A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
|
|
|
- Juniper Tyler
- 6 years ago
- Views:
Transcription
1 A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International Conference on Diabetes and Metabolism and 5 th Asian Association for the Study of Diabetes, Seoul, Korea
2 The Global Epidemic of Obesity > 1/3 of adult population in USA are obese and 2/3 are overweight. Child obesity is rapidly growing.
3 Obesity: Disruption in Energy Balance Energy Intake Energy Balance Energy Expenditure Basal Metabolism Adaptive Thermogenesis Physical Activity Obesity and the regulation of energy balance, Review, by B. Spiegelman and J. Flier, Cell, 21
4 White Adipose Tissue (WAT) & Brown Adipose Tissue (BAT) Adipose tissue (fat cell) is an endocrine organ that control energy balance. WAT (Bad Fat): Stores excess energy as Fat (TG). In particular, abdominal Fat BAT (Good Fat) Packed w/ mitochondria Dissipates energy as heat (via UCP1). Newborns and small animals have BAT. Also, adults have BAT (cold exposure)! Activation of BAT would be an appealing option for weight-loss and fighting obesity. BUT!!!
5 Third Type of Fat: Beige Fat Browning of WAT P. Searle, U Penn
6 Third Type of Fat: Beige Fat Beige Fat: Stained by an antibody against UCP1, by Ting Fu HFD HFD (+anti-mir-34a) Beige fats are detected by brown-fat specific UCP1 staining. Beige fats are distinct from the classical BAT (gene expression patterns, basal levels UCP1, myogenic myf5-negative cell lineage, -----). Beige fat depots are developed in WAT in response to various activators, including transcriptional regulators, hormones, and cold exposure (PRDM16, irisin, FGF21, cold exposure (activators of β-adrenergic receptor)-----).
7 Fibroblast Growth Factor-21 (FGF21) Upon cold exposure, FGF21 promotes fat browning in PGC-1a dependent manner. Both systemically and locally acts on WAT/BAT and liver to beneficially control metabolism and energy balance. Binds to the adipocyte FGF21 membrane receptor complex, FGFR1 and βkl. FGF21 resistance in obesity was proposed, but the mechanisms are not clear. FGF21 FGFR1 βkl C. Cantor and J., Auwerx, review, Science, 212 Oxidative metabolism Fat Browning
8 MicroRNAs (mirs) Small non-coding RNAs (2-25 nt) Binds to 3 UTR of target mrnas (negative gene regulators) Powerful cellular regulators Known that regulate >1/3 of genomes Aberrant expression in human disease
9 Elevated mir-34a causes metabolic problems in obesity! Our recent published studies on mir-34a: J. Lee et al., JBC, 21 (SIRT1 in liver) J. Lee and JK Kemper, Review, Aging, 21 T. Fu et al., PNAS, 212 (bkl in liver) SE Choi et al., Aging Cell, 213 (NAMPT in liver) SE Choi and JK Kemper, Review, Mol. and Cells, 213 T. Fu et al., MS in preparation (FGFR1, bkl in adipose) Elevated mir-34a in obesity directly targets βkl in liver
10 mir-34a may directly target the both members of the FGF21 receptor bkl (a direct mir-34a target) is abundantly expressed in adipose tissue. The 3 UTR of FGFR1 mrna also contains a potential mir-34a site. mir-34a is elevated in adipocyte as well as liver in obese patients. mir-34a 3 UTR of FGFR1 mouse UGUUGGUCGA---UUCUGUGACGGU UCCCCUUGUUGGAC-ACACUGCCU FGF21 FGFR1 βkl Downstream Signaling
11 Hypothesis Elevated adipocyte mir-34a in obesity contributes to FGF21 resistance by directly targeting the both members of the FGF21 receptor complex, FGFR1 and βkl. If so, downregulation of elevated mir- 34a in obesity should restore FGF21 signaling, which results in beneficial effects on metabolism and energy balance. Obesity FGF21 FGFR1 βkl mir-34a Downstream Signaling ERK/AMPK? Transcription program of fat browning
12 Inverse correlation between FGFR1/bKL and mir-34a levels in WAT and BAT in obesity ND HFD (16 weeks) Rel mrna level 1.5 ** FGFR1 * WAT BAT 1 βkl ** * WAT BAT Rel mirna level mir-34a * * WAT BAT
13 mir-34a directly targets the 3 UTR of FGFR1 mrna mir-34a 3 UTR of FGFR1 mouse UGUUGGUCGA---UUCUGUGACGGU UCCCCUUGUUGGAC-ACACUGCCU mir 34a - site Luc FGFR1 3 UTR Overexpression of mir-34a mutated mir-34a site Luc FGFR1 3 UTR Downregulation of mir-34a Rel mirna Level 2 1 plasmids (ng) mir-34a * Rel Luc Activity pcdh-mir-34a FGFR1-WT 3 UTR * ** pcdh FGFR1-Mut 3 UTR NS Rel mirna Level RNA (nm) mir-34a * ** Anti-miR-34a Rel Luc Activity FGFR1-WT 3 UTR Anti-Scramble ** FGFR1-Mut 3 UTR 2 1 NS
14 In vivo role of elevated adipocyte mir-34a in obesity: Downregulation of mir-34a using lenti-anti-mir-34a (L-34ai) injection Inject Lentivirus Sacrifice Days 5d 8d 12d 14d 2d 2 week ND or HFD Start q-rtpcr IB Staining Rel mirna level mir-34a * * 2 1 WAT BAT ND (Lenti-E) HFD (Lenti-E) HFD (Lenti-34ai) (g) ND HFD,L-E HFD,L-34ai Start Body Weight * ** ** ND(L-E) HFD (L-E) HFD(L-34ai) (time) 4wks 2wks 5d 8d 12d 14d 2d Food Intake 3 NS NS NS g / p er d ay 2 1 5d 8d 12d
15 Downregulation of mir-34a (lenti-anti-mir-34a) reduced adiposity in diet-induced obese mice Types of Adipose Tissue BAT WAT: Visceral Epididymal WAT (ewat): perirenal WAT (prwat) gonadal WAT (gwat) Subcutaneous inguinal WAT (iwat) BAT prwat Adipose Tissue ND(L-E) HFD (L-E) HFD(L-34ai) (g) Adipose Weight * ** ** BAT prwat gwat iwat gwat iwat
16 Anti-miR-34a in obesity promotes fat browning : UCP1 staining WAT ND(L-E) HFD(L-E) HFD(L-34ai) BAT ND(L-E) HFD(L-E) HFD(L-34ai) UCP1 UCP1 5um 5um 5um 5um 5um 5um UCP1 DAPI UCPI DAPI 5um 5um 5um 5um 5um 5um Adipose Size (um 2 ) 8 *** ND (Lenti-E) HFD (Lenti-E) HFD (Lenti-34ai) mdna/ndna Mitochondrial Number WAT BAT ** **
17 Anti-miR-34a in obesity promotes browning in WAT (beige fat) Visceral ewat prwat He UCPI gwat He UCPI Mitochondrial UCP1 (IHC) ND(L-E) HFD(L-E) HFD(L-34ai) 5um 5um 5um 5um 5um 5um Brown gene expression Rel mrna level Rel mrna level prwat *** * ** Ucp1 Pgc1α Prdm16 ** gwat * Ucp1 Pgc1α Prdm16 Subcutaneous iwat iwat He UCPI 5um 5um 5um Rel mrna level *** iwat ** * Ucp1 Pgc1α Prdm16
18 Citrate Synthase (CS) Activity is restored by anti-mir-34a CS catalyzes the first step in the TCA cycle in mitochondria and its activity is a marker for mitochondrial oxidative function. TCA Cycle Citrate Synthase Citrate Synthase Activity (umole/mg/min) gwat * C S activity (u m o l/m g/m in ) BAT iwat **
19 Anti-miR-34a in obesity induces true beige fats in all types of WAT: detection of CD137 (Beige fat-specific marker) B UCPI prwat CD137 Merge D UCPI BAT CD137 Merge ND(L-E) ND(L-E) HFD (L-E) HFD (L-34ai) DAPI HFD (L-34ai) HFD (L-E) 5um DAPI 5um
20 Anti-miR-34a in obesity induces beige fats in all types of WAT: detection of CD137 (Beige fat-specific marker) A UCPI iwat CD137 Merge C UCPI gwat CD137 Merge HFD (L-E) HFD (L-E) ND(L-E) HFD (L-34ai) ND(L-E) DAPI 5um HFD (L-34ai)
21 Mechanisms? So far, Anti-miR-34a in diet-induced obese mice: reduced adiposity increased mitochondrial number and activity increased UCP1 expression increased browning of WAT (true beige fats) Question: How downregulation of mir-34a in obesity restores FGF21 signaling and promotes fat browning of WAT?
22 Downregulation of mir-34a restored FGF21 signaling in WAT in vivo 2 week ND or HFD Inject Lentivirus Days 5d 8d 12d 14d 16d Begin FGFR1//βKL Protein ND HFD L-E L-E L-34ai FGF βkl FGFR Kd Actin 37 Sacrifice FGF21 (3mins) Collect WAT IB Ac-assay ND HFD L-E L-E L-34ai FGF P-Erk T-Erk FGF21 signaling (Erk) FGF21 FGFR1 βkl Kd ERK
23 Downregulation of mir-34a decreased Ac of PGC-1α in WAT in vivo Ac- PGC-1α Ac ND HFD L-E L-E L-34ai FGF IP: PGC-1α IB: Acetyl-Lys Kd 1 75 PGC1 Input IB: PGC-1α 1 75 SIRT1 Protein ND HFD L-E L-E L-34ai FGF Kd 15 SIRT Actin 37 mir-34a SIRT1
24 Both FGF21 signaling and SIRT1 are important for anti-mir-34amediated PGC-1α deac and fat browning in adipocyte sirna Di- 3T3L1 FGF21 βkl sictl siβkl 1.11 IP: βkl IB: βkl B: Tubulin FGFR1 sictl sifgfr1 1.2 IP: FGFR1 IB: FGFR1 B: Tubulin SIRT1 sictl sisirt IB: SIRT1 IB: Tubulin Ac PGC1 A-Sc sictl Anti-miR34a siβkl sifgfr1 FGF Ac- PGC-1α IP: PGC-1α IB: Acetyl-Lys sisirt IB, qpcr Mito#, IHC IB: PGC-1α 75 R el m R N A lev el 2 1 Ucp1 ** *** ** * 2 1 Pgc1α *** *** ** ** * 15 ** ** *** *** ** 1 5 Prdm16 Anti-Sc Anti-SC, FGF21 Anti-34a, FGF21 Anti-34a, FGF21, sifgfr1 Anti-34a, FGF21, siβkl Anti-34a, FGF21, sisirt1
25 Both FGF21 signaling and SIRT1 are important for anti-mir-34amediated PGC-1α deac and fat browning in adipocyte UCP1 Staining (2x) Anti-Sc Anti-SC,FGF21 Anti-34a,FGF21 3um 3um 3um Anti-34a,siFGFR1,FGF21 Anti-34a,siβKL,FGF21 Anti-34a,siSIRT1,FGF21 3um 3um 3um
26 Summary FGF21 Obesity FGFR1 βkl Obesity + Anti-miR-34a FGF21 FGFR1 βkl mir-34a ERK/ AMPK? mir-34a ERK/ AMPK? SIRT1 Anti-miR-34a SIRT1 Ac Ac PGC1α PGC1α PGC1α Browning genes (Ucp1, Pgc-1, Prdm16, ----) Directly targets FGFR1 and bkl Impaired FGF21 signaling Directly targets SIRT1 Elevated PGC-1 Ac Dysfunctional Tx activity of PGC-1α Restored FGFR1/βKL/FGF21 signaling Increased SIRT1 Decreased PGC-1 Ac Transcription Program of Beige Fat This study identifies mir-34a a novel target for adipocyte FGF21 signaling, providing exciting potential options for treating obesity-related diseases. Ting Fu et al., MS in preparation
27 Acknowledgements J. Kim Kemper lab Ting Fu Sunmi Seok, Ph.D. Sung-E Choi, Ph.D. Sam Huang Subodh Kumar, Ph.D. Dong-Hyun Kim, Ph.D. Sangwon Byun, Ph.D. Sanghoon Kwon, Ph.D. Danny Ryerson Erica Yu David Tkac Supported by grants from NIH (DK62777, DK95842), AHA Grant in Aid, and ADA Basic Science Award
28
29 Extra energy is stored as FAT (TG) in adipose tissue
30 Downregulation of mir-34 (Lenti-34ai) reduced TG in both liver and WAT in diet-induced obese mice Oil Red O ND(L-E) HFD (L-E) HFD(L-34ai) 3um 3um 3um 3um 3um 3um
31 Summary FGF21 Obesity FGFR1 βkl Obesity + Anti-miR-34a FGF21 FGFR1 βkl mir-34a ERK/ AMPK? mir-34a ERK/ AMPK? SIRT1 Anti-miR-34a SIRT1 Ac PGC1α Ac PGC1α PGC1α Browning genes (Ucp1, Pgc-1, Prdm16, ----) Directly targets FGFR1 and bkl Impaired FGF21 signaling Directly targets SIRT1 Elevated PGC-1 Ac Dysfunctional Tx activity of PGC-1α Restored FGFR1/βKL/FGF21 signaling Increased SIRT1 Decreased PGC-1 Ac Transcription Program of Beige Fat Ting Fu et al., MS in preparation
32 Summary 1. mir-34a directly binds to the 3 UTR of both FGFR1 and bkl mrnas. 2. Elevated adipocyte mir-34a attenuates FGF21 signaling in obesity. 3. Downregulation of mir-34a reduces adiposity in obese mice. 4. Downregulation of mir-34a increases mitochondrial number and function and promotes fat browning (beige fat) in all types of WAT. 5. Mechanisms: Downregulation of mir-34a by lenti-anti-mir-34a Restored FGFR1, bkl, and SIRT1 levels in WAT Restored FGF21 signaling Deacetylation of PGC1-α and increased Tx activity Upregulation of brown genes (UCP1, PGC-1α, PRDM16, ---) Promotes development of Beige Fat in WAT 6. identifies mir-34a a novel target for adipocyte FGF21 signaling, providing exciting potential targets for treating obesity-related diseases. Ting Fu et al., MS in preparation
33 Downregulation of mir-34 (Lenti-34ai) reduced TG in both liver and WAT in diet-induced obese mice ND(L-E) HFD(L-E) HFD(L-34ai) WAT ORO 1um 1um 1um BAT H&E 1um 1um 1um 1um 1um 1um
34 Mechanisms? How downregulation of mir-34a in obesity promotes fat browning? Increased FGFR1/βKL levels Restored FGF21 signaling Increased SIRT1 levels Decreased Ac of PGC-1α (a key Tx activator of Mito biogenesis and fat browning) Promotes transcriptional program of fat browning Obesity + Anti-miR-34a FGF21 FGFR1 βkl mir-34a ERK/ AMPK? Anti-miR-34a SIRT1 Ac PGC1α PGC1α Browning genes (Ucp1, Pgc-1, Prdm16, ----)
35 mir-34a attenuates FGF21 signaling in adipocytes (3T3) R el m ir N A level Overexpression of mir-34a mir-34a ** Ad- E 34a FGFR1 Ad- E 34a βkl Kd Ad- E 34a 15 1 Kd 15 1 Tubulin Tubulin 5 5 FGF21 signaling FGF P-Erk T-Erk Ad- E 34a Kd NS.5. FGF Ad-E Ad-34a R e l P -E rk /T -E r k P=.13 FGF21 FGFR1 βkl ERK Downregulation of mir-34a Rel mirna level 2 1 mir-34a ** Anti-Sc 34a FGFR1 Anti-Sc anti-mir-34a (nm) IP: FGFR1 IB: FGFR1 Input IB: Tubulin FGF21 signaling Lenti- E 34ai FGF P-Erk T-Erk Kd Rel P-Erk/T-Erk level P= NS FGF Lenti-E Lenti-34ai
36 Inverse correlation between FGFR1/bKL and mir-34a levels in obesity ND HFD (16 weeks) Rel mrna level 1.5 ** FGFR1 * WAT BAT 1 βkl ** * WAT BAT WAT FGFR1 βkl Merge BAT FGFR1 βkl Merge HFD ND Rel mirna level mir-34a * * WAT BAT DAPI 5um
37 However, there are limited amounts of BAT in adult humans, BAT is substantially reduced in obese humans, and more importantly, the physiological significance of BAT in adults has just begun to be appreciated, so it is not clear whether targeting the classical BAT would be a therapeutically effective and ideal approach.
38
39 mir-34a hampers Glucose uptake in adipocytes Done by Dr. SungE Choir
40 ND (Saline) HFD (Oligo) ND Scramble Anti-miR34a H&E 5um 5um 5um Oil Red 5um 5um 5um Glucose (mg/dl) ND (Saline) HFD (Anti-SC) HFD (Anti-miR-34a) GTT ITT ** ** * ** ** * Time (min) Time (min)
41
42
43 Increased energy expenditure through uncoupled respiration During mitochondria oxidative phosphorylation pathway, H + leak (which is mediated by UCPs), uncouples the processes of electron transport/proton-gradient generation and ATP synthesis. The energy that is derived from this uncoupling process is released as Heat.
BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli
BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli Symposium Co-Chairs: Bruce M. Spiegelman (Harvard/Dana Farber) and Sven Enerbäck (U.Gothenburg) April 17-23, 2015 Snowbird Resort,
Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
Regulation of adipose tissue remodeling by peripheral serotonin
Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis
SUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
SUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
Beige fat: A New Hope for Metabolic Disorder
Young Biomedical Scientists Forum(YBSF) Beige fat: A New Hope for Metabolic Disorder Harim Kim(2) 1 Ewha University, School of Medicine, 52, Ewhayeodae-gil, Seodaemun-gu, Seoul 120-750 Korea k3541729@ybsf21.org
SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota
Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
Brown Adipose Tissue: Research Milestones of a Potential Player in Human Energy Balance and Obesity
774 Review Brown Adipose Tissue: Research Milestones of a Potential Player in Human Energy Balance and Obesity Author Affiliation B. Zafrir Department of Cardiovascular Medicine, Lady Davis Carmel Medical
BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
FGF21 Resistance in Adipose Tissues as a Cause of Insulin Resistance
Resistance in Adipose Tissues as a Cause of Insulin Resistance The ICDM 213 & 5 th AASD Scientific Meeting Seoul, Korea, Nov 8, 213 Aimin Xu Dept of Medicine & Dept of Pharmacology and Pharmacy The University
Adipocyte-specific deletion of Ip6k1 reduces diet-induced obesity by enhancing AMPKmediated
Adipocyte-specific deletion of Ip6k1 reduces diet-induced obesity by enhancing AMPKmediated thermogenesis Qingzhang Zhu,, James C. Barrow, Anutosh Chakraborty J Clin Invest. 2016;126(11):4273-4288. https://doi.org/10.1172/jci85510.
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
Supplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice
Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice Shen Yon Toh 1,2,3., Jingyi Gong 2., Guoli Du 2., John
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
Weight Loss at Altitude-The Untold Story: It s Cold Up Here! Biff F. Palmer, M.D.
Weight Loss at Altitude-The Untold Story: It s Cold Up Here! By Biff F. Palmer, M.D. Internal Medicine Grand Rounds University of Texas Southwestern Medical Center April 14, 2017 This is to acknowledge
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal
Correspondence: Ande Satyanarayana, 1410 Laney Walker Blvd., Rm-CN3150, Augusta, GA
Original Article Heart Metab. (2016) 69:4-8 Brown adipose tissue and the genetics of obesity Ande Satyanarayana, PhD Department of Biochemistry and Molecular Biology, Molecular Oncology & Biomarkers Program,
Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue
Manuscript EMBO-2015-40819 Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue Wuping Sun, Kunitoshi Uchida, Yoshiro Suzuki, Yiming Zhou, Minji Kim, Yasunori Takayama, Nobuyuki Takahashi,
ENHANCEMENT OF BROWN ADIPOSE TISSUE DEVELOPMENT IN VIVO BY A NOVEL INSULIN SENSITIZER
ENHANCEMENT F BRWN ADIPSE TISSUE DEVELPMENT IN VIV BY A NVEL INSULIN SENSITIZER William G. McDonald 1, Serena L. Cole 1, Brian N. Finck 2, Danielle D. Holewa 1, Angela S. Brightwell-Conrad 1, Charles Mackenzie
Id1 Promotes Obesity by Suppressing Brown Adipose Thermogenesis and White Adipose Browning
Diabetes Volume 66, June 2017 1611 Id1 Promotes Obesity by Suppressing Brown Adipose Thermogenesis and White Adipose Browning Mallikarjun Patil, Bal Krishan Sharma, Sawsan Elattar, Judith Chang, Shweta
BALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR
The West London Medical Journal 2010 Vol 2 No 4 pp 29-35 BALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR Sairah Akbar The topic of obesity is rarely out of the public eye with an increasingly
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis
Article Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis Kiana Mahdaviani 1,2, Ilan Y Benador 1,2, Shi Su 1, Raffi A Gharakhanian 1, Linsey Stiles 1,2, Kyle
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
![Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.](/thumbs/90/103696086.jpg "Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.")
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
Chapter 14. Energy conversion: Energy & Behavior
Chapter 14 Energy conversion: Energy & Behavior Why do you Eat and Breath? To generate ATP Foods, Oxygen, and Mitochodria Cells Obtain Energy by the Oxidation of Organic Molecules Food making ATP making
Fasted Insulin Coincidence of Macrophage Infiltration into White Adipose Tissue and Onset of Hyperinsulinemia During Diet- Induced Obesity
Fasted Insulin Coincidence of Macrophage Infiltration into White Adipose Tissue and Onset of Hyperinsulinemia During Diet- Induced Obesity F4/80 MCP-1 (After: Xu et al, 2003 JCI vol.112) F4/80+ Cells are
Supplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
Pathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
Understanding the Physiology of FGF21
ANNUAL REVIEWS Further Click here to view this article's online features: Download figures as PPT slides Navigate linked references Download citations Explore related articles Search keywords Annu. Rev.
UCP1-independent signaling involving SERCA2bmediated calcium cycling regulates beige fat thermogenesis and systemic glucose homeostasis
ARTICLES UCP-independent signaling involving SERCA2bmediated calcium cycling regulates beige fat thermogenesis and systemic glucose homeostasis 27 Nature America, Inc., part of Springer Nature. All rights
UNDERSTANDING THE REGULATION OF ADIPOGENESIS AND ADIPOCYTE METABOLISM IN OBESITY
UNDERSTANDING THE REGULATION OF ADIPOGENESIS AND ADIPOCYTE METABOLISM IN OBESITY A DISSERTATION SUBMITTED TO THE FACULTY OF THE UNIVERSITY OF MINNESOTA BY MING ZHAO IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
of professional contacts and collaborations. With various global locations these conferences attract
Abstract The Keystone Symposia are held annually to congregate people working in a specific field of research in order to disseminate unpublished findings and allow for networking and establishment of
Beneficial effects of naringenin and indomethacin on white and brown adipocytes
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange Masters Theses Graduate School 12-2016 Beneficial effects of naringenin and indomethacin on white and brown adipocytes
In The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
Does Pharmacological Exercise Mimetics Exist? Hokkaido University Graduate School of Medicine Shintaro Kinugawa
Does Pharmacological Exercise Mimetics Exist? Hokkaido University Graduate School of Medicine Shintaro Kinugawa Survival rate (%) Peak oxygen uptake and prognosis in patients with heart failure (HF) 1
Endothelial PDGF-CC regulates angiogenesisdependent thermogenesis in beige fat
ARTIE Received Apr 6 Accepted 6 Jun 6 Published 5 Aug 6 DOI:.8/ncomms5 OPEN Endothelial PDGF-CC regulates angiogenesisdependent thermogenesis in beige fat Takahiro Seki, Kayoko Hosaka, Sharon Lim, Carina
Hormones and Target Tissues
Hormones and Target Tissues The hypothalamus is the coordination center of the endocrine system Hypothalamus is a small region of the forebrain in animals with skulls It receives and integrates nerve signals
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
Review Article Novel Browning Agents, Mechanisms, and Therapeutic Potentials of Brown Adipose Tissue
BioMed Research International Volume 2016, Article ID 2365609, 15 pages http://dx.doi.org/10.1155/2016/2365609 Review Article Novel Browning Agents, Mechanisms, and Therapeutic Potentials of Brown Adipose
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
FADD is a key regulator of lipid metabolism
Research Article FADD is a key regulator of lipid metabolism Hongqin Zhuang 1, Xueshi Wang 1, Daolong Zha 1, Ziyi Gan 1, Fangfang Cai 1, Pan Du 1, Yunwen Yang 1, Bingya Yang 1, Xiangyu Zhang 1, Chun Yao
exposed operative area for presence of small islands (±1-2 cm) of adipose tissue from
Supplemental Material Details for the biopsy procedure During surgery, both the surgeon (N.B.) and the researcher (G.V.) visually inspected the exposed operative area for presence of small islands (±1-2
SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)
SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of
Interplay between FGF21 and insulin action in the liver regulates metabolism
Research article Interplay between FGF21 and insulin action in the liver regulates metabolism Brice Emanuelli, 1 Sara G. Vienberg, 1 Graham Smyth, 1 Christine Cheng, 2 Kristin I. Stanford, 1 Manimozhiyan
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
NT-PGC-1α activation attenuates high-fat diet-induced obesity by enhancing brown fat thermogenesis and adipose tissue oxidative metabolism
Page 1 of 37 NT-PGC-1α activation attenuates high-fat diet-induced obesity by enhancing brown fat thermogenesis and adipose tissue oxidative metabolism Hee-Jin Jun, Yagini Joshi, Yuvraj Patil, Robert C.
Tadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual
Tadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual Medicine and Andrology Unit Dept. Experimental and Clinical
E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss
GG2 Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss Dr Giacomo Gastaldi CHRU Montpellier Folie 1 GG2 19.10.2009 GG_PC; 12.10.2009 Plan Introduction
Hypothalamic Autophagy and Regulation of Energy Balance
Hypothalamic Autophagy and Regulation of Energy Balance Rajat Singh, MD Albert Einstein College of Medicine New York NuGOweek 211 Sept 6-9, 211 Autophagy Evolutionarily conserved cellular recycling program
Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
NIH Public Access Author Manuscript Annu Rev Physiol. Author manuscript; available in PMC 2014 July 10.
NIH Public Access Author Manuscript Published in final edited form as: Annu Rev Physiol. 2014 ; 76: 225 249. doi:10.1146/annurev-physiol-021113-170252. A New Era in Brown Adipose Tissue Biology: Molecular
Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B
Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B Fawaz G. Haj Associate Professor Diagnosed Obesity and Diabetes for Adults aged 20 years in United States
The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.
The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C
Activation of Toll-like Receptor 4 (TLR4) Attenuates Adaptive Thermogenesis via Endoplasmic Reticulum Stress
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Nutrition and Health Sciences -- Faculty Publications Nutrition and Health Sciences, Department of 10-2015 Activation of
Resveratrol and Metformin Combination Therapy in Prevention and Treatment of Insulin Resistance. Scott Frendo-Cumbo
Resveratrol and Metformin Combination Therapy in Prevention and Treatment of Insulin Resistance by Scott Frendo-Cumbo A Thesis Presented to The University of Guelph In partial fulfillment of requirements
Supplemental Information. Brown Adipogenic Reprogramming. Induced by a Small Molecule
Cell Reports, Volume 18 Supplemental Information rown dipogenic Reprogramming Induced by a Small Molecule aoming Nie, Tao Nie, Xiaoyan Hui, Ping Gu, Liufeng Mao, Kuai Li, Ran Yuan, Jiashun Zheng, Haixia
Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue
Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is
Supporting Information
Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs
Supporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,
1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of
perk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
UC San Francisco UC San Francisco Previously Published Works
UC San Francisco UC San Francisco Previously Published Works Title A new era in brown adipose tissue biology: Molecular control of brown fat development and energy homeostasis Permalink https://escholarship.org/uc/item/61v5z1v2
Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice
Am J Physiol Regul Integr Comp Physiol 284: R87 R100, 2003; 10.1152/ajpregu.00431.2002. Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice HEATHER
ShapePerfection Burns fat fights cellulite
Burns fat fights cellulite Burns fat fights cellulite Spicy Substances to Fight Cellulite and Excess Centimeters ShapePerfection is a liposoluble anti-cellulite slimming active ingredient that is based
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity
1 EXERCISE IS MEDICINE: The Science Behind the Movement Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity Rosa Allyn G. Sy, MD, FPCP, FPSEDM Endocrinology, Diabetes, Metabolism
Regulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
Review Article Does Adipose Tissue Thermogenesis Play a Role in Metabolic Health?
Obesity Volume 2013, Article ID 204094, 4 pages http://dx.doi.org/10.1155/2013/204094 Review Article Does Adipose Tissue Thermogenesis Play a Role in Metabolic Health? Craig Porter, 1,2 Elisabet Børsheim,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
Acquisition of brown fat characteristics by white adipose
ENERGY BALANCE-OBESITY A Role for Phosphodiesterase 3B in Acquisition of Brown Fat Characteristics by White Adipose Tissue in Male Mice Emilia Guirguis, Steven Hockman, Youn Wook Chung, Faiyaz Ahmad, Oksana
Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
Reviewer #1 (Remarks to the Author)
Reviewer #1 (Remarks to the Author) The authors provide an interesting data set concerning the effects of an ATGL inhibitor on energy balance and indices of insulin action in mice fed a high fat diet.
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
Supplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
Activation of Bile Acid Signaling Shapes the Gut Microbiota to Improve Diabetes and Fatty Liver Disease
Activation of Bile Acid Signaling Shapes the Gut Microbiota to Improve Diabetes and Fatty Liver Disease John Chiang, Ph.D. Northeast Ohio Medical University Rootstown, OH, USA International Conference
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Diabetes in Older Adults
Diabetes in Older Adults NICOLAS MUSI, MD Barshop Institute for Longevity and Aging Studies San Antonio GRECC University of Texas Health Science Center San Antonio, TX Metabolic Alterations in Aging Sarcopenia