Effect of Lctocillus gsseri SBT2055 in fermented milk on dominl diposity in dults in rndomised controlled tril. British Journl of Nutrition 110: Keit, A.V., Slim, S.Y., Jing, T., Yng, P.C., Frnzen, L., Soderkvist, P., Mgnusson, K.E. nd Soderholm, J.D., Incresed uptke of non-pthogenic E. coli vi the follicle-ssocited epithelium in longstnding ilel Crohn s disese. Journl of Pthology 215: Kim, K.A., Gu, W., Lee, I.A., Joh, E.H. nd Kim, D.H., High ft diet-induced gut microiot excertes inflmmtion nd oesity in mice vi the TLR4 signling pthwy. PloS One 7: e Kim, S.W., Prk, K.Y., Kim, B., Kim, E. nd Hyun, C.K., Lctocillus rhmnosus GG improves insulin sensitivity nd reduces diposity in high-ft diet-fed mice through enhncement of diponectin production. Biochemicl nd Biophysicl Reserch Communictions 431: Beneficil Microes 5(4)

9 B420, ft mss nd glucose intolernce in oese mice Kondo, S., Xio, J.Z., Stoh, T., Odmki, T., Tkhshi, S., Sughr, H., Yeshim, T., Iwtsuki, K., Kmei, A. nd Ae, K., Antioesity effects of Bifidocterium reve strin B-3 supplementtion in mouse model with high-ft diet-induced oesity. Bioscience, Biotechnology, nd Biochemistry 74: Luche, E., Cousin, B., Gridou, L., Serino, M., Wget, A., Brreu, C., Andre, M., Vlet, P., Courtney, M., Csteill, L. nd Burcelin, R., Metolic endotoxemi directly increses the prolifertion of dipocyte precursors t the onset of metolic diseses through CD14-dependent mechnism. Moleculr Metolism 2: Muccioli, G.G., Nslin, D., Bckhed, F., Reigstd, C.S., Lmert, D.M., Delzenne, N.M. nd Cni, P.D., The endocnninoid system links gut microiot to dipogenesis. Moleculr Systems Biology 6: 392. Prk, D.Y., Ahn, Y.T., Prk, S.H., Huh, C.S., Yoo, S.R., Yu, R., Sung, M.K., McGregor, R.A. nd Choi, M.S., Supplementtion of Lctocillus curvtus HY7601 nd Lctocillus plntrum KY1032 in diet-induced oese mice is ssocited with gut microil chnges nd reduction in oesity. PloS One 8: e Pussinen, P.J., Hvulinn, A.S., Lehto, M., Sundvll, J. nd Slom, V., Endotoxemi is ssocited with n incresed risk of incident dietes. Dietes Cre 34: Putl, H., Slusjrvi, T., Nordstrom, M., Srinen, M., Ouwehnd, A.C., Bech Hnsen, E. nd Rutonen, N., Effect of four proiotic strins nd Escherichi coli O157:H7 on tight junction integrity nd cyclo-oxygense expression. Reserch in Microiology 159: Rot, S., Memrez, M., Bruneu, A., Gerrd, P., Hrch, T., Moser, M., Rymond, F., Mnsourin, R. nd Chou, C.J., Germfree C57BL/6J mice re resistnt to high-ft-diet-induced insulin resistnce nd hve ltered cholesterol metolism. FASEB Journl 24: Sto, M., Uzu, K., Yoshid, T., Hmd, E.M., Kwkmi, H., Mtsuym, H., Ad El-Gwd, I.A. nd Imizumi, K., Effects of milk fermented y Lctocillus gsseri SBT2055 on dipocyte size in rts. British Journl of Nutrition 99: Schertzer, J.D., Tmrkr, A.K., Mglhes, J.G., Pereir, S., Biln, P.J., Fullerton, M.D., Liu, Z., Steinerg, G.R., Gicc, A., Philpott, D.J. nd Klip, A., NOD1 ctivtors link innte immunity to insulin resistnce. Dietes 60: Serino, M., Luche, E., Gres, S., Bylc, A., Berge, M., Cenc, C., Wget, A., Klopp, P., Icovoni, J., Klopp, C., Mriette, J., Bouchez, O., Lluch, J., Ourne, F., Monsn, P., Vlet, P., Roques, C., Amr, J., Bouloumie, A., Theodorou, V. nd Burcelin, R., Metolic dpttion to high-ft diet is ssocited with chnge in the gut microiot. Gut 61: Stenmn, L.K., Holm, R., Eggert, A. nd Korpel, R., A novel mechnism for gut rrier dysfunction y dietry ft: epithelil disruption y hydrophoic ile cids. Americn Journl Physiology: Gstrointestinl nd Liver Physiology 304: G227-G234. Stenmn, L.K., Holm, R. nd Korpel, R., High-ft-induced intestinl permeility dysfunction ssocited with ltered fecl ile cids. World Journl of Gstroenterology 18: Ydv, H., Lee, J.H., Lloyd, J., Wlter, P. nd Rne, S.G., Beneficil metolic effects of proiotic vi utyrte-induced GLP-1 hormone secretion. Journl of Biologicl Chemistry 288: Beneficil Microes 5(4) 445

10

* * * * * liver kidney ileum. Supplementary Fig.S1

* * * * * liver kidney ileum. Supplementary Fig.S1 Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).

More information

Abstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions

Abstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,

More information

The effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1

The effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1 The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce

More information

2018 American Diabetes Association. Published online at

2018 American Diabetes Association. Published online at Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison

More information

EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE

EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity

More information

Expression of Three Cell Cycle Inhibitors during Development of Adipose Tissue

Expression of Three Cell Cycle Inhibitors during Development of Adipose Tissue Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy

More information

Supplementary figure 1

Supplementary figure 1 Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22

More information

The Ever Changing World of Feed Additives in The Poultry Industry

The Ever Changing World of Feed Additives in The Poultry Industry The Ever Chnging World of Feed Additives in The Poultry Industry B. S. Lumpkins nd G.F. Mthis Southern Poultry Reserch Inc. Athens, GA, USA Outline Southern Poultry Reserch Impct of ethnol production of

More information

Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens

Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler

More information

Supplementary Figure 1

Supplementary Figure 1 Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,

More information

PROVEN ANTICOCCIDIAL IN NEW FORMULATION

PROVEN ANTICOCCIDIAL IN NEW FORMULATION PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules

More information

Dr. Javier Polo Vice President Research & Development

Dr. Javier Polo Vice President Research & Development Efecto de l suplementción con concentrdo de inmunoglobulins prtir del suero bovino en l Microbiot y su contribución l slud intestinl y l sistem nervioso centrl Dr. Jvier Polo Vice President Reserch & Development

More information

A Specific Gut Microbiota Dysbiosis of Type 2 Diabetic Mice Induces GLP-1 Resistance through an Enteric NO-Dependent and Gut-Brain Axis Mechanism

A Specific Gut Microbiota Dysbiosis of Type 2 Diabetic Mice Induces GLP-1 Resistance through an Enteric NO-Dependent and Gut-Brain Axis Mechanism Article A Specific Gut Microiot Dysiosis of Type 2 Dietic Mice Induces GLP-1 Resistnce through n Enteric NO-Dependent nd Gut-Brin Axis Mechnism Grphicl Astrct Authors Estelle Grsset, Anthony Puel, Julie

More information

British Journal of Nutrition

British Journal of Nutrition (11), 16, 1449 1456 q The Authors 11 doi:1.117/s71145111917 Fish oil comined with SCFA synergisticlly prevent tissue ccumultion of NEFA during weight loss in oese mice Miken H. Pedersen 1,, Lotte Luritzen

More information

PNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :

PNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 : PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged

More information

THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS

THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY

More information

Effect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1

Effect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1 Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5

More information

Clinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number

Clinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess

More information

Bioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM

Bioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms

More information

TNF-α (pg/ml) IL-6 (ng/ml)

TNF-α (pg/ml) IL-6 (ng/ml) Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6

More information

Intestinal microbiota and energy balance pro s and con s

Intestinal microbiota and energy balance pro s and con s Technicl University of Munich Nutrition nd Immunology Intestinl microiot nd energy lnce pro s nd con s Prof. Dr. Dirk Hller Chir of Nutrition nd Immunology School of Life Sciences Weihenstephn (WZW) Reserch

More information

Effects of physical exercise on working memory and prefrontal cortex function in post-stroke patients

Effects of physical exercise on working memory and prefrontal cortex function in post-stroke patients Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei

More information

Effect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice

Effect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which

More information

The DPP-4 inhibitor vildagliptin impacts the gut microbiota and prevents disruption of intestinal homeostasis induced by a Western diet in mice

The DPP-4 inhibitor vildagliptin impacts the gut microbiota and prevents disruption of intestinal homeostasis induced by a Western diet in mice Dietologi (18) 61:1838 1848 https://doiorg/117/s15-18-4647-6 ARTICLE The DPP-4 inhiitor vildgliptin impcts the gut microiot nd prevents disruption of intestinl homeostsis induced y Western diet in mice

More information

Inheritance of cholesterol metabolism of probands with high or low cholesterol absorption

Inheritance of cholesterol metabolism of probands with high or low cholesterol absorption Inheritnce of cholesterol metolism of pronds with high or low cholesterol sorption Helen Gylling* nd Ttu A. Miettinen 1, Deprtment of Clinicl Nutrition,* University of Kuopio, nd Kuopio University Hospitl,

More information

EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE

EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.

More information

British Journal of Nutrition

British Journal of Nutrition British Journl of Nutrition (215), 113, 1862 1875 q The Authors 215 doi:1.117/s7114515121x Anormlities in myo-inositol metolism ssocited with type 2 dietes in mice fed high-ft diet: enefits of dietry myo-inositol

More information

Curcumin attenuates Nrf2 signaling defect, oxidative stress in muscle and glucose intolerance in high fat diet-fed mice

Curcumin attenuates Nrf2 signaling defect, oxidative stress in muscle and glucose intolerance in high fat diet-fed mice Online Sumissions: http://www.wjgnet.com/1948-938of fice wjd@wjgnet.com doi:239/wjd.v3.i.94 World J Dietes 212 My 1; 3(): 94-14 ISSN 1948-938 (online) 212 Bishideng. All rights reserved. ORIGINAL ARTICLE

More information

DR. MARC PAGÈS Project Manager R&D Biologicals - Coccidia Projects, HIPRA

DR. MARC PAGÈS Project Manager R&D Biologicals - Coccidia Projects, HIPRA DR. MARC PAGÈS Project Mnger R&D Biologicls - Coccidi Projects, HIPRA Dr. Mrc Pgès Bosch otined Microiology nd Genetics degree t the University of Brcelon in 1998. He otined his PhD working on the synptoneml

More information

Chromium Alleviates Glucose Intolerance, Insulin Resistance, and Hepatic ER Stress in Obese Mice

Chromium Alleviates Glucose Intolerance, Insulin Resistance, and Hepatic ER Stress in Obese Mice nture pulishing group rticles intervention AND prevention Chromium Allevites Glucose Intolernce, Insulin Resistnce, nd Heptic ER Stress in Oese Mice Nir Sreejyn, Feng Dong, Mchender R. Knddi,2, Xioping

More information

Signaling by IL-6 promotes alternative activation of macrophages to limit endotoxemia and obesity-associated resistance to insulin

Signaling by IL-6 promotes alternative activation of macrophages to limit endotoxemia and obesity-associated resistance to insulin Signling y promotes lterntive ctivtion of mcrophges to limit endotoxemi nd oesity-ssocited resistnce to insulin Nture Americ, Inc. All rights reserved. Jn Muer,9, Bhgirth Chursi,9, Juli Goldu, Merly C

More information

The effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat

The effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA

More information

Anti-Obesity Potential of Gallic Acid from Labisia pumila, through Augmentation of Adipokines in High Fat Diet Induced Obesity in C57BL/6 Mice

Anti-Obesity Potential of Gallic Acid from Labisia pumila, through Augmentation of Adipokines in High Fat Diet Induced Obesity in C57BL/6 Mice Advnces in Reserch 2(10): 556-570, 2014, Article no. AIR.2014.10.004 SCIENCEDOMAIN interntionl www.sciencedomin.org Anti-Oesity Potentil of Gllic Acid from Lisi pumil, through Augmenttion of Adipokines

More information

Check your understanding 3

Check your understanding 3 1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the

More information

P eriodontal diseases are mainly chronic infectious diseases result from response to a complex dental plaque

P eriodontal diseases are mainly chronic infectious diseases result from response to a complex dental plaque OPEN SUBJECT AREAS: PERIODONTITIS METABOLIC DISORDERS Received 15 Jnury 214 Accepted 9 April 214 Pulished 6 My 214 Correspondence nd requests for mterils should e ddressed to K.Y. (kz@dent. niigt-u.c.jp)

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+

More information

The Journal of Physiology

The Journal of Physiology J Physiol 595.13 (2017) pp 4379 4398 4379 Impct of perintl exposure to sucrose or high fructose corn syrup (HFCS-55) on diposity nd heptic lipid composition in rt offspring Crl R. Toop 1, Beverly S. Muhlhusler

More information

Optimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality

Optimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,

More information

Synergistic effects of metformin, resveratrol, and hydroxymethylbutyrate on insulin sensitivity

Synergistic effects of metformin, resveratrol, and hydroxymethylbutyrate on insulin sensitivity Dietes, Metolic Syndrome nd Oesity: Trgets nd Therpy Open Access Full Text Article open ccess to scientific nd medicl reserch Originl Reserch Synergistic effects of metformin, resvertrol, nd hydroxymethylutyrte

More information

Chronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats

Chronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho

More information

De novo lipogenesis in human fat and liver is linked to ChREBP-b and metabolic health

De novo lipogenesis in human fat and liver is linked to ChREBP-b and metabolic health Received 2 Aug 2 Accepted 23 Jn 213 Pulished 26 Fe 213 DOI: 1.13/ncomms253 De novo lipogenesis in humn ft nd liver is linked to ChREBP- nd metolic helth Leh Eissing 1, *, Thoms Scherer 2, *,w, Klus Tödter

More information

Products for weaners Benzoic acid or the combination of lactic acid and formic acid

Products for weaners Benzoic acid or the combination of lactic acid and formic acid Products for weners Benzoic cid or the comintion of lctic cid nd formic cid Tril report no.: 490 Novemer, 000 Hnne Mrio, Lrs Egelund Olsen, Bent Borg Jensen 1 nd Nuri Miquel 1 The Ntionl Committee for

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized

More information

Dietary oil composition differentially modulates intestinal endotoxin transport and postprandial endotoxemia

Dietary oil composition differentially modulates intestinal endotoxin transport and postprandial endotoxemia Mni et l. Nutrition & Metolism 2013, 10:6 http://www.nutritionndmetolism.com/content/10/1/6 RESEARCH Open Access Dietry oil composition differentilly modultes intestinl endotoxin trnsport nd postprndil

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight

More information

SESSIONE I: RELATORI. Ghrelin: from oroxigenic signal to metabolic master regulator?

SESSIONE I: RELATORI. Ghrelin: from oroxigenic signal to metabolic master regulator? SESSIONE I: RELATORI Ghrelin: from oroxigenic signl to metbolic mster regultor? Prof. Rocco Brzzoni Professore ssocito di Medicin Intern Università degli Studi di Trieste Ghrelin: d segnle oressizznte

More information

Implication of fermentable carbohydrates targeting the gut microbiota on conjugated linoleic acid production in high-fat-fed mice

Implication of fermentable carbohydrates targeting the gut microbiota on conjugated linoleic acid production in high-fat-fed mice British Journl of Nutrition, pge 1 of 14 q The Authors 213 doi:1.117/s7114513123 Impliction of fermentle crohydrtes trgeting the gut microiot on conjugted linoleic cid production in high-ft-fed mice Céline

More information

A mouse model of vitamin D insufficiency: is there a relationship between 25(OH) vitamin D levels and obesity?

A mouse model of vitamin D insufficiency: is there a relationship between 25(OH) vitamin D levels and obesity? Seldeen et l. Nutrition & Metolism (217) 14:26 DOI 1.1186/s12986-17-174-6 RESEARCH Open Access A mouse model of vitmin D insufficiency: is there reltionship etween 25(OH) vitmin D levels nd oesity? Kenneth

More information

Enhanced Chemopreventive Effect by Combining Quercetin and Green tea in Prostate Cancer

Enhanced Chemopreventive Effect by Combining Quercetin and Green tea in Prostate Cancer Enhnced Chemopreventive Effect y Comining Quercetin nd Green te in Prostte Cncer Piwen Wng, MD, PhD Assistnt Professor, Division of Cncer Reserch nd Trining Chrles R. Drew University of Medicine nd Science

More information

Using Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids

Using Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress

More information

Mecadox. Improves pig performance in a wide range of health and growing conditions. (Carbadox) Talk With a Phibro Expert:

Mecadox. Improves pig performance in a wide range of health and growing conditions. (Carbadox) Talk With a Phibro Expert: SWINE (Crbdox) Improves pig performnce in wide rnge of helth nd growing conditions The Advntge Over the yers, medicted feed dditive hs proven to be cost-effective mngement tool for improving pig performnce

More information

British Journal of Nutrition

British Journal of Nutrition (2011), 105, 90 100 q The Authors 2010 doi:10.1017/s0007114510003132 The effect of fire supplement compred to helthy diet on ody composition, lipids, glucose, insulin nd other metolic syndrome risk fctors

More information

British Journal of Nutrition

British Journal of Nutrition (2013), 110, 1837 1848 q The Authors 2013 doi:10.1017/s0007114513001293 Dietry fire ffects intestinl mucosl rrier function nd regultes intestinl cteri in wening piglets Hong Chen 1,2, Xinging Mo 1,2, Jun

More information

Cyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK

Cyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK 3 rd Interntionl Conference nd Exhiition on Nutrition & Food Sciences Septemer 23-25, 214 Vlenci, Spin Cynidin-3-O-glucoside meliortes lipid nd glucose ccumultion in C57BL/6J mice vi ctivtion of PPAR-α

More information

TLR7 induces anergy in human CD4 + T cells

TLR7 induces anergy in human CD4 + T cells TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:

More information

Food & Function Accepted Manuscript

Food & Function Accepted Manuscript Food & Function Accepted Mnuscript This is n Accepted Mnuscript, which hs een through the Royl Society of Chemistry peer review process nd hs een ccepted for puliction. Accepted Mnuscripts re pulished

More information

Effect of fungicide timing and wheat varietal resistance on Mycosphaerella graminicola and its sterol 14 α-demethylation-inhibitorresistant

Effect of fungicide timing and wheat varietal resistance on Mycosphaerella graminicola and its sterol 14 α-demethylation-inhibitorresistant Effect of fungicide timing nd whet vrietl resistnce on Mycospherell grminicol nd its sterol 14 α-demethyltion-inhiitorresistnt genotypes Didierlurent L., Roisin-Fichter C., Snssené J., Selim S. Pltform

More information

Supplementary Figure 1

Supplementary Figure 1 doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney

More information

Maternal omega-3 fatty acids regulate offspring obesity through persistent modulation of gut microbiota

Maternal omega-3 fatty acids regulate offspring obesity through persistent modulation of gut microbiota Roertson et l. Microiome (218) 6:95 https://doi.org/1.1186/s4168-18-476-6 RESEARCH Open Access Mternl omeg-3 ftty cids regulte offspring oesity through persistent modultion of gut microiot Ruiri C. Roertson

More information

Title: Niche-dependent regulations of metabolic balance in high-fat diet induced diabetic mice by mesenchymal stromal cells

Title: Niche-dependent regulations of metabolic balance in high-fat diet induced diabetic mice by mesenchymal stromal cells Pge 1 of 3 Dietes Title: Niche-dependent regultions of metolic lnce in high-ft diet induced dietic mice y mesenchyml stroml cells Authors: Andre Tung-Qin Ji, 1 Yun-Chung Chng, 1 Yun-Ju Fu, 1 Oscr K Lee,

More information

*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU

*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA

More information

Effect of Inhibition of Angiotensin-Converting Enzyme and/or Neutral Endopeptidase on Neuropathy in High-Fat-Fed C57Bl/6J Mice

Effect of Inhibition of Angiotensin-Converting Enzyme and/or Neutral Endopeptidase on Neuropathy in High-Fat-Fed C57Bl/6J Mice Effect of Inhiition of Angiotensin-Converting Enzyme nd/or Neutrl Endopeptidse on Neuropthy in High-Ft-Fed C7Bl/J Mice The Hrvrd community hs mde this rticle openly ville. Plese shre how this ccess enefits

More information

Supporting information

Supporting information Supporting informtion Multiple Univrite Dt Anlysis Revels the Inulin Effects on the High-ft-diet Induced Metolic Altertions in Rt Myocrdium nd Testicles in the Pre-oesity Stte Yixun Dun #, Ynpeng An #,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,

More information

Common genetic variation in the melatonin receptor 1B gene (MTNR1B) is associated with decreased early-phase insulin response

Common genetic variation in the melatonin receptor 1B gene (MTNR1B) is associated with decreased early-phase insulin response Dietologi (2009) 52:1537 1542 DOI 10.1007/s00125-009-1392-x ARTICLE Common genetic vrition in the meltonin receptor 1B gene (MTNR1B) is ssocited with decresed erly-phse insulin response C. Lngenerg & L.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION . Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,

More information

EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1

EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were

More information

Effect of Different Dietary Energy Sources on Induction of Fatty Liver-Hemorrhagic Syndrome in Laying Hens

Effect of Different Dietary Energy Sources on Induction of Fatty Liver-Hemorrhagic Syndrome in Laying Hens Interntionl Journl of Poultry Science 7 (12): 1232-1236, 2008 ISSN 1682-8356 sin Network for Scientific Informtion, 2008 Effect of Different Dietry Energy Sources on Induction of Ftty Liver-Hemorrhgic

More information

Hormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.

Hormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L. Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,

More information

Combined deletion of SCD1 from adipose tissue and liver does not protect

Combined deletion of SCD1 from adipose tissue and liver does not protect Comined deletion of SCD1 from dipose tissue nd liver does not protect mice from oesity Mtthew T. Flowers 1, Lcmouh de 1, Mggie S. Strle 2 nd Jmes M. Ntmi 1,2,* Deprtments of 1 Biochemistry nd 2 Nutritionl

More information

The Effect of Substituting Sugar with Artificial. Sweeteners on the Texture and Palatability of Pancakes

The Effect of Substituting Sugar with Artificial. Sweeteners on the Texture and Palatability of Pancakes The Effect of Sustituting Sugr with Artificil NUTR 453 Sweeteners on the Texture nd Pltility of Pnckes Jmie Wldron, Rquel Reyes, nd Reecc Legi 1 I. Astrct The effects of replcing sugr with Stevi nd Splend

More information

Background Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield.

Background Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield. Nnjing Agriculturl University Potssium enhnces the sugr ssimiltion in leves nd fruit y regulting the expression of key genes involved in sugr metolism of Asin pers Cixi Dong, Chngwei Shen, Yngchun Xu College

More information

Northern blot analysis

Northern blot analysis Northern blot nlysis RNA SCD RNA SCD FAS C c-9 t-1 C c-9 t-1 PRE PI PDMI PRE PI PDMI PRE PDMI PIM An W c-9, t-11 t-1, c-12 C 5 2 4 1 um C 5 2 4 1 um Angus dipocytes expressed SCD higher thn Wgyu dipocyte

More information

Effect of linear and random non-linear programming on environmental pollution caused by broiler production

Effect of linear and random non-linear programming on environmental pollution caused by broiler production Journl of Novel Applied Sciences Aville online t www.jnsci.org 24 JNAS Journl-24-3-/43-434 ISSN 2322-549 24 JNAS Effect of liner nd rndom non-liner progrmming on environmentl pollution cused y roiler production

More information

Brown adipose tissue activity controls triglyceride clearance

Brown adipose tissue activity controls triglyceride clearance Supplementry informtion Brown dipose tissue ctivity s triglyceride clernce Alexnder Brtelt 1, Oliver T. Bruns 2, Rudolph Reimer 2, Heinz Hohenerg 2, Hrld Ittrich 3, Kersten Peldschus 3, Michel G. Kul 3,

More information

A Comparison of Serum Magnesium Level in Pregnant Women with and without Gestational Diabetes Mellitus (GDM)

A Comparison of Serum Magnesium Level in Pregnant Women with and without Gestational Diabetes Mellitus (GDM) Brief Report J Bbol Univ Med Sci Vol 18, Issu 12; Dec 2016. P:71-75 A Comprison of Serum Mgnesium Level in Pregnnt Women with nd without Gesttionl Dibetes Mellitus (GDM) Z. Bouzri (MD) 1, F. Elmi(MD) 2,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.

More information

Supplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage

Supplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,

More information

Research Article Maternal Fructose Intake Induces Insulin Resistance and Oxidative Stress in Male, but Not Female, Offspring

Research Article Maternal Fructose Intake Induces Insulin Resistance and Oxidative Stress in Male, but Not Female, Offspring Journl of Nutrition nd Metolism Volume 2015, Article ID 158091, 8 pges http://dx.doi.org/10.1155/2015/158091 Reserch Article Mternl Fructose Intke Induces Insulin Resistnce nd Oxidtive Stress in Mle, ut

More information

Interleukin-4 Restores Insulin Sensitivity in Lipid-Induced Insulin-Resistant Adipocytes

Interleukin-4 Restores Insulin Sensitivity in Lipid-Induced Insulin-Resistant Adipocytes ISSN 6-2979, Biochemistry (Moscow), 21, Vol. 3, No. 5, pp. 49-56. Pleides Pulishing, Ltd., 21. Originl Russin Text I. S. Stfeev, S. S. Michurin,3, N. V. Podkuychenko, A. V. Vorotnikov, M. Yu. Menshikov,

More information

4/16/2009. Gabler Laboratory Research Program. Long chain n-3 Fatty Acids, Fetal Programming and Swine. My Background. Swine Research Areas

4/16/2009. Gabler Laboratory Research Program. Long chain n-3 Fatty Acids, Fetal Programming and Swine. My Background. Swine Research Areas /1/9 Gler Lortory Reserch Progrm Nichols Gler Venktesh Mni (PhD. student) Emily Kuntz (BSc. student) Mrth Jeffrey (L. Mnger) Deprtment of Animl Sciences Iow Stte University L Troe University B. Agriculturl

More information

Naringenin prevents cholesterol-induced systemic inflammation, metabolic dysregulation and atherosclerosis in Ldlr -/- mice.

Naringenin prevents cholesterol-induced systemic inflammation, metabolic dysregulation and atherosclerosis in Ldlr -/- mice. Nringenin prevents cholesterol-induced systemic inflmmtion, metolic dysregultion nd therosclerosis in Ldlr -/- mice. Juli M. Assini 1,2, Erin E. Mulvihill 1,2, Brin G. Sutherlnd 1, Dwn E. Telford 1,3,

More information

A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM

A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND

More information

The Journal of Physiology

The Journal of Physiology J Physiol 596.4 (218) pp 623 645 623 Restortion of metolic helth y decresed consumption of rnched-chin mino cids Nicole E. Cummings 1,2,3, Elizeth M. Willims 1,2,IldikoKsz 4, Elizeth N. Konon 1,2, Michel

More information

Lymphatic Pump Treatment as an Adjunct to Antibiotics for Pneumonia in a Rat Model

Lymphatic Pump Treatment as an Adjunct to Antibiotics for Pneumonia in a Rat Model Editor s Note: Corrections to this rticle were pulished in the June 2015 issue of The Journl of the Americn Osteopthic Assocition (2015;115[6]:357). The corrections hve een incorported in this online version

More information

Input from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer

Input from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA

More information

Flaxseed Lignan Increased Glucose Uptake by Human Red Blood Cells

Flaxseed Lignan Increased Glucose Uptake by Human Red Blood Cells The Open Nutrceuticls Journl, 29, 2, 81-85 81 Open Access Flxseed Lignn Incresed Glucose Uptke y Humn Red Blood Cells Yeong Rhee * nd Ardith Brunt 351 EML, NDSU Dept. # 262, PO Box 65, North Dkot Stte

More information

Research Article Antidiabetic Effect of Morindacitrifolia (Noni) Fermented by Cheonggukjang in KK-A y Diabetic Mice

Research Article Antidiabetic Effect of Morindacitrifolia (Noni) Fermented by Cheonggukjang in KK-A y Diabetic Mice Evidence-Bsed Complementry nd Alterntive Medicine Volume 2012, Article ID 163280, 8 pges doi:10.1155/2012/163280 Reserch Article Antidietic Effect of Morindcitrifoli (Noni) Fermented y Cheonggukjng in

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.

More information

Bright Futures Medical Screening Reference Table 2 to 5 Day (First Week) Visit

Bright Futures Medical Screening Reference Table 2 to 5 Day (First Week) Visit Bright Futures Medicl Reference Tle 2 to 5 Dy (First Week) Visit Universl Action Metolic nd Verify documenttion of neworn metolic screening results, pproprite rescreening, nd needed follow-up. Document

More information

British Journal of Nutrition

British Journal of Nutrition British Journl of Nutrition (2015), 113, 923 934 doi:10.1017/s0007114514003201 q The Authors 2015. This is n Open Access rticle, distriuted under the terms of the Cretive Commons Attriution licence (http://cretive

More information

PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES

PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles

More information

Myricetin Ameliorates Defective Post-Receptor Insulin Signaling via

Myricetin Ameliorates Defective Post-Receptor Insulin Signaling via Evidence-Bsed Complementry nd Alterntive Medicine Volume 211, Article ID 15752, 9 pges doi:1.193/ecm/neq17 Originl Article Ameliortes Defective Post-Receptor Insulin Signling vi β-endorphin Signling in

More information

Invasive Pneumococcal Disease Quarterly Report July September 2018

Invasive Pneumococcal Disease Quarterly Report July September 2018 Invsive Pneumococcl Disese Qurterly Report July Septemer Introduction Since 17 Octoer 2008, invsive pneumococcl disese (IPD) hs een notifile to the locl Medicl Officer of Helth under the Helth Act 1956.

More information

Hydroxy Minerals - The Newest Development in Mineral Nutrition

Hydroxy Minerals - The Newest Development in Mineral Nutrition Hydroxy Minerls - The Newest Development in Minerl Nutrition By Jeff Cohen nd F. A. Stewrd For t lest 3 yers nutritionl sources of essentil trce minerls such s iron, zinc, copper nd mngnese hve een commonly

More information

Critical role of c-kit in beta cell function: increased insulin secretion and protection against diabetes in a mouse model

Critical role of c-kit in beta cell function: increased insulin secretion and protection against diabetes in a mouse model Dietologi (1) 55:14 5 DOI 1.17/s15-1-5-5 ARTICLE Criticl role of c-kit in et cell function: incresed insulin secretion nd protection ginst dietes in mouse model Z. C. Feng & J. Li & B. A. Turco & M. Riopel

More information

ARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum,

ARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum, DOI:.554/5YRTIMB..3 OPPOSITE MODELS OF EXPRESSION OF ANDROGEN RECEPTOR (AR) AND RETINOIC ACID RECEPTOR-α (RAR-α) IN THE ONSET OF MALE GERM CELL DEVELOPMENT IN HORMONALLY MANIPULATED RATS E. Pvlov, N. Atnssov,

More information

Thallium-201 chloride scintigraphy in soft tissue tumors

Thallium-201 chloride scintigraphy in soft tissue tumors 136 ORIGINAL Thllium-201 chloride scintigrphy in soft tissue tumors Hideki Otsuk, Kori Terzw, Nomi Morit, Yoichi Otomi, Shoichiro Tko, Seiji Iwmoto, Kyosuke Oski, Msfumi Hrd, nd Hiromu Nishitni Deprtment

More information