SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)"

Transcription

1 SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of diet (day ) and at termination ( months) for both CD-fed and HFD-fed mice. (B) Blood glucose concentration was measured at the beginning of diet (day ) and at the termination ( months) for both CD-fed and HFD-fed mice. (C) Intra-peritoneal glucose tolerance test (ipgtt) was performed at 7 weeks of diet from both CD-fed and HFD-fed mice. Time course measurement of blood glucose concentration was performed following an intra-peritoneal injection of glucose ( g/kg) after 6h of fasting. (D) Iulin tolerance test (ITT) was performed at 7 weeks of diet on both CD-fed and HFD-fed mice. Time course measurement of blood glucose concentration was performed following an intra-peritoneal injection of iulin (.7 IU/kg) after 6h of fasting. Results are plotted as whiskers box (whiskers: minimum to maximum values). p <., p <.. Supplemental Figure. Cell-sorting from SVF from ob/ob mice ewat by FACS. Cells were stained using appropriated antibodies (see Material and Methods) then sorted by FACS. Gating was performed according to the antibody signal inteity for endothelial cells (CD- /CD+, orange), preadipocytes/amscs (CD-/CD-, pink) and macrophages (F/8+, blue). For lymphocytes, gating was performed according both cell size/structure and CD+ signal inteity (green). Results are displayed as coloured isolated cell-type according to gating from signal inteity or size/structure. Supplemental Figure. Expression of markers of adipocytes and preadipocytes/amscs from ob/ob mice ewat. Expression of adipocyte markers (Adiponectin, PPARg and Fabp) and preadipocyte/amsc markers (CD and Sca-) was monitored by qpcr in both

2 adipocyte fraction from ewat from ob/ob mice and preadipocyte/amsc sorted from SVF from ewat from ob/ob mice. Results for (A) Adiponectin, (B) PPARγ and (C) Fabp are displayed as expression relatively to preadipocytes/amscs. Results of expression of (D) CD and (E) Sca- are displayed as fold expression compared to adipocytes. p <., p <.. Supplemental Figure. Expression of markers of macrophages, lymphocytes, haematopoietic cells and endothelial cells from SVF from ob/ob mice ewat. Expression levels of macrophage marker (F/8), lymphocyte marker (CDe), haematopoietic cell marker (CD) and endothelial cell marker (CD) were quantified by qpcr in preadipocytes/amscs (dark blue), endothelial cells (red), macrophages (light blue), lymphocytes (green) sorted from SVF of ob/ob mice ewat. Results for (A) F/8, (B) CDe, (C) CD and (D) CD are displayed as fold-expression compared to non-fractionated SVF. p <., p <.. Supplemental Figure. Cell-sorting from SVF from both CD-fed and HFD-fed mice ewat by FACS. (A) Body weight was measured at the beginning of diet (day ) and at the termination ( months) from both CD-fed and HFD-fed mice. p <. (B) Dendogram depicting the preadipocytes SVF-sorting strategy. (C) Gating strategy for preadipocyte sorting and isolation from ewat from both CD-fed and HFD-fed mice. Preadipocytes were identified as CD - CD - Sca- + CD9 + CD + CD - cells. Supplemental Figure 6. Expression of identified mirna in preadipocytes sorted from SVF from CD-fed and HFD-fed mice ewat. Expression levels of (A) mir-a, (B) mir- b, (C) mir--p, (D) mir--p and (E) mir--p were quantified by qpcr in preadipocytes isolated from SVF from CD-fed and HFD-fed mice ewat. Results are

3 displayed as expression of each mirna in preadipocytes from HFD-fed mice ewat relative to that in preadipocytes from CD-fed mice ewat. n indicates the number of mice used for each experiment. p <.. Supplemental Figure 7. Expression level of mir-a and mir-b in subcutaneous WAT of lean, normoglycemic, glucose intolerant and diabetic patients. Expression level of (A) mir-a and (B) mir-b was quantified by qpcr in the subcutaneous WAT of lean, normoglycemic, glucose intolerant and diabetic patients. Results are displayed as the expression of each mirna in tissue from obese patients relative to that in control lean patients. Results are plotted as whiskers box (whiskers: minimum to maximum values). Supplemental Figure 8. Expression level of VTmR related to each identified mirna in endothelial cells, macrophages and lymphocytes from SVF from ob/ob mice ewat. Deregulated VTmRs related to mir-a (Flt, Gata6, Vcam, Zeb and Zfpm), mir-b (Flt, Ptpn, Zeb and Zfpm), mir--p (Bmp7 and Dnmt) and mir--p (Lrg, Mapk, Rasa and Tnc) in non-fractionated ewat were selected for subsequent expression level analysis in the distinct cell subtypes sorted from SVF from ob/ob mice ewat. Results are displayed as expression of each VTmR in endothelial cells, macrophages and lymphocytes relatively to preadipocytes/amscs from SVF from ob/ob mice ewat. Supplemental Figure 9. Expression of selected VTmRs in preadipocytes sorted from SVF from CD-fed and HFD-fed mice ewat. Expression levels of (A) Flt, (B) Vcam and (C) Bmp7 were quantified by qpcr in preadipocytes isolated from SVF from CD-fed and HFD-fed mice ewat. Results are displayed as expression of each gene in preadipocytes from HFD-fed mice ewat relative to that in preadipocytes from CD-fed mice ewat. n indicates the number of mice used for each experiment. p <..

4 A Oger F. et al., Figure SI Body weight (g) Day months Day months chow diet high fat diet Blood glucose (mg/dl) Day months Day months chow diet high fat diet 8 ipgtt Blood glucose (mg/dl) 6 high fat diet chow diet 6 9 Time (min) ITT Blood glucose (mg/dl) high fat diet chow diet 6 9 Time (min)

5 Oger F. et al., Figure SI

6 A. F/8 Oger F. et al., Figure SI.. SVF preadipocytes /AMSCs endothelial cells macrophages lymphocytes CDe SVF preadipocytes /AMSCs endothelial cells macrophages lymphocytes. CD.. SVF preadipocytes /AMSCs endothelial cells macrophages lymphocytes CD SVF preadipocytes /AMSCs endothelial cells macrophages lymphocytes

7 Oger F. et al., Figure SI A CD B Sca Adipocytes Preadipocytes/AMSCs Adipocytes Preadipocytes/AMSCs Adiponectin D Pparγ Preadipocytes/AMSCs Adipocytes Preadipocytes/AMSCs Adipocytes Fabp Preadipocytes/AMSCs Adipocytes

8 Oger F. et al., Figure SI A 8 B ewat SVF Adipocytes Body weight (g) 6 p=.68 CD- CD+ Sca-- Sca-+ Day months Day months chow diet high fat diet CD+ CD- CD9- CD9+ CD- CD+ mirna expression gene expression Preadipocytes sorted from HFD-fed mice Preadipocytes sorted from CD-fed mice

9 Oger F. et al., Figure SI6 A mir-a B mir-b. p=.7... CD HFD CD HFD n= n= n= n= mir--p D mir--p.. CD HFD CD HFD n= n= n= n= mir--p.. CD HFD n= n=

10 obese patients Oger F. et al., Figure SI7 diabetic obese patients A mir-a B mir-b control normoglycemic glucose intolerant diabetic control normoglycemic glucose intolerant

11 Flt Vcam Oger F. et al., Figure SI8 Zfpm Ptpn Bmp7 Dnmt Tnc Mapk Rasa Lrg 8 Gata6 Zeb 6 6

12 Oger F. et al., Figure SI9 A Vcam.. CD HFD n= n= Bmp7.. CD HFD n= n=

13 Primer sequences ( ) Genes Genebank accession number ACTGTCAAGCTAGAGGTGTCC Flt NM_8 ACCTATAGACACCCTCATCCTC GTGCCTCGACCACTTGCTAT Gata6 NM_8 ACAGAGCCACTGCTGTTACC AACCGAATCCCCAACTTGTGCAG Vcam NM_69 TCTCCAGCTTCTCTCAGGAAATGCC GCATGTGACCTGTGTGACAA Zeb NM_6 CACACTCGTGAGGCCTCTTA AATGCACCAAGAGCTTTTCC Zfpm NM_766 GGGCAGGAACTCTTCCATTT CACAATGGGGAGGACAACTT Ptpn NM_ CCAGTGGCTGTGGGATAAAT AGCGATTTGACAACGAGACC Bmp7 NM_77 GCTGTCCAGCAAGAAGAGGT CCTAGTTCCGTGGCTACGAGGAGAA Dnmt NM_99 TCTCTCTCCTCTGCAGCCGACTCA AGTGGGAGCTTCCAGGAACA Tnc NM_67 TGGTGTCCAGACGACCTTCTG CACGTTGGTACAGAGCTCCA Mapk NM_99 TGTGATTCAGCTGGTCAAGG TGTCCATGACAGTCTCTTCG Rasa NM_ GGAGTTTCTCCTGCAAAGTAAAA AGAATTCCACCGACAGATGG Lrg NM_9796 GCCTCAAGGAATGCCTGATA CATGCTCAACATCTCCCCCTTCTCC Rplp (6B) NM_ GGGAAGGTGTAATCCGTCTCCACAG GTGCAGAAAGAGCTCAGGGAC Sca- NM_76 TCCATCAGGGTAGGGGCAGG TAAGACCACACCAGCCATCTC CD NM_6 TGGAGTTCCAGAGCCTGAAG CCGTGATGGAAGACCACTCG Pparγ NM_6 AGGCCTGTTGTAGAGCTGGGT C GTGATGCCTTTGTGGGAACCTGG Fabp NM_6 TGTGGCAAAGCCCACTCCCACT GTGATGGCAGAGATGGCACT Adipoq (Adiponectin) NM_96 GCTTCTCCAGGCTCTCCTTT CTTTGGCTATGGGCTTCCAGTC F/8 NM_ GCAAGGAGGACAGAGTTTATCGTG

14 CTGCTACACACCAGCCTCAA CAGGTCCACCTCCACACAGT AGGCGACAGAGGTGTCTGAT TTTCTCCAAACTGATTGTATTCCA CACCTGCAAAGTGGAATCAA TCTAACTTCGGCTTGGGAAA CDe CD CD NM_768 NM_ NM_886 Supplemental Table. Primers used for qpcr.

15 MATERIALS AND METHODS SUPPLEMENTAL INFORMATION Intraperitoneal glucose tolerance test (ipgtt) and iulin tolerance test (ITT). For glucose and iulin tolerance tests, g/kg glucose or.7 IU/kg iulin (Actrapid; Novo Nordisk), respectively, was injected intraperitoneally after a 6-h fast and blood glucose was measured (Accu-Check; Roche Diagnostics) at indicated time points. Preparation of stromal vascular fraction cells and isolation of preadipocytes. Epididymal adipose tissue was cut into small pieces and digested at 7 C for min with collagenase type I (Sigma) followed by centrifugation at g for min. Cell pellets were suspended in ice-cold x PBS and filtered through a 7 µm-sieve, and the SVF fraction was collected by centrifugation at g for min. Cells were stained with rat antibody agait CD (clone -F, BD Biosciences), CD (clone 9, BioLegend), Sca- (clone D7, ebioscience), CD (clone HM, BioLegend), CD (clone M/69, BD Biosciences) and CD9 (clone HMB-, BioLegend). Preadipocytes were identified as CD - CD - Sca- + CD9 + CD + CD - cells () and sorted using the FACSAria (BD Bioscience) cell sorter, or analysed using the LSRII Fortessa (BD Bioscience) and FlowJo software (Tree Star Inc). The purity of isolated preadipocytes was > 9% after cell sorting.. Berry R, Rodeheffer MS. Characterization of the adipocyte cellular lineage in vivo. Nat Cell Biol ;():-8.

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Research article MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Hajime Kanda, 1 Sanshiro Tateya, 1 Yoshikazu Tamori, 1 Ko Kotani,

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Adipocyte Dynamics and Reversible Metabolic Syndrome in Mice with an Inducible Adipocyte- Specific Deletion of the Insulin Receptor

Adipocyte Dynamics and Reversible Metabolic Syndrome in Mice with an Inducible Adipocyte- Specific Deletion of the Insulin Receptor Article Adipocyte Dynamics and Reversible Metabolic Syndrome in Mice with an Inducible Adipocyte- Specific Deletion of the Insulin Receptor Graphical Abstract Authors Masaji Sakaguchi, Shiho Fujisaka,

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

Thrombin promotes diet-induced obesity through fibrin-driven inflammation

Thrombin promotes diet-induced obesity through fibrin-driven inflammation Thrombin promotes diet-induced obesity through fibrin-driven inflammation Anna K. Kopec, 1 Sara R. Abrahams, 2 Sherry Thornton, 3 Joseph S. Palumbo, 4 Eric S. Mullins, 4 Senad Divanovic, 5 Hartmut Weiler,

More information

AMPK Activation by Metformin Suppresses Abnormal Extracellular Matrix Remodeling in Adipose Tissue and Ameliorates Insulin Resistance in Obesity

AMPK Activation by Metformin Suppresses Abnormal Extracellular Matrix Remodeling in Adipose Tissue and Ameliorates Insulin Resistance in Obesity Diabetes Volume 65, August 2016 2295 Ting Luo, 1,2 Allison Nocon, 1 Jessica Fry, 1 Alex Sherban, 1 Xianliang Rui, 1 Bingbing Jiang, 1 X. Julia Xu, 1 Jingyan Han, 1 Yun Yan, 3 Qin Yang, 4 Qifu Li, 2 and

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

ab Adipogenesis Assay Kit (Cell-Based)

ab Adipogenesis Assay Kit (Cell-Based) ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance ORIGINAL ARTICLE Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance Yoshinaga Kawano, 1 Jun Nakae, 1 Nobuyuki Watanabe, 2 Shiho Fujisaka, 3

More information

Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B

Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B Fawaz G. Haj Associate Professor Diagnosed Obesity and Diabetes for Adults aged 20 years in United States

More information

Gladstone Institute of Cardiovascular Disease, San Francisco, California. 2 Diabetes Center, 3 Cardiovascular Research Institute, and 4

Gladstone Institute of Cardiovascular Disease, San Francisco, California. 2 Diabetes Center, 3 Cardiovascular Research Institute, and 4 Suneil K. Koliwad, 1,2,3,4 Ryan S. Streeper, 1 Mara Monetti, 1 Ivo Cornelissen, 3 Liana Chan, 1 Koji Terayama, 5 Stephen Naylor, 6 Meghana Rao, 1 Brian Hubbard, 7 and Robert V. Farese Jr. 1,2,3,4,8 1 Gladstone

More information

Stem Cell Reports Ar ticle

Stem Cell Reports Ar ticle Stem Cell Reports Ar ticle Treating Diet-Induced Diabetes and Obesity with Human Embryonic Stem Cell-Derived Pancreatic Progenitor Cells and Antidiabetic Drugs Jennifer E. Bruin, 1 Nelly Saber, 1 Natalie

More information

Supplemental Information. The Therapeutic Effect. of Anti-HER2/neu Antibody Depends. on Both Innate and Adaptive Immunity CONTENTS:

Supplemental Information. The Therapeutic Effect. of Anti-HER2/neu Antibody Depends. on Both Innate and Adaptive Immunity CONTENTS: Cancer Cell, Volume 18 Supplemental Information The Therapeutic Effect of Anti-HER2/neu Antibody Depends on Both Innate and Adaptive Immunity SaeGwang Park, Zhujun Jiang, Eric D. Mortenson, Liufu Deng,

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung Transplant Function via Depletion of Donor Dendritic Cells Wolfgang Jungraithmayr, Laura Codarri, Gregory Bouchaud,Carsten Krieg,

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

Obesity reversibly depletes the basal cell population and enhances mammary epithelial cell estrogen receptor alpha expression and progenitor activity

Obesity reversibly depletes the basal cell population and enhances mammary epithelial cell estrogen receptor alpha expression and progenitor activity Chamberlin et al. Breast Cancer Research (2017) 19:128 DOI 10.1186/s13058-017-0921-7 RESEARCH ARTICLE Open Access Obesity reversibly depletes the basal cell population and enhances mammary epithelial cell

More information

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/3/11/eaaq0723/dc1 Supplementary Materials for Synthetic smart gel provides glucose-responsive insulin delivery in diabetic mice Akira Matsumoto, Miyako Tanaka,

More information

Adipose tissue plasticity: how fat depots respond differently to pathophysiological cues

Adipose tissue plasticity: how fat depots respond differently to pathophysiological cues Diabetologia (2016) 59:1075 1088 DOI 10.1007/s00125-016-3933-4 REVIEW Adipose tissue plasticity: how fat depots respond differently to pathophysiological cues Vanessa Pellegrinelli 1 & Stefania Carobbio

More information

Endothelial PDGF-CC regulates angiogenesisdependent thermogenesis in beige fat

Endothelial PDGF-CC regulates angiogenesisdependent thermogenesis in beige fat ARTIE Received Apr 6 Accepted 6 Jun 6 Published 5 Aug 6 DOI:.8/ncomms5 OPEN Endothelial PDGF-CC regulates angiogenesisdependent thermogenesis in beige fat Takahiro Seki, Kayoko Hosaka, Sharon Lim, Carina

More information

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance Cell Metabolism, Volume 25 Supplemental Information b Cell Aging Markers Have Heterogeneous Distribution and Are Induced by Insulin Resistance Cristina Aguayo-Mazzucato, Mark van Haaren, Magdalena Mruk,

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

Transgenic Increase in N-3/N-6 Fatty Acid Ratio Reduces Maternal Obesity-Associated Inflammation and Limits Adverse Developmental Programming in Mice

Transgenic Increase in N-3/N-6 Fatty Acid Ratio Reduces Maternal Obesity-Associated Inflammation and Limits Adverse Developmental Programming in Mice Transgenic Increase in N-3/N-6 Fatty Acid Ratio Reduces Maternal Obesity-Associated Inflammation and Limits Adverse Developmental Programming in Mice Margaret J. R. Heerwagen 1, Michael S. Stewart 1, Becky

More information

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

Human Leptin ELISA Kit

Human Leptin ELISA Kit Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone

More information

Immune Cells in Regional Adipose Tissue Depots: A Pilot Study. Vi Dam. A Thesis. The Department. Exercise Science

Immune Cells in Regional Adipose Tissue Depots: A Pilot Study. Vi Dam. A Thesis. The Department. Exercise Science Effect of Early onset Obesity versus Late onset Obesity on Immune Cells in Regional Adipose Tissue Depots: A Pilot Study Vi Dam A Thesis in The Department of Exercise Science Presented in Partial Fulfillment

More information

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment

More information

Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans

Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans Emilie Viennois 1*, Yuan Zhao 1, 2, Moon Kwon Han 1, Bo Xiao 1, 3, Mingzhen Zhang 1,

More information

Body Mass Index Chart = overweight; = obese; >40= extreme obesity

Body Mass Index Chart = overweight; = obese; >40= extreme obesity Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 25 February 2008 Body Mass Index Chart 25-29.9 = overweight; 30-39.9= obese; >40= extreme obesity 5'0" 5'2" Weight (lbs)

More information

Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis

Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis Article Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis Kiana Mahdaviani 1,2, Ilan Y Benador 1,2, Shi Su 1, Raffi A Gharakhanian 1, Linsey Stiles 1,2, Kyle

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

FAPESP Week /21/2017

FAPESP Week /21/2017 Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr

More information

Weighing in on Adipocyte Precursors

Weighing in on Adipocyte Precursors Weighing in on Adipocyte Precursors Ryan Berry, 1 Elise Jeffery, 2 and Matthew S. Rodeheffer 1,3,4, * 1 Department of Molecular, Cell and Developmental Biology, Yale University School of Medicine, New

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Adipocyte Function. and associated comorbidities Adipose tissue development. Isabel Wagner

Adipocyte Function. and associated comorbidities Adipose tissue development. Isabel Wagner Adipocyte Function Obesity during childhood and adolescents and associated comorbidities Adipose tissue development D. Rockstroh, K. Dittrich, K. Landgraf, R. Tauscher, J. Gesing, M. Neef, M. Wojan, H.Till,

More information

The Annexin V Apoptosis Assay

The Annexin V Apoptosis Assay The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.

More information

Obesity is associated with macrophage accumulation in adipose tissue

Obesity is associated with macrophage accumulation in adipose tissue Obesity is associated with macrophage accumulation in adipose tissue See the related Commentary beginning on page 1785. Stuart P. Weisberg, 1 Daniel McCann, 1 Manisha Desai, 2 Michael Rosenbaum, 1 Rudolph

More information

Visceral and subcutaneous fat have different origins and evidence supports a mesothelial source

Visceral and subcutaneous fat have different origins and evidence supports a mesothelial source Europe PMC Funders Group Author Manuscript Published in final edited form as: Nat Cell Biol. 2014 April ; 16(4): 367 375. doi:10.1038/ncb2922. Visceral and subcutaneous fat have different origins and evidence

More information

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,

More information

SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression

SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression Received 1 Feb 215 Accepted 15 Oct 215 Published 24 Nov 215 DOI: 1.138/ncomms9917 SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression Lan Shao

More information

* This work was supported, in whole or in part, by National Institutes of Health Grants HL076684, HL62984 (to N. L. W.), and ES (to S. H.

* This work was supported, in whole or in part, by National Institutes of Health Grants HL076684, HL62984 (to N. L. W.), and ES (to S. H. THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 31, pp. 27836 27847, August 5, 2011 Printed in the U.S.A. Histone Deacetylase 9 Is a Negative Regulator of Adipogenic Differentiation * S Received for

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

Metabolic Disease drug discovery at Evotec

Metabolic Disease drug discovery at Evotec Metabolic Disease drug discovery at Evotec Evotec, Metabolic Disease Drug Discovery, 2016 Evotec, an ideal partner in metabolic disease drug discovery The different ways to work with us On your specific

More information

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,

More information

SUPPLEMENTAY FIGURES AND TABLES

SUPPLEMENTAY FIGURES AND TABLES SUPPLEMENTAY FIGURES AND TABLES Supplementary Figure S1: Validation of mir expression by quantitative real-time PCR and time course studies on mir- 29a-3p and mir-210-3p. A. The graphs illustrate the expression

More information

Successful completion of Phase I clinical trial of AMPK activator O304

Successful completion of Phase I clinical trial of AMPK activator O304 Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination

More information

Retinol-binding protein 7 is an endothelium-specific PPARγ cofactor mediating an antioxidant response through adiponectin

Retinol-binding protein 7 is an endothelium-specific PPARγ cofactor mediating an antioxidant response through adiponectin Retinol-binding protein 7 is an endothelium-specific PPARγ cofactor mediating an antioxidant response through adiponectin Chunyan Hu, 1 Henry L. Keen, 1 Ko-Ting Lu, 1 Xuebo Liu, 1 Jing Wu, 1 Deborah R.

More information

Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST)

Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST) Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST) No Actual or Potential Conflict of Interest https://www.flickr.com/photos/luchoedu/2453267732/ 1985

More information

Obesity Modulates microrna Expression. in the Visceral Adipose of Humans and Mice. Honors Thesis Research

Obesity Modulates microrna Expression. in the Visceral Adipose of Humans and Mice. Honors Thesis Research Obesity Modulates microrna Expression in the Visceral Adipose of Humans and Mice Honors Thesis Research Presented in Partial Fulfillment of the Requirements for graduation with Honors Research Distinction

More information

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements.

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

Supplementary Figure 1. Effects of EDTA and ACD anticoagulants on blood storage. (a) EDTA

Supplementary Figure 1. Effects of EDTA and ACD anticoagulants on blood storage. (a) EDTA Supplementary Figure 1. Effects of EDTA and ACD anticoagulants on blood storage. (a) EDTA vacutainers (4.9 mm EDTA in 10 ml of blood) induce hemolysis after overnight storage in room temperature. (b) Viability

More information

Limited OXPHOS capacity in white adipocytes is a hallmark of obesity in laboratory mice irrespective of the glucose tolerance status

Limited OXPHOS capacity in white adipocytes is a hallmark of obesity in laboratory mice irrespective of the glucose tolerance status Limited OXPHOS capacity in white adipocytes is a hallmark of obesity in laboratory mice irrespective of the glucose tolerance status Theresa Schöttl, Lisa Kappler, Tobias Fromme, Martin Klingenspor * ABSTRACT

More information

Review Article Novel Browning Agents, Mechanisms, and Therapeutic Potentials of Brown Adipose Tissue

Review Article Novel Browning Agents, Mechanisms, and Therapeutic Potentials of Brown Adipose Tissue BioMed Research International Volume 2016, Article ID 2365609, 15 pages http://dx.doi.org/10.1155/2016/2365609 Review Article Novel Browning Agents, Mechanisms, and Therapeutic Potentials of Brown Adipose

More information

Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL5 and GM-CSF

Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL5 and GM-CSF A RT I C L E S Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL and GM-CSF Daniela F. Quail,7, Oakley C. Olson,7, Priya Bhardwaj, Logan A. Walsh, Leila Akkari,,,

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

Supplemental Information. Human CD1c + Dendritic Cells Drive. the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF-

Supplemental Information. Human CD1c + Dendritic Cells Drive. the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF- Immunity, Volume 38 Supplemental Information Human CD1c + Dendritic Cells Drive the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF- Chun I. Yu Christian Becker Yuanyuan

More information

Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3

Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3 Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. Supplementary Tale i: Primers used for RT-PCR. References are provided under Source, except for primers

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Rosiglitazone promotes development of a novel adipocyte population from bone marrow derived circulating progenitor cells

Rosiglitazone promotes development of a novel adipocyte population from bone marrow derived circulating progenitor cells Research article Related Commentary, page 3103 Rosiglitazone promotes development of a novel adipocyte population from bone marrow derived circulating progenitor cells Joseph T. Crossno Jr., 1,2,3 Susan

More information

mir-150 regulates obesityassociated controlling B cell functions

mir-150 regulates obesityassociated controlling B cell functions www.nature.com/scientificreports OPEN received: 25 June 2015 accepted: 23 December 2015 Published: 01 February 2016 mir-150 regulates obesityassociated insulin resistance by controlling B cell functions

More information

The murine Resistin coding sequence was amplified from a fetal mouse cdna library and cloned

The murine Resistin coding sequence was amplified from a fetal mouse cdna library and cloned ESM METHODS Generation of Resistin transgenic mice The murine Resistin coding sequence was amplified from a fetal mouse cdna library and cloned into pcr4ta (Invitrogen). This was subcloned into a transgenic

More information

Regulatory T cells (Treg)

Regulatory T cells (Treg) Incomplete Depletion and Rapid Regeneration of Foxp3 Regulatory T Cells Following Anti-CD25 Treatment in Malaria-Infected Mice 1 Kevin N. Couper,* Daniel G. Blount,* J. Brian de Souza,* Isabelle Suffia,

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Immunity Supplemental Information Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Brian D. Hondowicz, Dowon An, Jason M. Schenkel, Karen S. Kim, Holly R. Steach, Akshay

More information

Citation for published version (APA): Diepenbroek, C. (2017). Glucose metabolism, diet composition, and the brain

Citation for published version (APA): Diepenbroek, C. (2017). Glucose metabolism, diet composition, and the brain UvA-DARE (Digital Academic Repository) Glucose metabolism, diet composition, and the brain Diepenbroek, C. Link to publication Citation for published version (APA): Diepenbroek, C. (2017). Glucose metabolism,

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

Antibiotic effects on gut microbiota and metabolism are host dependent

Antibiotic effects on gut microbiota and metabolism are host dependent Antibiotic effects on gut microbiota and metabolism are host dependent Shiho Fujisaka, 1 Siegfried Ussar, 1,2 Clary Clish, 3 Suzanne Devkota, 4 Jonathan M. Dreyfuss, 5,6 Masaji Sakaguchi, 1 Marion Soto,

More information

Overexpression of C-type Natriuretic Peptide in Endothelial Cells Protects against Insulin Resistance and Inflammation during Diet-induced Obesity

Overexpression of C-type Natriuretic Peptide in Endothelial Cells Protects against Insulin Resistance and Inflammation during Diet-induced Obesity www.nature.com/scientificreports Received: 12 May 2017 Accepted: 2 August 2017 Published: xx xx xxxx OPEN Overexpression of C-type Natriuretic Peptide in Endothelial Cells Protects against Insulin Resistance

More information

Even Fjære. NIFES; National Institute of Nutrition and Seafood Research

Even Fjære. NIFES; National Institute of Nutrition and Seafood Research Proteiner fra sjømatfokus på blodglukoseregulering og overvekt/fedme Even Fjære NIFES; National Institute of Nutrition and Seafood Research Obesity and related metabolic disturbances Obesity definition:

More information

Increased fat cell size: a major phenotype of subcutaneous white adipose tissue in non-obese individuals with type 2 diabetes

Increased fat cell size: a major phenotype of subcutaneous white adipose tissue in non-obese individuals with type 2 diabetes DOI.7/s5-5-38-6 ARTICLE Increased fat cell size: a major phenotype of subcutaneous white adipose tissue in non-obese individuals with type diabetes Juan R. Acosta & Iyadh Douagi & Daniel P. Andersson &

More information

The Beneficial Effects of n-3 Polyunsaturated Fatty Acids on Diet Induced Obesity and Impaired Glucose Control Do Not Require Gpr120

The Beneficial Effects of n-3 Polyunsaturated Fatty Acids on Diet Induced Obesity and Impaired Glucose Control Do Not Require Gpr120 RESEARCH ARTICLE The Beneficial Effects of n-3 Polyunsaturated Fatty Acids on Diet Induced Obesity and Impaired Glucose Control Do Not Require Gpr120 Mikael Bjursell 1 *, Xiufeng Xu 1, Therése Admyre 1,

More information

Phenotypic plasticity and targeting of Siglec-F high CD11c low eosinophils to the airway in a murine model of asthma

Phenotypic plasticity and targeting of Siglec-F high CD11c low eosinophils to the airway in a murine model of asthma Allergy BRIEF COMMUNICATION Phenotypic plasticity and targeting of Siglec-F high CD11c low eosinophils to the airway in a murine model of asthma H. Abdala Valencia 1, L. F. Loffredo 1, A. V. Misharin 2

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

Serum Triglyceride Quantification Kit (Colorimetric)

Serum Triglyceride Quantification Kit (Colorimetric) Product Manual Serum Triglyceride Quantification Kit (Colorimetric) Catalog Number STA-396 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Triglycerides (TAG) are a type

More information

MicroRNAs Modulate Hematopoietic Lineage Differentiation

MicroRNAs Modulate Hematopoietic Lineage Differentiation MicroRNAs Modulate Hematopoietic Lineage Differentiation Harvey F. Lodish, Chang-Zheng Chen, David P. Bartel Whitehead Institute for Biomedical Research, Department of Biology, Massachusetts Institute

More information

Altered food consumption in mice lacking lysophosphatidic acid receptor-1

Altered food consumption in mice lacking lysophosphatidic acid receptor-1 J Physiol Biochem, 65 (4), 000-000, 2009 Altered food consumption in mice lacking lysophosphatidic acid receptor-1 R. Dusaulcy, D. Daviaud, J-P. Pradère, S. Grès, Ph. Valet and J.S. Saulnier-Blache Institut

More information

Life Sciences METABOLISM. Transform Your Metabolic Research

Life Sciences METABOLISM. Transform Your Metabolic Research METABOLISM Transform Your Metabolic Research COMPREHENSIVE TOOLS FOR ADVANCING YOUR METABOLIC RESEARCH Metabolism refers to a set of chemical reactions which are responsible for transforming carbohydrates,

More information

ParActin For Cold & Flu

ParActin For Cold & Flu ParActin For Cold & Flu Colds and flu can reach epidemic proportions during the winter months. There are more than 95 million flu cases in the U.S. annually, according to the Centers for Disease Control,

More information