Supplementary Materials for

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Supplementary Materials for"

Transcription

1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen Shie, Ming-Shien Wen, Kuo-Chun Hung, I-Chang Hsieh, Ta-Sen Yeh, Delon Wu The PDF file includes: *Corresponding author. Published 15 December 2015, Sci. Signal. 8, ra127 (2015) DOI: /scisignal.aab3357 Fig. S1. FTO protein distribution in human and mice. Fig. S2. FTO abundance after 2 and 14 days on a high-fat diet. Fig. S3. Generation of adipocyte-specific FTO knockout mice. Fig. S4. Analysis of tibial length, adipocyte size, energy expenditure, thyroid function, body weight, and paired feeding experiments. Fig. S5. Relative mrna expression of brown fat genes in AFO and wild-type mice. Fig. S6. Glucose tolerance and insulin sensitivity. Fig. S7. Lipidomics analysis of white fat tissue in AFO and wild-type mice. Fig. S8. FTO protein abundance during adipocyte differentiation. Fig. S9. LPL-mediated lipoprotein-dependent fatty acid uptake. Fig. S10. RNA immunoprecipitation experiments. Fig. S11. RNA expression in white adipose tissue. Fig. S12. RNA EMSAs for Angptl4 mrna and FTO protein. Fig. S13. DAA treatment and Angptl4 abundance in AFO adipocytes. Fig. S14. m 6 A pattern in Angptl4 mrna. Fig. S15. Polysome profiles and Angptl4 RNA abundance in control and FTO knockdown MCF-7 cell lines. Fig. S16. Serum triglyceride concentrations in wild-type and AFO mice after inguinal fat pad injections of control adenovirus or adenovirus expressing Angptl4.

2 Fig. S1. FTO protein distribution in human and mice. Left panel: Western blot analysis of FTO protein abundance in human tissue samples. Right panel: Western blot analysis of FTO protein expression in mouse adipose tissue. SF, subcutaneous fat; VF, visceral fat; BF, brown fat. Data are representative of two independent experiments.

3 Fig. S2. FTO abundance after 2 and 14 days on a high-fat diet. (A) mrna analysis of PPAR- and FTO from subcutaneous white fat (WF), visceral WF, and brown fat (BF) from WT mice fed chow diet (CD), 2-d HFD, or 14-d HFD (n = 4 mice per diet). * P < 0.05, 2d- HFD or 14-d HFD, compared to CD. (B) Protein analysis by Western blot of PPAR- and

4 FTO from subcutaneous fat, visceral fat, and brown fat from WT mice fed chow diet, 2-d HFD, or 14-d HFD (n = 4 mice per diet). * P < 0.05, 2d-HFD or 14-d HFD, compared to CD. (C, D) FTO mrna and protein abundance in adipose tissue from WT mice that received the PPAR- inhibitor GW9662 for 1 d after being fed with CD or 2-d HFD (n = 4 mice per diet and treatment). * P < 0.05, HFD-GW9662 compared to HFD-C. Data represent mean ± s.e.m. Statistical analysis was done using two-sample Mann-Whitney test.

5 Fig. S3. Generation of adipocyte-specific FTO knockout mice (A) Wild-type, floxed, and deleted FTO gene loci with targeting vector. (B) Absolute FTO mrna copy number (copies/10 ng total RNA) in AFO and WT (FTO f/f) mice (n = 3 mice per genotype). Data represent mean ± s.e.m. * P < 0.05, Adiponectin-Cre FTO f/f compared to FTO f/f.

6 Statistical analysis was done using two-sample Mann-Whitney test. (C) Protein abundance of FTO and actin in AFO and WT mice (n = 3 mice per genotype). Fig. S4. Analysis of tibial length, adipocyte size, energy expenditure, thyroid function, body weight, and paired feeding experiments. (A) Tibial length (TL) and adipocyte size quantification for epididymal white adipocytes from 20-week-old mice (n=10 mice per

7 genotype). Energy expenditure (EE) in 8-week-old mice (n=12 mice per genotype), adjusted for variation in lean mass using multiple linear regression (ANCOVA). Data represent means ± s.e.m. * P < 0.05, adiponectin-cre mice compared to WT mice. The FTO f/f and AFO mice data presented here were from Fig. 1D, 1G, and 2G to enable comparison with the other genotypes. (B) Thyroid function of AFO and WT (FTO f/f) mice (n = 6 mice per group). Data represent mean ± s.e.m. NS, not significant, AFO compared to FTO f/f (twosample Mann-Whitney test). (C) Body weights of AFO and FTO f/f littermate mice on chow diet, HFD, and paired feeding experiments (n = mice per group). Pair-fed mice received the same amount of calories in a high-fat diet as mice fed with the chow diet. Data represent mean ± s.e.m. AFO on the high-fat diet weighed significantly more than FTO f/f on the high-fat diet by two-way ANOVA with repeated measures (P = 0.03); *, P < 0.05, AFO paired feeding compared to FTO f/f paired feeding (Student s unpaired t-test). Fig. S5. Relative mrna expression of brown fat genes in AFO and wild-type mice. Data represent mean ± s.e.m. *, P < 0.05 AFO compared to FTO f/f brown fat. NS, not significant. n = 6 mice per group. Statistical analysis was done using two-sample Mann-Whitney test.

8 Fig. S6. Glucose tolerance and insulin sensitivity. (A) Glucose tolerance and (B) insulin sensitivity in AFO and WT (FTO f/f) mice fed with chow diet (n = 8 mice per group). Data represent mean ± s.e.m.

9 Fig. S7. Lipidomics analysis of white fat tissue in AFO and wild-type mice. Epididymal white fat was isolated and lipids were extracted and analyzed with lipidomics (n = 3 mice per group). Data represent mean ± s.e.m. *, P < 0.05 AFO compared to FTO f/f. Statistical analysis was done using two-sample Mann-Whitney test.

10 Fig. S8. FTO protein abundance during adipocyte differentiation. Western blot analysis of FTO and actin abundance during the in vitro differentiation of preadipocytes from WT and FTO-knockout mice to mature adipocytes (n = 3 mice per genotype). WT, wild-type adipocytes; KO, FTO-knockout adipocytes.

11 Fig. S9. LPL-mediated lipoprotein-dependent fatty acid uptake. (A) Adipocytes from AFO or WT (FTO f/f) mice were treated with or without orlistat and incubated with vehicle, intralipid, or oleic acid-rich bovine serum albumin (OA-BSA). Intracellular triglyceride was analyzed and normalized to cell numbers (n = 3 mice per genotype and treatment). Data represent mean ± s.e.m. (B D) Intracellular lipids were analyzed by lipidomics (n = 4 mice

12 per group). Data represent mean ± s.e.m. *, P < 0.05 AFO compared to FTO f/f treated with vehicle. Statistical analysis was done using two-sample Mann-Whitney test. A Isolation of visceral white fat IP RNA purification RNA sequence Flag reads vs. IgG reads Enriched RNA list F-FTO Bowtie mapping Selection of RNA target related to lipid homeostasis RNA-IP Immunoprecipitation with Flag or IgG beads Read counts for known & new RNAs Normalization Flag vs. IgG Cross reference to Microarray lists from WT/AFO mice B C log (IgG-IP) log 2(Flag-IP) Adcre - Adcre + D STARD3 SNX17 SLS27A4 SCARF1 PRKAB1 PPARD PMVK PCSK9 OXCT2A MVK LCAT INSIG1 IDI2 FDPS ECHS1 CYP46A1 CYP11A1 CYB5R3 APOA4 APOA2 APOA1 ANGPTL4 ACSM5 ACOX3 ACOX1 ACOT8 ACOT2 ACADS ACADL ACAA1A ABCG1 Flag-FTO IP Lipid homeostasis related RNA enrichment ratios Fig. S10. RNA immunoprecipitation experiments. (A) Schematic diagram of the RNAimmunoprecipitation (IP) procedure. (B) Scatterplot of Flag-FTO-IP and RNA-sequence data, in which normalized and log-transformed read numbers for each known transcript are

13 plotted against control IgG-IP data. The FLAG-FTO-IP analysis was performed twice. (C) Microarray of white adipose tissues from AFO and WT (FTO f/f) mice (n = 3 mice per genotype). (D) The enrichment ratios of FTO-associated RNAs with functions related to lipid homeostasis. Fig. S11. RNA expression in white adipose tissue. Quantitative PCR of gene expression in white adipose tissue from AFO and WT (FTO f/f) mice (n = 3 mice per genotype). Data represent mean ± s.e.m. NS, not significant. Statistical analysis was done using two-sample Mann-Whitney test.

14 Fig. S12. RNA EMSAs for Angptl4 mrna and FTO protein. (A) Two segments of the Angptl4 3ʹ UTR were in vitro transcribed and incubated with different amounts of FTO protein. RNA-protein complexes were analyzed together with free probe, unlabeled RNA, and FTO protein control. (B) RNA EMSA analysis of Angptl4 mrna in free probes (F), FTO protein-angptl4 mrna probe complexes (FTO), and nonlabeled Angptl4 mrna

15 competitor + FTO protein-angptl4 mrna probe complexes (C). (C) Angptl4 3ʹ UTR segments were incubated with adipose tissue protein lysates from wild-type (WT) or FTOknockout (KO) mice and analyzed with EMSA. Data are representative of three independent experiments. Fig. S13. DAA treatment and Angptl4 abundance in AFO adipocytes. (A) Treatment of primary adipocytes from WT (FTO f/f) and AFO mice with vehicle or DAA. Representative Western blot for Angptl4 and m 6 A Northern-Western blot for m 6 A abundance in total RNA (n = 4 mice per genotype). (B) Angptl4 m 6 A abundance analyzed by m 6 A immunoprecipitation and real-time quantitative PCR (n = 3 mice per genotype and treatment). (C) Angptl4 mrna abundance analyzed by real-time quantitative PCR (n = 3

16 mice per genotype and treatment). (D) Quantification of Angptl4 protein abundance by Western blot (n = 3 mice per genotype and treatment). Data represent mean ± s.e.m. *, P < 0.05, AFO compared to WT. NS, not significant, AFO+DAA compared to WT+DAA. Statistical analysis was done using two-sample Mann-Whitney test. Fig. S14. m 6 A pattern in Angptl4 mrna. mrna purified from total RNA was subjected to immunoprecipitation by m 6 A antibody. Immunoprecipitated mrnas were analyzed by RNA sequencing and visualized with an integrative genomics viewer (n = 2 independent experiments).

17 Fig. S15. Polysome profiles and Angpt4 RNA abundance in control and FTO knockdown MCF-7 cell lines. (A) Polysome profiles from control MCF-7 (MCF-7 sh) and FTO knock-down MCF-7 (MCF-7 AS2) cell lines (n = 3 independent experiments). (B) Relative Angptl4 RNA abundance in RNA extracts from polysome fractions of MCF-7 sh and MCF-7 AS2 cell lines (n = 3 independent experiments). Data represent mean ± s.e.m. Yellow-shaded areas indicate polysome fractions.

18 Fig. S16. Serum triglyceride concentrations in wild-type and AFO mice after inguinal fat pad injections of control adenovirus or adenovirus expressing Angptl4. (A) Western blots and (B) relative Angptl4 mrna abundance of inguinal adipose tissues from WT (FTO f/f) and AFO mice 2 weeks after injections of control adenovirus (Ad516) or adenovirus expressing Angptl4 (AdAngptl4) (n = 6 mice per genotype and adenovirus injection). Data represent mean ± s.e.m. (C) Serum triglyceride concentrations of WT and AFO mice fed with chow diet or high-fat diet (HFD) 2 weeks after inguinal fat pad injections of control adenovirus (Ad516) or adenovirus expressing Angptl4 (AdAngptl4) (n = 6 mice per genotype and adenovirus injection). Data represent mean ± s.e.m. NS, not significant. * P < 0.05, AdAngptl4 with HFD compared with Ad516 with HFD. Statistical analysis was done using two-sample Mann-Whitney test.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance ORIGINAL ARTICLE Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance Yoshinaga Kawano, 1 Jun Nakae, 1 Nobuyuki Watanabe, 2 Shiho Fujisaka, 3

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

The Beneficial Effects of n-3 Polyunsaturated Fatty Acids on Diet Induced Obesity and Impaired Glucose Control Do Not Require Gpr120

The Beneficial Effects of n-3 Polyunsaturated Fatty Acids on Diet Induced Obesity and Impaired Glucose Control Do Not Require Gpr120 RESEARCH ARTICLE The Beneficial Effects of n-3 Polyunsaturated Fatty Acids on Diet Induced Obesity and Impaired Glucose Control Do Not Require Gpr120 Mikael Bjursell 1 *, Xiufeng Xu 1, Therése Admyre 1,

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,

More information

Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B

Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B Fawaz G. Haj Associate Professor Diagnosed Obesity and Diabetes for Adults aged 20 years in United States

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Obesity in aging: Hormonal contribution

Obesity in aging: Hormonal contribution Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

Hepatic retinol secretion and storage are altered by dietary CLA: common and distinct actions of CLA c9,t11 and t10,c12 isomers

Hepatic retinol secretion and storage are altered by dietary CLA: common and distinct actions of CLA c9,t11 and t10,c12 isomers Hepatic retinol secretion and storage are altered by dietary CLA: common and distinct actions of CLA c9,t11 and t10,c12 isomers Berenice Ortiz, 1, * Lesley Wassef, 1, * Elena Shabrova, * Lina Cordeddu,

More information

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Research article MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Hajime Kanda, 1 Sanshiro Tateya, 1 Yoshikazu Tamori, 1 Ko Kotani,

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Probe. Hind III Q,!&#12?R'!! /0!!!!D1?R'! vector. Homologous recombination Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!&#1?R'!!

More information

Insulin-induced gene 1 (insig-1) mrna increases dramatically in

Insulin-induced gene 1 (insig-1) mrna increases dramatically in Insig-1 brakes lipogenesis in adipocytes and inhibits differentiation of preadipocytes Jinping Li*, Kiyosumi Takaishi*, William Cook*, Sara Kay McCorkle*, and Roger H. Unger* *Touchstone Center for Diabetes

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Altered food consumption in mice lacking lysophosphatidic acid receptor-1

Altered food consumption in mice lacking lysophosphatidic acid receptor-1 J Physiol Biochem, 65 (4), 000-000, 2009 Altered food consumption in mice lacking lysophosphatidic acid receptor-1 R. Dusaulcy, D. Daviaud, J-P. Pradère, S. Grès, Ph. Valet and J.S. Saulnier-Blache Institut

More information

* This work was supported, in whole or in part, by National Institutes of Health Grants HL076684, HL62984 (to N. L. W.), and ES (to S. H.

* This work was supported, in whole or in part, by National Institutes of Health Grants HL076684, HL62984 (to N. L. W.), and ES (to S. H. THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 31, pp. 27836 27847, August 5, 2011 Printed in the U.S.A. Histone Deacetylase 9 Is a Negative Regulator of Adipogenic Differentiation * S Received for

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures and Figure Legends Supplementary Figure 1 A. HDL-C (mg/dl) 14 12 1 8 6 4 2 Noncarriers HDL Cholesterol **** Carriers B. apoa-i (mg/dl) 325 3 275 25 225 2

More information

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,

More information

Central insulin action regulates peripheral glucose and fat metabolism in mice

Central insulin action regulates peripheral glucose and fat metabolism in mice Research article Central insulin action regulates peripheral glucose and fat metabolism in mice Linda Koch, 1 F. Thomas Wunderlich, 1 Jost Seibler, 2 A. Christine Könner, 1 Brigitte Hampel, 1 Sigrid Irlenbusch,

More information

Cardiovascular Biology of the Leptin/Melanocortin System

Cardiovascular Biology of the Leptin/Melanocortin System Cardiovascular Biology of the Leptin/Melanocortin System Alexandre A. da Silva, Ph.D., FAHA Department of Physiology and Biophysics University of Mississippi Medical Center Jackson, MS p

More information

Brief Critical Review

Brief Critical Review Brief Critical Review May 2007: 251 256 Serum Retinol-Binding Protein: A Link Between Obesity, Insulin Resistance, and Type 2 Diabetes George Wolf, DPhil Insulin resistance occurs under conditions of obesity,

More information

+ + + IP: Anti-Flag. Catalytic domain. Regulatory domain. Myr SH3 SH2 Kinase domain PP2. Flag-HK1. c-src ΔSH3. HK1 N-half: C-half:

+ + + IP: Anti-Flag. Catalytic domain. Regulatory domain. Myr SH3 SH2 Kinase domain PP2. Flag-HK1. c-src ΔSH3. HK1 N-half: C-half: a d h ΔSH2 Δ(SH3SH2) Myr SH3 SH2 Kinase domain 85 5 249 55 5 csrc ΔSH3 FlagHK HAcSrc HAcSrcΔSH2 HAcSrcΔSH3 HAcSrcΔ(SH3SH2) WB: FlagHK HAcSrc HAcSrcKD HAcSrcY529F WB: HisHK2HK2 Input GSTcSrc GST : : GST

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Bachelorarbeit Fructose and weight gain

Bachelorarbeit Fructose and weight gain Bachelorarbeit Fructose and weight gain Bogner-Strauß, Juliane Gertrude, Assoc.Prof. Mag.rer.nat. Dr.rer.nat. Von Johanna Maria Ticar Mat: 0730208 Graz, 27.07.2011 Abstract The prevalence of obesity is

More information

Supplementary Figure 1 Maschalidi et al.

Supplementary Figure 1 Maschalidi et al. a 1% 5% % 1% 5% % OVAb βgal activity A.U. (x1 4 ) 2 1 5 βgal activity A.U. (x1 4 ) 2 1 BSAb 2 hours 4 hours OVAb BSAb OVAb BSAb,1 1 1 1 SIINFEKL (ng/ml) CFSE b Beads Alexa488 (%) 8 6 4 2 ** ** 1:1 5:1

More information

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1

More information

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,

More information

Retinol-binding protein 7 is an endothelium-specific PPARγ cofactor mediating an antioxidant response through adiponectin

Retinol-binding protein 7 is an endothelium-specific PPARγ cofactor mediating an antioxidant response through adiponectin Retinol-binding protein 7 is an endothelium-specific PPARγ cofactor mediating an antioxidant response through adiponectin Chunyan Hu, 1 Henry L. Keen, 1 Ko-Ting Lu, 1 Xuebo Liu, 1 Jing Wu, 1 Deborah R.

More information

Peroxisome proliferator-activated receptor- coactivator 1 (PGC-1 ) regulates triglyceride metabolism by activation of the nuclear receptor FXR

Peroxisome proliferator-activated receptor- coactivator 1 (PGC-1 ) regulates triglyceride metabolism by activation of the nuclear receptor FXR Peroxisome proliferator-activated receptor- coactivator 1 (PGC-1 ) regulates triglyceride metabolism by activation of the nuclear receptor FXR Yanqiao Zhang, 1,2 Lawrence W. Castellani, 2 Christopher J.

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

Supplementary Information for

Supplementary Information for Supplementary Information for Involvement of urinary bladder Connexin43 and the circadian clock in the coordination of diurnal micturition rhythm Hiromitsu Negoro, 1,2 Akihiro Kanematsu, 1,3 Masao Doi,

More information

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,

More information

Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST)

Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST) Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST) No Actual or Potential Conflict of Interest https://www.flickr.com/photos/luchoedu/2453267732/ 1985

More information

Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL5 and GM-CSF

Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL5 and GM-CSF A RT I C L E S Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL and GM-CSF Daniela F. Quail,7, Oakley C. Olson,7, Priya Bhardwaj, Logan A. Walsh, Leila Akkari,,,

More information

Thrombin promotes diet-induced obesity through fibrin-driven inflammation

Thrombin promotes diet-induced obesity through fibrin-driven inflammation Thrombin promotes diet-induced obesity through fibrin-driven inflammation Anna K. Kopec, 1 Sara R. Abrahams, 2 Sherry Thornton, 3 Joseph S. Palumbo, 4 Eric S. Mullins, 4 Senad Divanovic, 5 Hartmut Weiler,

More information

Resistin expression in adipose tissues and its effect on glucose metabolism in rats with brain injury

Resistin expression in adipose tissues and its effect on glucose metabolism in rats with brain injury Resistin expression in adipose tissues and its effect on glucose metabolism in rats with brain injury R. Zhang 1, Z.Y. Wang 1, L.L. Zhu 1, F. Wu 1, D.Q. Chen 1, L.F. Sun 1 and Z.Q. Lu 2 1 Department of

More information

SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression

SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression Received 1 Feb 215 Accepted 15 Oct 215 Published 24 Nov 215 DOI: 1.138/ncomms9917 SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression Lan Shao

More information

Dietary Exposure to the Endocrine Disruptor Tolylfluanid Promotes Global Metabolic Dysfunction in Male Mice

Dietary Exposure to the Endocrine Disruptor Tolylfluanid Promotes Global Metabolic Dysfunction in Male Mice ENDOCRINE-DISRUPTING CHEMICALS Dietary Exposure to the Endocrine Disruptor Tolylfluanid Promotes Global Metabolic Dysfunction in Male Mice Shane M. Regnier, Andrew G. Kirkley, Honggang Ye, Essam El-Hashani,

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

gene expression and are protected against high fat-induced obesity

gene expression and are protected against high fat-induced obesity mice lacking p47 phox have altered adipose tissue gene expression and are protected against high fat-induced obesity Martin J. J. Ronis, Neha Sharma, Jamie Vantrease, Sarah J. Borengasser, Matthew Ferguson,

More information

Hepatic CB 1 receptor is required for development of diet-induced steatosis, dyslipidemia, and insulin and leptin resistance in mice

Hepatic CB 1 receptor is required for development of diet-induced steatosis, dyslipidemia, and insulin and leptin resistance in mice Research article Hepatic CB 1 receptor is required for development of diet-induced steatosis, dyslipidemia, and insulin and leptin resistance in mice Douglas Osei-Hyiaman, 1 Jie Liu, 1 Liang Zhou, 1 Grzegorz

More information

Adipose tissue dysfunction in obesity. Gijs Goossens, PhD

Adipose tissue dysfunction in obesity. Gijs Goossens, PhD Adipose tissue dysfunction in obesity -The role of adipose tissue oxygenation - Gijs Goossens, PhD NUTRIM School of Nutrition and Translational Research in Metabolism Maastricht University Medical Centre

More information

Title: Receptor Activator of Nuclear Factor-κB (RANKL) and Risk of Type 2 Diabetes Mellitus

Title: Receptor Activator of Nuclear Factor-κB (RANKL) and Risk of Type 2 Diabetes Mellitus 1 Title: Receptor Activator of Nuclear Factor-κB (RANKL) and Risk of Type 2 Diabetes Mellitus Authors: Stefan Kiechl, Jürgen Wittmann, Andrea Giaccari, Michael Knoflach, Peter Willeit, Aline Bozec, Alexander

More information

Significance: Present studies provide a novel mechanism for targeted therapy of obesity and MetS.

Significance: Present studies provide a novel mechanism for targeted therapy of obesity and MetS. THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 288, NO. 32, pp. 23394 23406, August 9, 2013 2013 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. RLIP76 Protein Knockdown

More information

AMPD1 regulates mtorc1-p70 S6 kinase axis in the control of insulin sensitivity in skeletal muscle

AMPD1 regulates mtorc1-p70 S6 kinase axis in the control of insulin sensitivity in skeletal muscle Tandelilin et al. BMC Endocrine Disorders (2015)15:1 DOI 10.1186/s12902-015-0010-9 RESEARCH ARTICLE Open Access AMPD1 regulates mtorc1-p70 S6 kinase axis in the control of insulin sensitivity in skeletal

More information

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona.

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene therapy: State of the art Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene Therapy: First Steps Type 1 diabetes: An islet disease Alpha cell Beta cell Pancreatic

More information

ab Adipogenesis Assay Kit (Cell-Based)

ab Adipogenesis Assay Kit (Cell-Based) ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended

More information

Table S1. Total and mapped reads produced for each ChIP-seq sample

Table S1. Total and mapped reads produced for each ChIP-seq sample Tale S1. Total and mapped reads produced for each ChIP-seq sample Sample Total Reads Mapped Reads Col- H3K27me3 rep1 125662 1334323 (85.76%) Col- H3K27me3 rep2 9176437 7986731 (87.4%) atmi1a//c H3K27m3

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

AMDCC Progress Report Duke/UNC/Stanford Unit. Program Director Thomas M. Coffman, MD

AMDCC Progress Report Duke/UNC/Stanford Unit. Program Director Thomas M. Coffman, MD AMDCC Progress Report Duke/UNC/Stanford Unit Program Director Thomas M. Coffman, MD Susceptibility Mutation Model Development + ApoE-/- +STZ Kidney Phenotype Screen Vascular & Kidney Phenotype Screen Generate

More information

The critical role of atypical protein kinase C in activating hepatic SREBP-1c and NFkB in obesity

The critical role of atypical protein kinase C in activating hepatic SREBP-1c and NFkB in obesity The critical role of atypical protein kinase C in activating hepatic SREBP-1c and NFkB in obesity Mini P. Sajan,*, ** Mary L. Standaert,* Sonali Nimal, Usha Varanasi, Tina Pastoor, Stephen Mastorides,*

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Thioesterase-mediated control of cellular calcium homeostasis enables hepatic ER stress

Thioesterase-mediated control of cellular calcium homeostasis enables hepatic ER stress Thioesterase-mediated control of cellular calcium homeostasis enables hepatic ER stress Baran A. Ersoy, Kristal M. Maner-Smith, Yingxia Li, Ipek Alpertunga, and David E. Cohen Department of Medicine, Division

More information

8 th NUGO week Wageningen. #nugo. Michael Müller Conclusions What is health?

8 th NUGO week Wageningen. #nugo. Michael Müller Conclusions What is health? 8 th NUGO week Wageningen #nugo Michael Müller Conclusions What is health? 1 1 You are what you eat What's healthy? 4 4 What is health? WHO 1946:..a state of complete physical, mental, and social well-being

More information

Structural vs. nonstructural proteins

Structural vs. nonstructural proteins Why would you want to study proteins associated with viruses or virus infection? Receptors Mechanism of uncoating How is gene expression carried out, exclusively by viral enzymes? Gene expression phases?

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Molecular Medicine. Brown adipose tissue responds to cold and adrenergic

Molecular Medicine. Brown adipose tissue responds to cold and adrenergic Brown adipose tissue responds to cold and adrenergic stimulation by induction of FGF21 Dionysios V. Chartoumpekis, 1, Ioannis G. Habeos, 1, Panos G. Ziros, 1 Agathoklis I. Psyrogiannis, 1 Venetsana E.

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

BREAST MILK COMPONENTS AND POTENTIAL INFLUENCE ON GROWTH

BREAST MILK COMPONENTS AND POTENTIAL INFLUENCE ON GROWTH Note: for non-commercial purposes only CAMPUS GROSSHADERN CAMPUS INNENSTADT BREAST MILK COMPONENTS AND POTENTIAL INFLUENCE ON GROWTH Maria Grunewald, Hans Demmelmair, Berthold Koletzko AGENDA Breast Milk

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

Switzerland; Medicine, University of Lausanne Medical School, 1011 Lausanne, Switzerland

Switzerland; Medicine, University of Lausanne Medical School, 1011 Lausanne, Switzerland Dietary obesity-associated Hif1a activation in adipocytes restricts fatty acid oxidation and energy expenditure via suppression of the Sirt2-NAD + system Jaya Krishnan, 1,2 Carsten Danzer, 1,2 Tatiana

More information

Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice

Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Research article Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Seongah Han, Chien-Ping Liang, Marit Westerterp, Takafumi Senokuchi, Carrie L. Welch, Qizhi Wang, Michihiro

More information

FAPESP Week /21/2017

FAPESP Week /21/2017 Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr

More information

Desnutrin/ATGL Activates PPARd to Promote Mitochondrial Function for Insulin Secretion in Islet b Cells

Desnutrin/ATGL Activates PPARd to Promote Mitochondrial Function for Insulin Secretion in Islet b Cells Article Desnutrin/ATGL Activates PPARd to Promote Mitochondrial Function for Insulin Secretion in Islet b Cells Tianyi Tang,,3 Marcia J. Abbott,,3 Maryam Ahmadian,,5 Andressa B. Lopes,,4 Yuhui Wang, and

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance Cell Metabolism, Volume 25 Supplemental Information b Cell Aging Markers Have Heterogeneous Distribution and Are Induced by Insulin Resistance Cristina Aguayo-Mazzucato, Mark van Haaren, Magdalena Mruk,

More information

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,

More information

NIH Public Access Author Manuscript Biochem Biophys Res Commun. Author manuscript; available in PMC 2015 August 29.

NIH Public Access Author Manuscript Biochem Biophys Res Commun. Author manuscript; available in PMC 2015 August 29. NIH Public Access Author Manuscript Published in final edited form as: Biochem Biophys Res Commun. 2014 August 29; 451(3): 374 381. doi:10.1016/j.bbrc.2014.07.106. High fat diet rescues disturbances to

More information

Successful completion of Phase I clinical trial of AMPK activator O304

Successful completion of Phase I clinical trial of AMPK activator O304 Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination

More information

ExoQuick PLUS Exosome Purification Kit for Serum & Plasma

ExoQuick PLUS Exosome Purification Kit for Serum & Plasma ExoQuick PLUS Exosome Purification Kit for Serum & Plasma Cat# EQPL10A-1 User Manual Store kit at +4 0 C Version 2 2/22/2017 A limited-use label license covers this product. By use of this product, you

More information

Hypothalamic IKKb/NF-kBandER Stress Link Overnutrition to Energy Imbalance and Obesity

Hypothalamic IKKb/NF-kBandER Stress Link Overnutrition to Energy Imbalance and Obesity Hypothalamic IKKb/NF-kBandER Stress Link Overnutrition to Energy Imbalance and Obesity Xiaoqing Zhang, 1,4 Guo Zhang, 1,4 Hai Zhang, 1,2,4 Michael Karin, 3 Hua Bai, 1 and Dongsheng Cai 1, * 1 Department

More information

Interactions of exercise and diet in health prevention

Interactions of exercise and diet in health prevention Interactions of exercise and diet in health prevention Dr Jason Gill Institute of Cardiovascular and Medical Sciences University of Glasgow Physical activity and health outcomes does one size fit all?

More information

Islets of Langerhans consist mostly of insulin-producing β cells. They will appear to be densely labeled

Islets of Langerhans consist mostly of insulin-producing β cells. They will appear to be densely labeled Are adult pancreatic beta cells formed by self-duplication or stem cell differentiation? Introduction Researchers have long been interested in how tissues produce and maintain the correct number of cells

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Summary and concluding remarks

Summary and concluding remarks Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated

More information

METABOLISMO E VITAMINA D

METABOLISMO E VITAMINA D CONVEGNO NAZIONALE GIBIS ROMA 14-15 MAGGIO 2015 METABOLISMO E VITAMINA D Alfredo Scillitani UO Endocrinologia Ospedale Casa Sollievo della Sofferenza Holick MF, NEJM 2007 Sindrome Metabolica E un cluster

More information

c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis

c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis Research article c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis Shenghao Jin, Huiwu Zhao, Yan Yi, Yuji Nakata, Anna Kalota, and Alan M.

More information

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments

More information

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,

More information

MANGO MODULATES BODY FAT AND PLASMA GLUCOSE AND LIPIDS IN MICE FED HIGH FAT DIET WENJIA LI. Bachelor of Science in Biological Science

MANGO MODULATES BODY FAT AND PLASMA GLUCOSE AND LIPIDS IN MICE FED HIGH FAT DIET WENJIA LI. Bachelor of Science in Biological Science MANGO MODULATES BODY FAT AND PLASMA GLUCOSE AND LIPIDS IN MICE FED HIGH FAT DIET By WENJIA LI Bachelor of Science in Biological Science University of Guelph Guelph, Ontario 2006 Submitted to the Faculty

More information

Supplementary Information

Supplementary Information Supplementary Information Metabolomics reveals trichloroacetate as a major contributor to trichloroethylene-induced metabolic alterations in mouse urine and serum Zhong-Ze Fang, Kristopher W Krausz, Naoki

More information