SUPPLEMENTARY INFORMATION

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 DOI: /ncb2294 Figure S1 Localization and function of cell wall polysaccharides in root hair cells. (a) Spinning-disk confocal sections of seven day-old A. thaliana seedlings stained with 0.1% S4B were collected with a 10X objective (scale bars = 50 mm) using either brightfield (left panel) or appropriate filter sets to image S4B fluorescence (right panel). Young root hairs in a zone in which active tip-growth occurs display highly enriched S4B staining predominantly in the root hair apex (arrowheads), while mature root hairs display much more uniform staining along the entire root hair shaft (brackets). Quantification of the time- and dose-dependent effects of cellulase (b), xyloglucanase (c), and pectate lyase (d) treatment on growing root hairs. Characterization of the effect of xyloglucanase treatment on cellulose or cellulose-like polysaccharides (e), or xyloglucan (f) in growing root hairs. Medial confocal sections of root hairs from zones of active tip-growth were collected using a 40X (left; scale bar = 10 mm) or 10X lens (right; scale bar = 50 mm) and brightfield (upper panels) or appropriate filter sets to visualize S4B (e; lower panels) or anti-ccrc-m1 immunofluorescence (f; lower panels, 40X lens) either prior to (left panels) or after xyloglucanase treatment (+XGase; right panels) (scale bars = 10 mm). 1

2 Figure S2 (a). Brightfield image of root hairs from seven day-old wt(col-0) seedlings, (b). Root hairless kjk-2 seedling, (c). kjk-2 seedling transformed with 35S::EYFP-CSLD3. (d-e) Medial plane optical sections of kjk-2 seedlings rescued with (d) 35S::EYFP-CSLD3 or (e) the endogenous promoter (endop::eyfp-csld3) collected using spinning-disk confocal microscopy and appropriate filter sets. (f) Root hair lengths in wt(col-0), and kjk-2 lines rescued with EYFP-CSLD3 driven by either endogenous CSLD3 promoter (endop) or 35S EYFP-CSLD3::A6CD chimera driven by 35S promoter. Average length of root hairs (n = 30) from three independent seedlings were measured, error bars = +/- SD (scale bars = 100 mm for A-C; 10 mm for D-E). 2

3 Figure S3 Polarized EYFP-CSLD3 localizes into discrete regions of fluorescence that are motile in the tips of root hair cells. (a) Three successive Z-plane optical sections of a growing root hair cell stably expressing EYFP- CSLD3 were collected using spinning-disk confocal microscopy. EYFP- CSLD3 fluorescence was collected for 50 milliseconds with a 100X oil objective (1.46 NA) and optical sections are separated by 1 mm distances. EYFP-CSLD3 is enriched in a tip-restricted plasma membrane domain in the apex of the hair cell, and does not appear to be uniform but localizes in discrete regions of high fluorescence (highlighted by arrowheads; scale bar = 2 mm). (b) EYFP-CSLD3 dynamics within the apical plasma membrane domain. Successive frames of a time-lapse movie were collected for 50 milliseconds with a 100X oil objective (1.46 NA) at five second intervals. Zones where discrete regions of higher EYFP-CLSD3 fluorescence were detected are indicated by white or yellow brackets. While some of these appeared motionless relative to the growing tip (white asterisk) multiple fluorescent regions appeared and disappeared from the confocal plane, or could be observed to move position relative to the growing root hair apex (arrow heads; scale bar = 2 mm). 3

4 Figure S4 Fluorescence recovery after photobleaching growing root hairs. Medial confocal sections were collected from growing root hairs from seven day-old seedlings expressing EYFP-CSLD3. After establishing root hairs were growing, photobleaching was performed within small (a) or large (c) ROI (red circles). Quantification of fluorescence recovery of EYFP-CSLD3 within the apical plasma membrane domain in two independent root hairs (black squares and grey triangles) was measured at 2-second intervals within the small (b) or large (d) photobleached ROI. 4

5 Figure S5 Fluorescence recovery after photobleaching in latrunculin B treated root hairs. Medial confocal sections were collected from growing root hairs from seven day-old seedlings expressing EYFP-CSLD3. After establishing root hairs were growing, they were treated with 200 nm latrunculin B. Upon loss of cytoplasmically localized EYFP-CSLD3 vesicles within the root hair apex, photobleaching was performed within small (a) or large (c) ROI (red circles). Quantification of fluorescence recovery of EYFP- CSLD3 within the apical plasma membrane domain in two independent root hairs (black squares and grey triangles) was measured within the small (b) or large (d) photobleached ROI (scale bar = 1 mm). 5

6 Primers Primer Sequence (5-3 ) A: CSLD3-upper ATGGCGTCTAATAATCATTTCATGAACAGTAG B: CSLD3-lower TCATGGGAAAGTGAAAGATCCTCCGATTT C: kjk-4-lower TCATTTGATCTCGAGGAGAGCGAGTA D: CSLD3-Nterm-upper ATGGCGTCTAATAATCATTTCATGAACAGT E: CSLD3-Nterm-lower GGAAACCACTTGGGAAACTGATCAAGTAGC F: CSLD3-Cterm-upper GAGAGGTTTGCGTATGTGAACGTTGGAATCTAC G: CSLD3-Cterm-lower TCATGGGAAAGTGAAAGATCCTCCGATT H: CESA6-CD-upper ATCAGTTCCCTAAATGGTACCC I: CESA6-CD-lower GAGTTAATGTAGGACAACCGCT Table S1 Primers used for PCR amplification and assembly of CSLD3, kjk-4, and CSLD3::A6CD constructs. 6

7 Supplementary Movie Legends Movie 1: DCB treatment results in rapid root hair rupture. Movie 2A: Cellulase treatment results in root hair rupture, but can be competitively inhibited by 0.8 mg/ml CM-cellulose. Movie 2B: Xyloglucanase treatment inhibits root hair growth. Movie 2C: Pectate lyase treatment inhibits root hair growth. Movie 3: EYFP-CESA6 is restricted to internal compartments in growing root hair cells. Movie 4: A functional EYFP-CSLD3 fusion localizes to membranes in the tips of growing root hair cells. Movie 5: Delivery of EYFP-CSLD3 to tip-enriched plasma membranes requires an intact actin cytoskeleton. Movie 6: EYFP-CSLD3 localizes as discrete particles in tip-enriched plasma membranes in growing root hair cells. Movie 7: EYFP-CSLD3 dynamics within the apical plasma membranes in growing root hair cells. Movie 8A: FRAP analysis of EYFP-CSLD3 in growing root hair cells; small ROI. Movie 8B: FRAP analysis of EYFP-CSLD3 in growing root hair cells; large ROI. Movie 8C: FRAP analysis of EYFP-CSLD3 in the apical plasma membrane domain of latrunculin B treated root hair cells; small ROI. Movie 8D: FRAP analysis of EYFP-CSLD3 in the apical plasma membrane domain of latrunculin B treated root hair cells; large ROI. Movie 9: DCB effect on EYFP-CSLD3 dynamics in the tips of root hair cells. Movie 10: Isoxaben has no effect on EYFP-CSLD3 localization in growing root hair cells. Movie 11: CGA treatment inhibits root hair growth and induces cell rupture and bulging. Movie 12: Subcellular distribution of the EYFP-CSLD3::A6CD chimera in a growing root hair cell from a rescued kjk-2 seedling. 7

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV

More information

Vesicular Trafficking of Semaphorin 3A is Activity- Dependent and Differs Between Axons and Dendrites

Vesicular Trafficking of Semaphorin 3A is Activity- Dependent and Differs Between Axons and Dendrites Traffic 6; 7: 6 77 Blackwell Munksgaard Copyright # Blackwell Munksgaard 6 doi:./j.6-854.6.44.x Vesicular Trafficking of Semaphorin A is Activity- Dependent and Differs Between Axons and Dendrites Joris

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina

More information

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative

More information

Supplemental Information. 3D-CLEM Reveals that a Major Portion. of Mitotic Chromosomes Is Not Chromatin

Supplemental Information. 3D-CLEM Reveals that a Major Portion. of Mitotic Chromosomes Is Not Chromatin Molecular Cell, Volume 64 Supplemental Information 3D-CLEM Reveals that a Major Portion of Mitotic Chromosomes Is Not Chromatin Daniel G. Booth, Alison J. Beckett, Oscar Molina, Itaru Samejima, Hiroshi

More information

Supplemental Information. Figures. Figure S1

Supplemental Information. Figures. Figure S1 Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles

Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles Amin Feizpour Reinhard Lab Department of Chemistry and the Photonics Center, Boston University, Boston, MA May 2014

More information

Supplemental Information. Supernumerary Centrosomes. Nucleate Extra Cilia and Compromise. Primary Cilium Signaling. Current Biology, Volume 22

Supplemental Information. Supernumerary Centrosomes. Nucleate Extra Cilia and Compromise. Primary Cilium Signaling. Current Biology, Volume 22 Current Biology, Volume 22 Supplemental Information Supernumerary Centrosomes Nucleate Extra Cilia and Compromise Primary Cilium Signaling Moe R. Mahjoub and Tim Stearns Supplemental Inventory 1. Supplemental

More information

Distinct Dynamics of Endocytic Clathrin-Coated Pits and Coated Plaques

Distinct Dynamics of Endocytic Clathrin-Coated Pits and Coated Plaques Distinct Dynamics of Endocytic Clathrin-Coated Pits and Coated Plaques Saveez Saffarian, Emanuele Cocucci, Tomas Kirchhausen* Department of Cell Biology, Harvard Medical School, Children s Hospital and

More information

Chapter 6: A Tour of the Cell. 1. Studying Cells 2. Intracellular Structures 3. The Cytoskeleton 4. Extracellular Structures

Chapter 6: A Tour of the Cell. 1. Studying Cells 2. Intracellular Structures 3. The Cytoskeleton 4. Extracellular Structures Chapter 6: A Tour of the Cell 1. Studying Cells 2. Intracellular Structures 3. The Cytoskeleton 4. Extracellular Structures 1. Studying Cells Concepts of Microscopy MAGNIFICATION factor by which the image

More information

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn. Supplementary Figure 1 SybII and Ceb are sorted to distinct vesicle populations in astrocytes. (a) Exemplary images for cultured astrocytes co-immunolabeled with SybII and Ceb antibodies. SybII accumulates

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Molecular Components of HIV

Molecular Components of HIV October 17, 2006 1 Molecular Components of HIV Protein RNA Lipid You heard in the first part of this course about the properties of two of the molecules of life - nucleic acids and proteins. In the next

More information

13 13 1 1 1 12 0250512 24 1 1 48 1 70250512 24 1 148 1 0250512 24 1 48 1313 7025 0512 24 1 48 1313 13 13 11 24 0250512 48 1 7 124 0250512 48 1 124 0250512 48 13 13 7124 0250512 48 1313 13 13 1350250512

More information

MEMBRANE STRUCTURE. Lecture 8. Biology Department Concordia University. Dr. S. Azam BIOL 266/

MEMBRANE STRUCTURE. Lecture 8. Biology Department Concordia University. Dr. S. Azam BIOL 266/ 1 MEMBRANE STRUCTURE Lecture 8 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University Plasma Membrane 2 Plasma membrane: The outer boundary of the cell that separates it from the world

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Fig. S1. Weights of full-dose treatment groups comparing 1 st, 2 nd, and 3 rd generation gene replacement therapy. Mice were treated at p1 with 4x10 11 GC of the three different

More information

Karen L.P. McNally, Amy S. Fabritius, Marina L. Ellefson, Jonathan R. Flynn, Jennifer A. Milan, and Francis J. McNally

Karen L.P. McNally, Amy S. Fabritius, Marina L. Ellefson, Jonathan R. Flynn, Jennifer A. Milan, and Francis J. McNally Developmental Cell, Volume 22 Supplemental Information Kinesin-1 Prevents Capture of the Oocyte Meiotic Spindle by the Sperm Aster Karen L.P. McNally, Amy S. Fabritius, Marina L. Ellefson, Jonathan R.

More information

Structure and Function of Cells

Structure and Function of Cells Structure and Function of Cells Learning Outcomes Explain the cell theory Explain why cell size is usually very small Describe the Fluid Mosaic Model of membranes Describe similarities and differences

More information

Measures of Membrane Fluidity: Melting Temperature

Measures of Membrane Fluidity: Melting Temperature Measures of Membrane Fluidity: Melting Temperature T m (melting temperature) is a phase transition, a change from a more rigid solid-like state to a fluid-like state The fluidity - ease with which lipids

More information

Structural vs. nonstructural proteins

Structural vs. nonstructural proteins Why would you want to study proteins associated with viruses or virus infection? Receptors Mechanism of uncoating How is gene expression carried out, exclusively by viral enzymes? Gene expression phases?

More information

Imaging of Chromosomes at Nanometer-Scale Resolution, Using Soft X-Ray Microscope

Imaging of Chromosomes at Nanometer-Scale Resolution, Using Soft X-Ray Microscope Imaging of Chromosomes at Nanometer-Scale Resolution, Using Soft X-Ray Microscope K. Takemoto, A. Yamamoto 1, I. Komura 2, K. Nakanishi 3, H. Namba 2 and H. Kihara Abstract In order to clarify the process

More information

Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure.

Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. Animal cells have a lysosome (related to vacuole) and centrioles (function

More information

Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator

Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM Real-time automated measurements of cell motility inside your incubator See the whole story Real-time cell motility visualization and

More information

Supplementary Information Membrane tension increases fusion efficiency of model membranes in the presence of SNAREs

Supplementary Information Membrane tension increases fusion efficiency of model membranes in the presence of SNAREs Supplementary Information Membrane tension increases fusion efficiency of model membranes in the presence of SNAREs Torben-Tobias Kliesch, Jörn Dietz, Laura Turco, Partho Halder, Elena Alexandra Polo,

More information

NOTES: Chapter 6 STRUCTURE OF THE CELL

NOTES: Chapter 6 STRUCTURE OF THE CELL Biology 120 Section 10 J. Greg Doheny NOTES: Chapter 6 STRUCTURE OF THE CELL NOTES Relative sizes of cells: If a Eukaryotic cell was the size of Columbia College, a prokaryotic cell (like a bacterium)

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

Chapt. 11, Membrane Structure. Chapt. 11, Membrane Structure. Chapt. 11, Membrane Structure. Functions of cell membrane. Functions of cell membrane

Chapt. 11, Membrane Structure. Chapt. 11, Membrane Structure. Chapt. 11, Membrane Structure. Functions of cell membrane. Functions of cell membrane Chapt. 11, Membrane Structure Functions of cell membrane 1 Chapt. 11, Membrane Structure Functions of cell membrane As a container/ barrier to movement of small molecules. Figure 11 2 Chapt. 11, Membrane

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Supplementary Figures

Supplementary Figures Supplementary Figures 9 10 11 Supplementary Figure 1. Old plants are more resistant to insect herbivores than young plants. (a) Image of young (1-day-old, 1D) and old (-day-old, D) plants of Arabidopsis

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

Dynamic Partitioning of a Glycosyl-Phosphatidylinositol-Anchored Protein in Glycosphingolipid-Rich Microdomains Imaged by Single-Quantum Dot Tracking

Dynamic Partitioning of a Glycosyl-Phosphatidylinositol-Anchored Protein in Glycosphingolipid-Rich Microdomains Imaged by Single-Quantum Dot Tracking Traffic 2009; 10: 691 712 Blackwell Munksgaard 2009 The Authors Journal compilation 2009 Blackwell Munksgaard doi: 10.1111/j.1600-0854.2009.00902.x Dynamic Partitioning of a Glycosyl-Phosphatidylinositol-Anchored

More information

PBZ FT01_PBZ FT01_TZ FT01_NZ. interface zone (I) tumor zone (TZ) necrotic zone (NZ)

PBZ FT01_PBZ FT01_TZ FT01_NZ. interface zone (I) tumor zone (TZ) necrotic zone (NZ) Oncotarget, Supplementary Materials www.impactjournals.com/oncotarget/ SUPPLEMENTRY FLES ndividuals factor map (P) FT_ FT_ FT_ Dim (.%) Dim (.%) >% peripheral brain zone () around % interface zone () FT

More information

Chloride Channel Blockers Suppress Formation of Engulfment Pseudopodia in Microglial Cells

Chloride Channel Blockers Suppress Formation of Engulfment Pseudopodia in Microglial Cells Original Paper www.karger.com/cpb 319 Harl/Schmölzer/Jakab/Ritter/Kerschbaum: Accepted: February 07, 2013 Chloride Channel 1421-9778/13/0313-0319$38.00/0 Blockers Suppress This is an Open Access article

More information

11/19/2015. Compound eyes. Odonata. Diptera facets of ommatidia. ocellus compound eye. up to 30,000 facets per eye. corneagen cells.

11/19/2015. Compound eyes. Odonata. Diptera facets of ommatidia. ocellus compound eye. up to 30,000 facets per eye. corneagen cells. corneagen cells DORSAL OCELLUS retinula (sense) cell ocellar nerve to medial area of protocerebrum corneal lens cuticle epidermis pigment cells (or urate tapetum) pigment cell retinula cell (of 3) cross-section

More information

Parallel Driving and Modulatory Pathways Link the Prefrontal Cortex and Thalamus

Parallel Driving and Modulatory Pathways Link the Prefrontal Cortex and Thalamus Boston University OpenBU Health Sciences http://open.bu.edu SAR: Health Sciences: Scholarly Papers 2007-9-5 Parallel Driving and Modulatory Pathways Link the Prefrontal Cortex and Thalamus Zikopoulos,

More information

A. Major parts 1. Nucleus 2. Cytoplasm a. Contain organelles (see below) 3. Plasma membrane (To be discussed in Cellular Transport Lecture)

A. Major parts 1. Nucleus 2. Cytoplasm a. Contain organelles (see below) 3. Plasma membrane (To be discussed in Cellular Transport Lecture) Lecture 5: Cellular Biology I. Cell Theory Concepts: 1. Cells are the functional and structural units of living organisms 2. The activity of an organism is dependent on both the individual and collective

More information

THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS

THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS Research Foundation, 18 month progress report THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS Ekaterina Ivanova, doctoral student Elena Levtchenko, MD, PhD, PI Antonella

More information

Fig. 1. A zona-free hamster oocyte penetrated by several guinea pig spermatozoa.

Fig. 1. A zona-free hamster oocyte penetrated by several guinea pig spermatozoa. OTHER RESEARCH A. In Vitro Fertilization in Eutherian Mammals. In the early 1950s it was recognized that mammalian spermatozoa must undergo physiological and structural changes as a prerequisite to fertilization.

More information

Active Rab11 and functional recycling endosome are required for E-cadherin trafficking and lumen formation during epithelial morphogenesis

Active Rab11 and functional recycling endosome are required for E-cadherin trafficking and lumen formation during epithelial morphogenesis Am J Physiol Cell Physiol 295: C545 C556, 2008. First published June 25, 2008; doi:10.1152/ajpcell.00097.2008. Active Rab11 and functional recycling endosome are required for E-cadherin trafficking and

More information

Conventional or molecular measurement of Aspergillus load. Dr Karl Clemons California Institute for Medical Research

Conventional or molecular measurement of Aspergillus load. Dr Karl Clemons California Institute for Medical Research Conventional or molecular measurement of Aspergillus load Dr Karl Clemons California Institute for Medical Research Everyone quantifies burdens or numbers of organisms, so what s the big deal?? Why does

More information

EXTERNAL FIXATION SYSTEM

EXTERNAL FIXATION SYSTEM EXTERNAL FIXATION SYSTEM The Apex Pin Fixation System is a one step procedure reducing insertion time and reducing insertion temperature. There are three types of fixation pins: Self-drilling / Self-tapping

More information

Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022

Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022 96 APPENDIX B. Supporting Information for chapter 4 "changes in genome content generated via segregation of non-allelic homologs" Figure S1. Potential de novo CNV probes and sizes of apparently de novo

More information

Actin Filaments and Myosin I Alpha Cooperate with Microtubules for the Movement of Lysosomes V

Actin Filaments and Myosin I Alpha Cooperate with Microtubules for the Movement of Lysosomes V Molecular Biology of the Cell Vol. 12, 4013 4029, December 2001 Actin Filaments and Myosin I Alpha Cooperate with Microtubules for the Movement of Lysosomes V Marie-Neige Cordonnier,* Daniel Dauzonne,

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

Secretion and Endocytosis. Peter Takizawa Cell Biology

Secretion and Endocytosis. Peter Takizawa Cell Biology Secretion and Endocytosis Peter Takizawa Cell Biology Vesicular transport between organelles Glycosylation Protein sorting in the Golgi Endocytosis Secretory pathway delivers proteins and lipids to plasma

More information

EXO-DNA Circulating and EV-associated DNA extraction kit

EXO-DNA Circulating and EV-associated DNA extraction kit Datasheet EXO-DNA Circulating and EV-associated DNA extraction kit This product is for research use only. It is highly recommended to read this users guide in its entirety prior to using this product.

More information

The In Vivo Kinetics of RNA Polymerase II Elongation during Co-Transcriptional Splicing

The In Vivo Kinetics of RNA Polymerase II Elongation during Co-Transcriptional Splicing The In Vivo Kinetics of RNA Polymerase II Elongation during Co-Transcriptional Splicing Yehuda Brody 1, Noa Neufeld 1, Nicole Bieberstein 2, Sebastien Z. Causse 3, Eva-Maria Böhnlein 2, Karla M. Neugebauer

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding

More information

B cell activation from actin rearrangements to cell survival

B cell activation from actin rearrangements to cell survival B cell activation from actin rearrangements to cell survival Ph.D. thesis Maus Máté Supervisor: Prof. Sármay Gabriella D.Sc. Biology Doctoral School Immunology Programme Programme leader: Prof. Anna Erdei

More information

Technical Discussion HUSHCORE Acoustical Products & Systems

Technical Discussion HUSHCORE Acoustical Products & Systems What Is Noise? Noise is unwanted sound which may be hazardous to health, interfere with speech and verbal communications or is otherwise disturbing, irritating or annoying. What Is Sound? Sound is defined

More information

The Block in Assembly of Modified Vaccinia Virus Ankara in HeLa Cells Reveals New Insights into Vaccinia Virus Morphogenesis

The Block in Assembly of Modified Vaccinia Virus Ankara in HeLa Cells Reveals New Insights into Vaccinia Virus Morphogenesis JOURNAL OF VIROLOGY, Aug. 2002, p. 8318 8334 Vol. 76, No. 16 0022-538X/02/$04.00 0 DOI: 10.1128/JVI.76.16.8318 8334.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. The Block

More information

Arginine side chain interactions and the role of arginine as a mobile charge carrier in voltage sensitive ion channels. Supplementary Information

Arginine side chain interactions and the role of arginine as a mobile charge carrier in voltage sensitive ion channels. Supplementary Information Arginine side chain interactions and the role of arginine as a mobile charge carrier in voltage sensitive ion channels Craig T. Armstrong, Philip E. Mason, J. L. Ross Anderson and Christopher E. Dempsey

More information

International Graduate Research Programme in Cardiovascular Science

International Graduate Research Programme in Cardiovascular Science 1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.

More information

Lecture 2 I. Membrane Proteins II. Intracellular Compartments

Lecture 2 I. Membrane Proteins II. Intracellular Compartments Lecture 2 I. Membrane Proteins II. Intracellular Compartments Ref: MBoC (5th Edition), Alberts Johnson Lewis Raff Roberts Walter Chapter 10 Membrane Structure Chapter 12 Intracellular Compartments and

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

A two-microrna signature in urinary exosomes for diagnosis of prostate cancer

A two-microrna signature in urinary exosomes for diagnosis of prostate cancer Poster # B4 A two-microrna signature in urinary exosomes for diagnosis of prostate cancer Anne Karin Ildor Rasmussen 1, Peter Mouritzen 1, Karina Dalsgaard Sørensen 3, Thorarinn Blondal 1, Jörg Krummheuer

More information

Zool 3200: Cell Biology Exam 4 Part I 2/3/15

Zool 3200: Cell Biology Exam 4 Part I 2/3/15 Name: Trask Zool 3200: Cell Biology Exam 4 Part I 2/3/15 Answer each of the following questions in the space provided, explaining your answers when asked to do so; circle the correct answer or answers

More information

Figure S1 Expression of AHL gene family members in diploid (Ler Col) and triploid (Ler

Figure S1 Expression of AHL gene family members in diploid (Ler Col) and triploid (Ler Supplemental material Supplemental figure legends Figure S Expression of AHL gene family members in diploid (Ler ) and triploid (Ler osd) seeds. AHLs from clade B are labelled with (I), and AHLs from clade

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Activated Human Eosinophils

Activated Human Eosinophils Activated Human Eosinophils The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Published Version Accessed Citable Link

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

BIO 5099: Molecular Biology for Computer Scientists (et al)

BIO 5099: Molecular Biology for Computer Scientists (et al) BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 15: Being a Eukaryote: From DNA to Protein, A Tour of the Eukaryotic Cell. Christiaan van Woudenberg Being A Eukaryote Basic eukaryotes

More information

3. Insert Tocar Sleeves Insert the NCB tissue protection sleeve assembly 1.6 to 10mm through a skin incision (Fig. 38).

3. Insert Tocar Sleeves Insert the NCB tissue protection sleeve assembly 1.6 to 10mm through a skin incision (Fig. 38). NCB Proximal Humerus Plating System Surgical Technique 19 2. Temporary Plate Fixation The plate can be temporary fixed to the bone with 1.6mm K-wire through the proximal cannulated fixation screw of the

More information

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons Neuron, Volume 96 Supplemental Information Ca V 2.2 Gates Calcium-Independent but Voltage-Dependent Secretion in Mammalian Sensory Neurons Zuying Chai, Changhe Wang, Rong Huang, Yuan Wang, Xiaoyu Zhang,

More information

Sequence-Dependent Sorting of Recycling Proteins by Actin-Stabilized Endosomal Microdomains

Sequence-Dependent Sorting of Recycling Proteins by Actin-Stabilized Endosomal Microdomains Sequence-Dependent Sorting of Recycling Proteins by Actin-Stabilized Endosomal Microdomains Manojkumar A. Puthenveedu, 1, * Benjamin Lauffer, 2 Paul Temkin, 2 Rachel Vistein, 1 Peter Carlton, 3 Kurt Thorn,

More information

Visualization of Human Disorders and Genes Network

Visualization of Human Disorders and Genes Network Visualization of Human Disorders and Genes Network Bryan (Dung) Ta Dept. of Computer Science University of Maryland, College Park bryanta@cs.umd.edu I. INTRODUCTION Goh et al. [4] has provided an useful

More information

SYNAPTIC COMMUNICATION

SYNAPTIC COMMUNICATION BASICS OF NEUROBIOLOGY SYNAPTIC COMMUNICATION ZSOLT LIPOSITS 1 NERVE ENDINGS II. Interneuronal communication 2 INTERNEURONAL COMMUNICATION I. ELECTRONIC SYNAPSE GAP JUNCTION II. CHEMICAL SYNAPSE SYNAPSES

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

TRANSMISSION ELECTRON MICROSCOPY

TRANSMISSION ELECTRON MICROSCOPY TRANSMISSION ELECTRON MICROSCOPY NEGATIVE STAINS, IMMUNO-SPECIFIC LABELING (ISEM), THIN SECTIONING OF FIXED AND EMBEDDED MATERIAL PM 7/126 (1) ELECTRON MICROSCOPY IN DIAGNOSIS OF PLANT VIRUSES EPPO BULLETIN

More information

Actin Depolymerization Disrupts Tight Junctions via Caveolae-mediated Endocytosis V

Actin Depolymerization Disrupts Tight Junctions via Caveolae-mediated Endocytosis V Molecular Biology of the Cell Vol. 16, 3919 3936, September 2005 Actin Depolymerization Disrupts Tight Junctions via Caveolae-mediated Endocytosis V Le Shen and Jerrold R. Turner Department of Pathology,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images

More information

BONE HISTOLOGY SLIDE PRESENTATION

BONE HISTOLOGY SLIDE PRESENTATION BONE HISTOLOGY SLIDE PRESENTATION PRESENTED BY: SKELETECH, INC. Clients and Friends: SkeleTech invites you to use these complimentary images for your own presentations or as teaching slides for bone biology.

More information

The Structure and Function of the Auditory Nerve

The Structure and Function of the Auditory Nerve The Structure and Function of the Auditory Nerve Brad May Structure and Function of the Auditory and Vestibular Systems (BME 580.626) September 21, 2010 1 Objectives Anatomy Basic response patterns Frequency

More information

Chapter 7: Membrane Structure & Function

Chapter 7: Membrane Structure & Function Chapter 7: Membrane Structure & Function 1. Membrane Structure 2. Transport Across Membranes 1. Membrane Structure Chapter Reading pp. 125-129 What are Biological Membranes? Hydrophilic head WATER They

More information

Chapter 7: Membrane Structure & Function. 1. Membrane Structure. What are Biological Membranes? 10/21/2015. Why phospholipids? 1. Membrane Structure

Chapter 7: Membrane Structure & Function. 1. Membrane Structure. What are Biological Membranes? 10/21/2015. Why phospholipids? 1. Membrane Structure Chapter 7: Membrane Structure & Function 1. Membrane Structure 2. Transport Across Membranes 1. Membrane Structure Chapter Reading pp. 125-129 What are Biological Membranes? Hydrophilic head WATER They

More information

Force Fluctuations within Focal Adhesions Mediate ECM-Rigidity Sensing to Guide Directed Cell Migration

Force Fluctuations within Focal Adhesions Mediate ECM-Rigidity Sensing to Guide Directed Cell Migration Force Fluctuations within Focal Adhesions Mediate ECM-Rigidity Sensing to Guide Directed Cell Migration Sergey V. Plotnikov, 1 Ana M. Pasapera, 1 Benedikt Sabass, 2 and Clare M. Waterman 1, * 1 Cell Biology

More information

Supplemental Information. Memory-Relevant Mushroom Body. Output Synapses Are Cholinergic

Supplemental Information. Memory-Relevant Mushroom Body. Output Synapses Are Cholinergic Neuron, Volume 89 Supplemental Information Memory-Relevant Mushroom Body Output Synapses Are Cholinergic Oliver Barnstedt, David Owald, Johannes Felsenberg, Ruth Brain, John-Paul Moszynski, Clifford B.

More information

I. Why do cells reproduce?

I. Why do cells reproduce? Chapter 10: How Cells Divide I. Why do cells Reproduce? II. Cell Division in Prokaryotes III. Structure of Chromosomes IV. Mitosis V. Cell Cycle Control I. Why do cells reproduce? A. Single celled organisms

More information

Kristiina Kanerva, Riikka-Liisa Uronen, Tomas Blom, Shiqian Li, Robert Bittman, Pekka Lappalainen, Johan Peränen, Graça Raposo, and Elina Ikonen

Kristiina Kanerva, Riikka-Liisa Uronen, Tomas Blom, Shiqian Li, Robert Bittman, Pekka Lappalainen, Johan Peränen, Graça Raposo, and Elina Ikonen Developmental Cell, Volume 27 Supplemental Information LDL Cholesterol Recycles to the Plasma Membrane via a Rab8a-Myosin5b-Actin- Dependent Membrane Transport Route Kristiina Kanerva, Riikka-Liisa Uronen,

More information

Endoplasmic Reticulum-Golgi Intermediate Compartment Membranes and Vimentin Filaments Participate in Vaccinia Virus Assembly

Endoplasmic Reticulum-Golgi Intermediate Compartment Membranes and Vimentin Filaments Participate in Vaccinia Virus Assembly JOURNAL OF VIROLOGY, Feb. 2002, p. 1839 1855 Vol. 76, No. 4 0022-538X/02/$04.00 0 DOI: 10.1128/JVI.76.4.1839 1855.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Endoplasmic

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

The Plasma Membrane - Gateway to the Cell

The Plasma Membrane - Gateway to the Cell The Plasma Membrane - Gateway to the Cell 1 Photograph of a Cell Membrane 2 Cell Membrane The cell membrane is flexible and allows a unicellular organism to move 3 Homeostasis Balanced internal condition

More information

Visualization of TGN to Endosome Trafficking through Fluorescently Labeled MPR and AP-1 in Living Cells V

Visualization of TGN to Endosome Trafficking through Fluorescently Labeled MPR and AP-1 in Living Cells V Molecular Biology of the Cell Vol. 14, 142 155, January 2003 Visualization of TGN to Endosome Trafficking through Fluorescently Labeled MPR and AP-1 in Living Cells V Satoshi Waguri,* Frédérique Dewitte,*

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION TITLE: Structural Basis of Signal Sequence Surveillance and Selection by the SRP-SR Complex AUTHORS and AFFILIATIONS Ottilie von Loeffelholz 1,2, Kèvin Knoops 1,2,6, Aileen Ariosa

More information

it selectively allows some molecules to pass into the organism

it selectively allows some molecules to pass into the organism Multiple Choice Quiz Procaryotic Cell Structure and Function Eucaryotic Cell Structure and Function Choose the best answer 1. The significance of the plasma membrane is that it selectively allows some

More information

Mechanical assessment by magnetocytometry of the cytosolic and cortical cytoskeletal compartments in adherent epithelial cells

Mechanical assessment by magnetocytometry of the cytosolic and cortical cytoskeletal compartments in adherent epithelial cells Biorheology 40 (2003) 235 240 235 IOS Press Mechanical assessment by magnetocytometry of the cytosolic and cortical cytoskeletal compartments in adherent epithelial cells Valérie M. Laurent, Emmanuelle

More information

Self-Organization of Dynein Motors Generates Meiotic Nuclear Oscillations

Self-Organization of Dynein Motors Generates Meiotic Nuclear Oscillations Generates Meiotic Nuclear Oscillations PLoS BIOLOGY Sven K. Vogel 1[, Nenad Pavin 2,3[, Nicola Maghelli 1, Frank Jülicher 2, Iva M. Tolić-Nørrelykke 1* 1 Max Planck Institute of Molecular Cell Biology

More information

Supplemental Information. Proprioceptive Opsin Functions. in Drosophila Larval Locomotion

Supplemental Information. Proprioceptive Opsin Functions. in Drosophila Larval Locomotion Neuron, Volume 98 Supplemental Information Proprioceptive Opsin Functions in Drosophila Larval Locomotion Damiano Zanini, Diego Giraldo, Ben Warren, Radoslaw Katana, Marta Andrés, Suneel Reddy, Stephanie

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information