Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Size: px
Start display at page:

Download "Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK"

Transcription

1 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) Priory Road Edgbaston Website: Birmingham West Midlands B5 7UG Testing performed at the above address only Site activities performed away from the locations listed above: Location details Activity BMI Edgbaston 22 Somerset Road Edgbaston Birmingham West Midlands B15 2QQ Sally Curtis Blood issue fridge for storage of blood products only; no testing occurs at this site Rowley Hall Hospital Rowley Park Stafford Staffordshire ST17 9AQ Sally Curtis Blood issue fridge for storage of blood products only; no testing occurs at this site West. Midlands Hospital Colman Hill Halesowen West Midlands B63 2AH Sally Curtis Blood issue fridge for storage of blood products only; no testing occurs at this site BMI Droitwich Spa St Andrews Road Droitwich Spa Worcestershire WR9 8DN Sally Curtis Blood issue fridge for storage of blood products only; no testing occurs at this site Assessment Manager: MP 1 of 8

2 DETAIL OF ACCREDITATION HUMAN BODY FLUIDS otherwise stated) General Biochemistry Biochemical examination activities for the purposes of clinical diagnosis. Quantitation of: Albumin Alkaline Phosphatase (ALP) Alanine Transaminase (ALT) SOP TDL-B-EQPT-015 using Rocha Cobas c311 by the following measurement principles: Bromocresol Green AMP Buffer (IFCC) Tris Buffer with PLP Amylase Aspartate Transaminase (AST) Bilirubin (total) Calcium Chloride Cholesterol Creatinine (Jaffe method) Creatinine Kinase C-Reactive protein (CRP) Gamma-glutamyl Transpeptidase (GGT) Gentamicin Glucose HDL Cholesterol G7 substrate Tris Buffer without PLP Diaz NM-BAPTA Cholesterol Oxidase Compensated Kinetic Jaffe NAC Immunoturbidimetry Carboxynitoanilide B-Galactosidase Hexokinase + G6PD PEG enzymes Assessment Manager: MP Page 2 of 8

3 otherwise stated) (cont d) otherwise stated) General Biochemistry Biochemical examination activities for the purposes of clinical diagnosis. Quantitation of: (cont d) Iron Lactate dehydrogenase (LDH) Magnesium Phosphate Potassium Sodium Total protein Triglycerides Uric Acid Urea Vancomycin Albumin Calcium Chloride Creatinine (Jaffe method) SOPs TDL-B-EQPT-015 using Rocha Cobas c311 by the following measurement principles: Ferrozine L to P glucamine Xylidil Blue Phosphomolybdate Biuret Total Glycerol GPD Endpoint Uricase Kinetic Urase G6PD enzyme imuno assay SOP TDL-B-EQPT-001 using Rocha Cobas c111 by the following measurement principles: Bromocresol Green BM-BAPTA by photometry Assessment Manager: MP Page 3 of 8

4 General Biochemistry Biochemical examination activities for the purposes of clinical diagnosis. Quantitation of: (cont d) otherwise stated) (cont d) otherwise stated) Glucose Potassium Sodium Urea Beta-human chorionic gonadotrophin (HCG) Carcinoembryonic antigen Free thyroxine Oestradiol Prostate specific antigen (total) Troponin T Thyroid stimulating hormone Calculated values egfr LDL Cholesterol SOP TDL-B-EQPT-001 using Rocha Cobas c111 by the following measurement principles: Hexokinase + G6PD Kinetic Urease SOP TDL-B-EQPT-013 using Rocha Cobas e411 immunoassay by electrochemiluminescence. By calculation By Calculation Assessment Manager: MP Page 4 of 8

5 Haematology Haematology examination activities for the purposes of clinical diagnosis: Full blood count: Haemoglobin (HBG) White cell count (WBC) Red cell count (RBC) Haematocrit (HCT) Mean Cell Volume (MCV) Mean Cell Haemoglobin (MCH) Mean Cell Haemoglobin Concentration (MCHC) Platelets (PLT) Red Cell Distribution (RDW) Neutrophils (NEUT) Lymphocytes (LYMP) Monocytes (MONO) Eosinophils (EO) Basophils (BASO) Blood film assessment & cell differential Erythrocyte sedimentation rate (manual) Detection of Infectious Mononucleosis antibodies Detection of abnormal Sickle Cell Haemoglobin SOP TDL-EQPT-001 using Sysmex XS1000i by light scatter and absorption SOP TDL-H-EQPT-020 using Wrights stain using Quick Slide staining machine & microscopy SOP TDL-H-010 by manual method using Westergen SOP-TDL-H-008 using Accusay Mono SOP-TDL-H-009 using Helena HbS Solubility Screening kit Assessment Manager: MP Page 5 of 8

6 Citrated Blood Citrated Blood HUMAN BODY FLUIDS Coagulation Coagulation examination activities for the purposes of clinical diagnosis: Prothrombin time International Normalised Ratio Activated partial thromboplastin time (APTT) APTT ratio Prothrombin time International Normalised Ratio Activated partial thromboplastin time Blood Transfusion General examination activities for the purposes of clinical diagnosis: Automated blood group: A Rh D positive A Rh D negative O Rh D positive O Rh D negative B Rh D positive B Rh D negative AB Rh D positive AB Rh D negative Manual blood group SOPs TDL-H-007, TDL-EQPT-H-009 using Sysmex CA560 by photo optical clot detection By calculation SOPs TDL-EQPT-010, 011, 012 & 019 using Sysmex CA50 by photoelectric scattered light detection in conjunction with equipment manuals and standard methods as specified below: SOPs TDL-BT-021 using Diamed Gel Station by gel-based microtyping system SOP TDL-BT-025 using Bio-Rad gel cards Assessment Manager: MP Page 6 of 8

7 Blood Transfusion General examination activities for the purposes of clinical diagnosis: (cont d) in conjunction with equipment manuals and standard methods as specified below: (cont d) Electronic issue SOP TDL-BT-056 using GelStation Antibody detection and identification (automated) Rh: D, C, E, c, e, C W Kell: K, k, kp a, kp b, Js a, Js b Duffy: Fy a, Fy b Kidd: Jk a, Jk b Lewis: Le a, Le b P: P1 MNS: M, N, S, s Luth: Lu a, Lu b Xg: Xg a Antibody detection and identification (manual) Rh: D, C, E, c, e, C W Kell: K, k, kp a, Duffy: Fy a, Fy b Kidd: Jk a, Jk b Lewis: Le a, Le b P: P1 MNS: M, N, S, s Luth: Lu a, Lu b SOPs TDL-BT-021 & 023 using Diamed GelStation by gel-based microtyping system and 11 NHSBT panel cells SOP TDL-BT-023 using Diamed Gel Cards with 10 NHSBT panel cells Assessment Manager: MP Page 7 of 8

8 Blood Transfusion General examination activities for the purposes of clinical diagnosis: (cont d) in conjunction with equipment manuals and standard methods as specified below: (cont d) Manual Serological crossmatch SOP TDL-BT-087 using Diamed gel cards and indirect antibglobulin test Direct antiglobulin test Antibody phenotyping : Rh: C, E, c, e Kell: K SOP TDL-BT-021 & 024 using Diamed GelStation and gel cards SOP TDL-BT-026 using Diamed GelStation and gel cards END Assessment Manager: MP Page 8 of 8

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Laboratory locations: 60 Whitfield Street London W1N 4EU Contact:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Rapid Response Laboratory United Kingdom Contact: Gavyn Barrett Tel: +44 (0) 20 7307 7373 E-Mail: Gavyn.barrett@tdlpathology.com Website:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Laboratory locations: 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK - Cheltenham Hospital Hatherley Lane Cheltenham GL51 6SY Contact: Chris Watson Tel: +44 (0) 1242 246516 E-Mail: chris.watson@nuffieldhealth.com

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Neil Wrathall The Christie Tel: +44 (0) 161 918 7264 Wilmslow Road Fax: +44 (0) 161 446 8549 Manchester

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK HSL (Analytics) LLP Haematology and Blood Transfusion Department Barnet Hospital Wellhouse Lane Barnet EN5 3DJ Contact: Priti Patel Tel: +44

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Haematology and Blood Transfusion 3 rd Floor Pathology Directorate Darent Valley Hospital Darenth Wood Road Dartford Kent DA2

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 20 June 2017 ccredited to Haematology & Blood Tranfusion Craigavon rea Hospital

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Laboratory locations: Pathology Laboratory Ealing Hospital Uxbridge

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Laboratory locations: Schedule of ccreditation ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Royal lexandria Hospital Corsebar Road Paisley P2 9PN Contact:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Hammersmith Medicines Research Limited Cumberland Avenue Park Royal London NW10 7EW Contact: Juan Naveda Tel: +44 (0) 20 8961 4130 Fax: +44

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Laboratory locations: 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Blood Sciences Pathology Building Hull Royal Infirmary Anlaby Road Hull HU3 2JZ Contact: Dr Andrew Botham Tel: +44 (0)1482

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK University Hospitals NHS Foundation Trust Haematology and Transfusion Department Mindelsohn Way Edgbaston Contact: Tel: +44 (0) 121 371 5963

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION LANCET KENYA LIMITED UPPERHILL NAIROBI LABORATORY Co. Reg. No.: C168507 Facility Accreditation Number: is a South African National Accreditation System accredited laboratory

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Tameside and Glossop Integrated Care NHS Foundation Trust Department of Blood Sciences Tameside General Hospital New Fountain House Ashton-under-Lyne

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Biochemistry Department Poole Hospital Longfleet Road Poole BH15 2JB Contact: Dr Fergus Jack Tel: +44 (0) 1202 442 497 E-Mail: Fergus.jack@poole.nhs.uk

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Haematology & lood Transfusion East Kent Hospitals University NHS Foundation Trust William Harvey Hospital Kennington Road Willesborough

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Dr Fergus Jack Poole Hospital Tel: +44 (0) 1202 442 497 Longfleet Road E-Mail: fergus.jack@poole.nhs.uk

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Cher t s e y Lan e, Stai ne s - u pon-thames, TW18 3H R, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Cher t s e y Lan e, Stai ne s - u pon-thames, TW18 3H R, UK Schedule of Accreditation 2 Pine Trees, Cher t s e y Lan e, Stai ne s - u pon-thames, TW18 3H R, UK Department of Haematology & Blood Transfusion Levels 3 & 5 Torbay Hospital Lowe s Bridge Torquay TQ2

More information

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Manufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018

Manufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018 Acetaminophen Enzymatic, colorimetric µg/ml.09 0..0.09 0..0 0. 0. 0. 0. 9.. 9.0 0.9.0..9.. Albumin Bromcresol Purple (BCP) g/dl.0 0.0..0 0.00.. 0.0.. 0.09..9 0.0..9 0.0..0 0.0..0 0.0. Alkaline Phosphatase

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Laboratory locations: Leeds General Infirmary Old Medical School Great George Street LS1 3EX Contact: Richard Liversidge Tel: +44 (0)113 3923947

More information

Fullerton Healthcare Screening Centres

Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday

More information

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522

More information

Online catalog

Online catalog This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)

More information

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Annex to the Accreditation Certificate D-ML according to ISO 15189:2012

Annex to the Accreditation Certificate D-ML according to ISO 15189:2012 Deutsche Akkreditierungsstelle GmbH according to ISO 15189:2012 Period of validity: 31.10.2016 to 30.10.2021 Date of issue: 31.10.2016 Holder of certificate: Medlab Ghana Limited 17 Ridge Road, Roman Ridge,

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Biochemistry Department University Hospital of North Durham Durham County Durham DH1 5TW Contact: Dr Tim Lang Tel: +44 (0) 191 333 2694 Fax:

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Please contact the Client Services Team if you require further information.

Please contact the Client Services Team if you require further information. Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Bureau of Laboratory Quality Standards Page 1 of 13

Bureau of Laboratory Quality Standards Page 1 of 13 Clinical Chemistry 1. Lithium Heparin Plasma Glucose Glucose Hexokinase : Cobas c6000,c8000 2. Lithium Heparin Plasma BUN Urease,Kinetic : Cobas c6000,c8000 3. Lithium Heparin Plasma Creatinine Enzymatic

More information

CTAD as a universal anticoagulant

CTAD as a universal anticoagulant Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK lood Sciences Department Royal lackburn Hospital Haslingden Road lackburn 2 3HH United Kingdom Contact: Dayle Squires Tel: +44 (0)1254734162

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Issue No:002 Issue date: 12 February 2019 Pennine cute Hospitals NHS Trust Trust Headquarters North Manchester General Hospital Delaunays

More information

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

Inspector's Accreditation Unit Activity Menu

Inspector's Accreditation Unit Activity Menu 01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

Understanding your blood results:

Understanding your blood results: Understanding your blood results: Contents Introduction... 1 Haematology... 2 Biochemistry... 3 MB - 'Electrolytes' (Sodium, Potassium, Chloride, Bicarbonate):... 3 MB - Kidney parameters... 4 MB - Liver

More information

A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.

A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Get to know yourself better. Attend our health screening event.

Get to know yourself better. Attend our health screening event. Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening

More information

CALIBRATION SERUM - LEVEL 2 (CAL 2)

CALIBRATION SERUM - LEVEL 2 (CAL 2) CAT. NO. CAL 2350 LOT NO. 1242UN SIZE: 20 x 5ml EXPIRY: 2020-02-28 GTIN: 05055273200959 INTENDED USE For use as a Calibrator in clinical chemistry assays. RANDOX Calibration Sera are based on lyophilised

More information

Epic Labs Orderable As STAT PRIORITY As of 06/22/2016

Epic Labs Orderable As STAT PRIORITY As of 06/22/2016 ABG+HB(CORDARTERIAL) - BABY A ABG+HB(CORD ARTERIAL)- BABY B ABG+HB(CORD ARTERIAL)- BABY C ACETAMINOPHEN LEVEL ALANINE AMINOTRANSFERASE (ALT) ALBUMIN, FLUID ALBUMIN, PLEURAL FLUID ALBUMIN, SYNOVIAL FLUID

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

BC Biomedical Laboratories Adult Reference Ranges

BC Biomedical Laboratories Adult Reference Ranges BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Laboratory locations: Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK lood Sciences Department Zone 3 Laboratories

More information

CALIBRATION SERUM LEVEL 3 (CAL 3)

CALIBRATION SERUM LEVEL 3 (CAL 3) CALIBRATION SERUM LEVEL 3 (CAL 3) CAT. NO. CAL 2351 LOT NO. 907UE SIZE: 20 x 5ml EXPIRY: 2019-07-28 GTIN: 05055273200966 INTENDED USE For use as a Calibrator in clinical chemistry assays. RANDOX Calibration

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

CALIBRATION SERUM LEVEL 3 (CAL 3)

CALIBRATION SERUM LEVEL 3 (CAL 3) CALIBRATION SERUM LEVEL 3 (CAL 3) CAT. NO. CAL 2351 LOT NO. 709UE SIZE: 20 x 5ml EXP: 2016-12 INTENDED USE For use as a Calibrator in clinical chemistry assays. RANDOX Calibration Sera are based on lyophilised

More information

CLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800)

CLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800) ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts 01886 (800) 665-2575 MICROBIOLOGY Bacteriology Aerobic Culture and Identification Antibiotic Susceptibility Testing Direct Antigen Detection Gram Stain

More information

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated

More information

Analyte Specimen Demographic Reference Range Units

Analyte Specimen Demographic Reference Range Units Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3

More information

CLINICAL CHEMISTRY REAGENTS. Product Profile

CLINICAL CHEMISTRY REAGENTS. Product Profile Product Profile Why Clinical Chemistry Reagents? Quantitative determination of specific analytes associated with various types of disease. Diagnosis Identifying a disease already present Prognosis Forecasting

More information

Evaluation of new MiniCollect Z Serum (Separator) Tubes

Evaluation of new MiniCollect Z Serum (Separator) Tubes Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube

More information

Get to know yourself better. Attend our health screening event.

Get to know yourself better. Attend our health screening event. Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION

More information

HEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE

HEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE HEALTH SCREEN CARE VIGNE Healthcare provides a comprehensive Health Screening Package of Silver Gold Platinum Cancer EXCLUSIVE HEALTH SCREENING EXPERIENCE Meet & Greet Medical Review with Doctor Appointment

More information

10 Essential Blood Tests PART 1

10 Essential Blood Tests PART 1 Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com

More information

M Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES

M Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES M Series Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES ABOUT MINMED We are a progressive medical group that enlarges organically by growing constantly,

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Department of Clinical Biochemistry Royal Preston Hospital Sharoe

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Schedule of ccreditation United Kingdom ccreditation Service HSL (nalytics) LLP ccredited to Department of Clinical iochemistry (Chemical Pathology) arnet and Chase Farm Hospitals Wellhouse Lane arnet

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017

M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory

More information

LIQUID ASSAYED CHEMISTRY CONTROL PREMIUM PLUS - LEVEL 1 (LIQ CHEM ASY PREMIUM PLUS 1)

LIQUID ASSAYED CHEMISTRY CONTROL PREMIUM PLUS - LEVEL 1 (LIQ CHEM ASY PREMIUM PLUS 1) 0086 LIQUID ASSAYED CHEMISTRY CONTROL PREMIUM PLUS - LEVEL 1 (LIQ CHEM ASY PREMIUM PLUS 1) CAT. NO. LAL 4213 LOT NO. 238UL SIZE: 12 x 5 ml EXPIRY: 2018-04-28 GTIN: 05055273209006 INTENDED USE This product

More information

GRADING CRITERIA for CMS Regulated Analytes

GRADING CRITERIA for CMS Regulated Analytes CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers

More information

HUMAN ASSAYED MULTI-SERA - LEVEL 2 (HUM ASY CONTROL 2)

HUMAN ASSAYED MULTI-SERA - LEVEL 2 (HUM ASY CONTROL 2) 0843 HUMAN ASSAYED MULTI-SERA - LEVEL 2 (HUM ASY CONTROL 2) CAT. NO. HN1530 / HS2611 LOT NO. 899UN SIZE: 20 x 5ml / 5 x 5ml EXPIRY: 2018-02 INTENDED USE This product is intended for in vitro diagnostic

More information

NABL Deportment of Science E Technologv, lndiq

NABL Deportment of Science E Technologv, lndiq BL Deportment of Science E Technologv, lndiq DITATI Paliwa! Diagnostics Pvt. Ltd., 1 17lH-1102, Pandu Nagar, Kanpur Medicaling 1 ofs Specific Method Range of ing I CY o/o I. CLINICAL BIOCHEMISTRY t. PLASMA/SERUM/

More information

Health Screening for Nanyang Technological University (NTU)

Health Screening for Nanyang Technological University (NTU) Health Screening for Nanyang Technological University (NTU) Health screening packages are offered at corporate rates to NTU staff and dependents at the indicated clinics. Please refer to this document

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

Physician Office Laboratory Tests

Physician Office Laboratory Tests Important Change Effective March 1, 2018 Physician Office Laboratory Tests Molina Healthcare of Michigan has updated its list of payable laboratory tests that may be performed in a physician s office.

More information

HUMAN ASSAYED MULTI-SERA - LEVEL 3 (HUM ASY CONTROL 3)

HUMAN ASSAYED MULTI-SERA - LEVEL 3 (HUM ASY CONTROL 3) 0086 HUMAN ASSAYED MULTI-SERA - LEVEL 3 (HUM ASY CONTROL 3) CAT. NO. HE1532 / HS2611 LOT NO. 789UE SIZE: 20 x 5ml / 5 x 5ml EXP: 2019-05 INTENDED USE This product is intended for in vitro diagnostic use

More information

Research Data Available

Research Data Available Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION LANCET LABORATORIES Registration No: 4120108883 Facility Accreditation Number: MED 006 is a SADCAS accredited Medical Laboratory provided that all SADCAS conditions are complied

More information

CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE

CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE Croatian Centre for Quality Assessment in Laboratory Medicine Dear colleagues, Boskoviceva 18, 10000 Zagreb Croatia Tel/Phone & Fax: +385

More information

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such

More information

Questionnaire. Traceability in EQA. Traceability

Questionnaire. Traceability in EQA. Traceability Questionnaire in EQA QUESTIONNAIRE ON TRACEABILITY QUESTIONNAIRE ON TRACEABILITY GENERAL INFORMATION Name EQA organisation Country Specify the total number of measurands in the schemes of your EQA organisation

More information

What if you could help your team realise their health goals?

What if you could help your team realise their health goals? What if you could help your team realise their health goals? Realise Health Plans combine clinical data, lifestyle information and health coaching to help your employees understand their health and make

More information

HUMAN ASSAYED MULTI-SERA - LEVEL 2 (HUM ASY CONTROL 2)

HUMAN ASSAYED MULTI-SERA - LEVEL 2 (HUM ASY CONTROL 2) 0120 HUMAN ASSAYED MULTI-SERA - LEVEL 2 (HUM ASY CONTROL 2) CAT. NO. HN1530 / HS2611 LOT NO. 995UN SIZE: 20 x 5ml / 5 x 5ml EXP: 2018-12 INTENDED USE This product is intended for in vitro diagnostic use,

More information

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

1. Purpose 1.1. To define testing locations, schedule and order priority for each test performed in the core laboratory.

1. Purpose 1.1. To define testing locations, schedule and order priority for each test performed in the core laboratory. Department Of Pathology GEN.1017.03 Integrated Test Schedule Version# 5 Department Specimen Processing POLICY NO. 1938 PAGE NO. 1 OF 6 Printed copies are for reference only. Please refer to the electronic

More information

The following is a list of Fee-for-Service (FFS) outpatient laboratory Facility Approval Categories by fee item.

The following is a list of Fee-for-Service (FFS) outpatient laboratory Facility Approval Categories by fee item. MINISTRY OF HEALTH FEE FOR SERVICE OUTPATIENT LABORATORY FACILITY APPROVAL CATEGORIES October 1, 2015 Revised March 15, 2019 Introduction The following is a list of Fee-for-Service (FFS) outpatient laboratory

More information

Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments

Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments Med Chem 535P ~ Diagnostic Medicinal Chemistry General Comments Most blood chemistry and serology assays are performed automatically. Larger clinical laboratories often use sophisticated analyzers that

More information

Ascend Clinical Reference Ranges (July 2018) Chemistry

Ascend Clinical Reference Ranges (July 2018) Chemistry 24 Hour Urine Creatinine mg/24 hr 800-2000 (Male) Kinetic Alkaline Picrate (Jaffe Reaction) for 24 hour Urine Creatinine Clearence (Creatinine ml/min/1.73m^2 Clearance) 600-1800 (Female) 85-125 (Male)

More information

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300 Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness

More information