Control of energy metabolism on reproduction: a mechanism maintained during evolution
|
|
- Antonia Vivien Daniel
- 6 years ago
- Views:
Transcription
1 Control of energy metabolism on reproduction: a mechanism maintained during evolution Sara Della Torre Lab. A. Maggi Center of Excellence in Neurodegenerative Diseases (CEND) Department of Pharmacological Sciences University of Milan
2 The physiological roles of Estrogen Brain Heart Liver Breast Ovary Uterus Vagina Bone
3 Estrogen and Estrogen Receptors 95% 60%
4 Estrogen Receptor: mechanisms of action
5 The ERE-Luc reporter mouse: a paradigmatic model to study of ER transcriptional activity Luciferin + ATP + O 2 = oxyluciferin + AMP + LIGHT Activated Estrogen Receptor ERE-luc transgenic mouse Activated Estrogen Receptor TK +/- +/- INSULATOR ( MAR ) ERE 2x firefly luciferase luciferin + ATP = oxyluciferin + AMP + light INSULATOR ( MAR ) in vivo Bioluminescence Imaging, imaging BLI (CCD (CCD camera) ex vivo Enzymatic Enzimatic assay (luminometer) (luminomiter) Ciana et al., 2001
6 Photon Emission ERE-Luc mouse: a tool to study ER transcriptional activity Treatment with 17 -estradiol Maggi et al., 2009
7 ERE-Luc ad libitum with estrogen-free food evening morning LIVER BLI n = 15 p < evening ( pm) morning ( am) EVIDENCE: The ingestion of estrogen-free food results in a significant increase in the ER transcriptional activity in liver. (Ciana et al., 2005)
8 We decided to define the nature of the signalling responsible for liver ER activity and its physiological meaning With 2 different approaches: Calorie Restriction Components of diet Giuseppe Arcimboldo, "The market gardener
9 Effects on ER transcriptional activity Females ERE-Luc subjected to 40% CR weeks AL = ad libitum CR = calorie restriction Acquisitions done in the MORNING
10 Cts/s Effects on LIVER ER activity and mrna expression Females ERE-Luc subjected to 40% CR RLU/ g proteins LUC mrna rel. exp. A in vivo * ** ** ** Time (weeks) C ex vivo * * Time (weeks) B 2 1 ** ** Time (weeks) CONCLUSIONS: 1. CR induced a significant decrease in ER activity in LIVER 2. CR did not affect LIVER ERα mrna
11 Which component of diet is it responsible for LIVER ER activity? in vivo - Gavage to ERE-Luc mice C: carbohydrates AA: amino acids L: lipids +75% +60% CONCLUSION: Amino acids are responsible of inducing ER activity in LIVER of ERE-Luc mice
12 Do amino acids have a DIRECT effect on liver ER activity? Gavage to ERE-Luc mice AA: amino acids ICI: ICI182,780 (ER antagonist) in vivo ex vivo CONCLUSION: Amino acids dependent luciferase accumulation requires ER activation
13 Do amino acids have a DIRECT effect on ER activity? in vitro primary hepatocyte culture from ERE-Luc mice BCH: AA-uptake inhibitor CONCLUSION: Amino acids are responsible of inducing ER activity ALSO in ERE-Luc hepatocytes in culture.
14 Do amino acids have a DIRECT effect on liver ER activity? in vitro HepG2 cells transfected with ERE-Luc reporter +/- ER CONCLUSION: Amino acids are responsible of inducing ER activity ALSO in HepG2 cells co-transfected with ERE-Luc reporter and ERα.
15 About the mechanism in vitro HepG2 cells co-transfected with ERE-Luc reporter and ER IN PROGRESS Rapa: Rapamycin Ly: Ly H-89: mtor inhibitor PI3K inhibitor PKA inhibitor CONCLUSIONS: The mechanism of AA induction of ER activity seems to be mtor dependent.
16 About the mechanism in vitro HepG2 cells co-transfected with ERE-Luc reporter and ER (WT and mutants) IN PROGRESS CONCLUSION: The mechanism of AA induction of ER activity requires the phosphorylation of S167 and/or Y537.
17 LIVER is a sex steroid-responsive organ (ERα is expressed in liver) the major site of GH-regulated metabolism the primary source of circulating IGF-1 the role of ERs in the LIVER remains to be elucidated
18 LID/ERE-Luc ERE-Luc Effects of 40% CR on estrous cycle progression Females ERE-Luc B Weeks of CR CONCLUSION: Calorie restriction decrease ER activity in liver and induces the blockade of estrous cycle.
19 1. CR ER activity in liver 2. CR fertility 3. AA ER activity in liver 4. CR + AA fertility?
20 Regular diet versus hyper-proteic diet (+40% proteins) Females ERE-Luc subjected to 40% CR 66% 14% regular diet AL regular diet CR hyperproteic diet AL hyperproteic diet CR CONCLUSION: Dietary proteins rescue mice from CR-induced blockade of the estrous cycle.
21 Hyp: Liver ER activation could represent a permissive signal for the reproductive organs. HOW??? IGF-1 IGF-1
22 Circulating IGF-1 levels in vivo - Females ERE-Luc *P<0.05; **P<0.01; ***P<0.001 (vs.p); P<0.05 (vs. time 0) *P<0.05 (vs reg diet AL) CONCLUSION: Amino acids are important to maintain liver IGF-1 production
23 Circulating IGF-1 levels in vivo - Gavage to ERE-Luc mice CONCLUSIONS: 1. Amino acids increase liver IGF-1 output 2. this effect require transcriptional activation of ER
24 LERKO: liver ERα KO mice
25 Circulating IGF-1 levels in LERKO mice Physiological conditions and after Calorie Restriction CONCLUSIONS: 1. ER is involved in liver IGF-1 output 2. in LERKO CR sligthly decrease IGF-1 synthesis
26 Effect on estrous cycle progression Females LERKO subjected to 40% CR ERα flox/flox AL days Proestrus Estrus Metestrus Diestrus ERα flox/flox CR days LERKO AL after CR LERKO mice: IGF-1 Susceptibility to CR days after CR
27 WHAT is the role of circulating IGF-1??? Is IGF-1 signaling involved in the progression of the estrous cycle?? 2 different approaches: - a pharmacological blockade of IGF-1 signaling (JB3, IGF1-R antagonist) - a genetic mouse model (LID = liver IGF-1 KO)
28 ERE ERE TK ERE ERE TK LID: liver IGF-1 KO mice IGF-1 floxed Alb-Cre recombinase loxp ERE-Luc LID Liver IGF-1 deficient 75% less IGF-1 loxp LID-ERE-Luc Della Torre et al., Cell Metabolism, 2011
29 Impaired IGF-1 signaling is associated to altered estrous cycle ERE-Luc (controls) 4 days cycle ERE-Luc + JB3 7 days cycle LID-ERE-Luc Della Torre et al., Cell Metabolism, 2011
30 Circulating IGF-1 is necessary for a proper progression of the estrous cycle Hypothesis: Circulating IGF-1 could participate in the control of the activity of reproductive organs
31 Effect on estrous cycle progression Females ERE-Luc and LID/ERE-Luc subjected to 40% CR Weeks of CR CONCLUSION: Circulating IGF-1 has a role in the communication of the energetic status to the reproductive tissues.
32 Estrous cycle progression: focus on UTERUS
33 ISHIKAWA cells as model of uterine proliferation CONCLUSIONS: 1. Uterine cell proliferation requires IGF-1 2. Uterine cell proliferation is ER-dependent
34 ER and IGF activity in the UTERUS IHC E 2 max IGF-1 max E 2 min IGF-1 min E 2 min IGF-1 P E M D E 2 IGF-1 CONCLUSION: IGF-1 and IGF1-R are strongly involved in the progression of the reproductive cycle.
35 CONCLUSIONS 1. In mice liver ER is a sensor of amino acids availability necessary for the control of fertility. 2. Liver ER controls fertility regulating the levels of circulating IGF-1. Dietary amino acids Liver ER
36 FOOD INTAKE and REPRODUCTION C. elegans
37 (insulin) (IGF1) DAUER PATHWAY in C. elegans (PI3K) (IR/IGF1R) (PTEN) (AKT) (CYP450) (FOXO1) (NHR) (FOXO1) Modified from Von Stetina et al., Genome Biology, 2007.
38 Fontana et al., Science 2010
39 ACKNOWLEDGMENTS A. MAGGI Lab Center of Excellence on Neurodegenerative Diseases Department of Pharmacological Sciences University of Milan Adriana Maggi Gianpaolo Rando (now University of Lausanne) Clara Meda Department of Endocrinology, Pathophysiology and Applied Biology, University of Milan Paolo Magni Institut de Genetique et de Biologie Moleculaire et Cellulaire Centre National de la Recherche Scientifique, France Pierre Chambon and Andrée Krust Alessia Stell Cristian Ibarra (now Karolinska Institutet) Paolo Ciana Mount Sinai School of Medecine, USA Derek LeRoith Valeria Benedusi Elisa Faggiani Giusy Monteleone Paolo Sparaciari Cristina Vantaggiato Elisabetta Vegeto University of Calabria Marcello Maggiolini Department of Structural and Cellular Biology, Tulane University School of Medicine, New Orleans, USA Brian Rowan
Sex Differences in Central Expression and Effects of Brain-Derived Neurotrophic Factor
Sex Differences in Central Expression and Effects of Brain-Derived Neurotrophic Factor Haifei Shi Department of Biology, Miami University International Conference on Endocrinology October 22, 14 Arcuate
More informationNon-Invasive Imaging of Metabolic Fluxes and Enzymatic Activity in Living Mice
on-invasive Imaging of Metabolic Fluxes and Enzymatic Activity in Living Mice Hacer KARATA, Ph.D. Postdoctoral cientist DUBIKVKAYA LAB Laboratory of Bioorganic Chemistry and Molecular Imaging (LCBIM) June-6-14
More informationMechanisms Associated with Dietary Energy Balance Effects on Tumor Development: Alterations in Growth Factor and Energy Sensing Pathways
Mechanisms Associated with Dietary Energy Balance Effects on Tumor Development: Alterations in Growth Factor and Energy Sensing Pathways John DiGiovanni, Ph.D. Professor and Coulter R. Sublett Endowed
More informationSupplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
More informationCrosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea
Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia
More informationSupplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
More informationTargeting the PI3K-Akt-mTOR pathway with GDC-0068, a novel selective ATP competitive Akt inhibitor
Targeting the PI3K-Akt-mTOR pathway with GDC-0068, a novel selective ATP competitive Akt inhibitor Josep Tabernero, Andrés Cervantes, Cristina Saura, Desamparados Roda, Yibing Yan, Kui Lin, Sumati Murli,
More informationThe Wnt/βcatenin signaling pathway
Wnt signaling is crucial for functioning of the endometrium The Role of Wnt Signaling in Uterus Development (I) and in Homeostasis (II) and Malignancy (III) of the Uterine Endometrium Leen J Blok Erasmus
More informationOriginal Article Bioluminescence imaging of estrogen receptor activity during breast cancer progression
Am J Nucl Med Mol Imaging 2016;6(1):32-41 www.ajnmmi.us /ISSN:2160-8407/ajnmmi0014104 Original Article Bioluminescence imaging of estrogen receptor activity during breast cancer progression Cristina Vantaggiato
More informationMechanisms of Calorie Restriction- Mediated Inhibition of Epithelial Carcinogenesis: Identifying Targets for Cancer Prevention
Mechanisms of Calorie Restriction- Mediated Inhibition of Epithelial Carcinogenesis: Identifying Targets for Cancer Prevention John DiGiovanni, Ph.D. Professor and Coulter R. Sublett Endowed Chair Division
More informationDesign, Synthesis and Biological Screening of Focused Libraries of New Antiestrogens
Design, Synthesis and Biological Screening of Focused Libraries of New Antiestrogens Presenter: Jelena Janjic, Dipl.Pharm. Graduate student Pharmaceutical Sciences Prof. Dr. Peter Wipf s group Dr. Billy
More informationThe role of Hepatitis C Virus in hepatocarcinogenesis
The role of Hepatitis C Virus in hepatocarcinogenesis Laura Beretta Fred Hutchinson Cancer Research Center l8 Incidence and mortality of the five most common cancers worldwide, 2000 Incidence Lung Breast
More informationFukushima-ku, Osaka. Synopsis. and LH release by investigating the effects of exogenous estrogen on the progesteroneinduced
Further Studies on the Causal Relationship between the Secretion of Estrogen and the Release of Luteinizing Hormone in the Rat FUMIHIKO KOBAYASHI, KATSUMI HARA AND TAMOTSU MIYAKE Shionogi Research Laboratory,
More informationGoals and Challenges of Communication. Communication and Signal Transduction. How Do Cells Communicate?
Goals and Challenges of Communication Reaching (only) the correct recipient(s) Imparting correct information Timeliness Causing the desired effect Effective termination Communication and Signal Transduction
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationFOXO Reporter Kit PI3K/AKT Pathway Cat. #60643
Data Sheet FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643 Background The PI3K/AKT signaling pathway is essential for cell growth and survival. Disruption of this pathway or its regulation has been linked
More informationAltered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control
Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control Jan Trost Prof. Gudrun A. Brockmann Humboldt Universität zu Berlin Department of Crop and Animal Sciences Breeding Biology and Molecular
More informationFemale Reproductive System. Justin D. Vidal
Female Reproductive System Justin D. Vidal If you cannot identify the tissue, then it is probably part of the female reproductive system! Introduction The female reproductive system is constantly changing,
More informationSupplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationGENERAL SUMMARY Corpus luteum is a transient endocrine structure formed from the ruptured ovarian follicle. Its main function is to secrete P 4, a pro
Corpus luteum is a transient endocrine structure formed from the ruptured ovarian follicle. Its main function is to secrete P 4, a pro-gestational hormone, essential for establishment and maintenance of
More informationMedicinal Chemistry. February - June, Prof. Elena Goun
Medicinal Chemistry February - June, 2018 Prof. Elena Goun Laboratory of Bioorganic Chemistry and Molecular Imaging (LCBIM) Imaging beyond the Proteome http://lcbim.epfl.ch Elena Dubikovskaya 12/15/10
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationSupplementary Figure 1. Expression of the inducible tper2 is proportional to Dox/Tet concentration in Rosa-DTG/Per2 Per2-luc/wt MEFs.
Supplementary Figure 1. Expression of the inducible tper2 is proportional to Dox/Tet concentration in Rosa-DTG/Per2 Per2-luc/wt MEFs. (a) Dose-responsive expression of tper2 by Dox. Note that there are
More informationThe PI3K/AKT axis. Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia. Introduction
The PI3K/AKT axis Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia Introduction Phosphoinositide 3-kinase (PI3K) pathway are a family of lipid kinases discovered in 1980s. They have
More informationConvergent and Divergent Mechanisms in Aging and Cancer
Convergent and Divergent Mechanisms in Aging and Cancer Mariana S. De Lorenzo, PhD Department of Cell Biology & Molecular Medicine delorems@umdnj.edu LEARNING OBJECTIVES 1. To identify convergent and divergent
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationSupplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
More informationRationale Design of Combination Therapy in Prostate Cancer: Targeting the AR and PI3K pathways
Rationale Design of Combination Therapy in Prostate Cancer: Targeting the AR and PI3K pathways Brett S Carver, MD Assistant Attending, Department of Surgery/Urology Prostate Cancer Therapeutics: A Changed
More informationChapter 15: Signal transduction
Chapter 15: Signal transduction Know the terminology: Enzyme-linked receptor, G-protein linked receptor, nuclear hormone receptor, G-protein, adaptor protein, scaffolding protein, SH2 domain, MAPK, Ras,
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationGenetic modifications: from cells to organisms
Genetic modifications: from cells to organisms As an example: studying anti-cancer therapy resistance in genetically engineered mouse models (GEMMs) Sven Rottenberg Institute of Animal Pathology Images
More informationThe Role of the ErbB2/PI 3-K/Akt1 Pathway in the Development of Hormone. Department of Human Science, School of Nursing and Health Studies, Georgetown
The Role of the ErbB2/PI 3-K/Akt1 Pathway in the Development of Hormone Resistance in Breast Cancer Whitney A. Cesari Department of Human Science, School of Nursing and Health Studies, Georgetown University,
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationThe Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride
More informationResearch progress on the use of estrogen receptor agonist for treatment of spinal cord injury
Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Swapan K. Ray, PhD Professor, Department of Pathology, Microbiology, and Immunology USC School of Medicine,
More informationTBBPA. 31 August 2014 Green Science Policy Madrid, Spain. National Institutes of Health U.S. Department of Health and Human Services
TBBPA Linda S. Birnbaum, Ph.D., D.A.B.T., A.T.S. Director, National Institute of Environmental Health Sciences and National Toxicology Program Principle Investigator, National Cancer Institute 31 August
More informationExamples of questions for Cellular Immunology/Cellular Biology and Immunology
Examples of questions for Cellular Immunology/Cellular Biology and Immunology Each student gets a set of 6 questions, so that each set contains different types of questions and that the set of questions
More informationMechanisms of hormone drug resistance
Mechanisms of hormone drug resistance Ljiljana Stamatović Institute for Oncology and Radiology of Serbia Tenth UMOS Conference, Belgrade, 16-17 th May 2015. Hormone receptor-positive breast cancer (HR+
More informationSupplementary Information
Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,
More informationFOR REVIEW. BMB Reports - Manuscript Submission. Manuscript Draft. Manuscript Number: BMB
BMB Reports - Manuscript Submission Manuscript Draft Manuscript Number: BMB-18-095 Title: Insulin Receptor Substrate 2:A Bridge between Hippo and AKT Pathways Article Type: Perspective (Invited Only) Keywords:
More informationEstrogen receptor α- (ERα), but not ERβ-signaling, is crucially involved in mechanostimulation of bone fracture healing by whole-body vibration
Estrogen receptor α- (ERα), but not ERβ-signaling, is crucially involved in mechanostimulation of bone fracture healing by whole-body vibration Melanie Haffner-Luntzer et.al. published in BONE 1 Abstract
More informationShort-Term Fasting Reveals Amino Acid Metabolism as a Major Sex-Discriminating Factor in the Liver
Article Short-Term Fasting Reveals Amino Acid Metabolism as a Major Sex-Discriminating Factor in the Liver Graphical Abstract Authors Sara Della Torre, Nico Mitro, Clara Meda,..., Daniel Metzger, Donatella
More informationTITLE: "Impact of Obesity on Tamoxifen Chemoprevention in a Model of Ductal Carcinoma in Situ"
AD Award Number: W81XWH-09-1-0720 TITLE: "Impact of Obesity on Tamoxifen Chemoprevention in a Model of Ductal Carcinoma in Situ" PRINCIPAL INVESTIGATOR: Sarah Dunlap-Smith, Ph.D. CONTRACTING ORGANIZATION:
More informationClose to site of release (at synapse); binds to receptors in
Chapter 18: The Endocrine System Chemical Messengers 1. Neural 2. Endocrine 3. Neuroendocrine 4. Paracrine 5. Autocrine Endocrine System --Endocrine and nervous systems work together --Endocrine vs. Nervous
More informationRESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC)
Thursday 5 November EU-India PARTNERING EVENT Theme: Health RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) CNRS, INSERM,
More informationGenomic priming of the antisecretory response to estrogen in rat distal colon throughout the estrous cycle.
Royal College of Surgeons in Ireland e-publications@rcsi Molecular Medicine Articles Department of Molecular Medicine 1-11-2009 Genomic priming of the antisecretory response to estrogen in rat distal colon
More informationAnimal and Veterinary Science Department University of Idaho. REGULATION OF REPRODUCTION AVS 222 (Instructor: Dr. Amin Ahmadzadeh) Chapter 5
Animal and Veterinary Science Department University of Idaho REGULATION OF REPRODUCTION AVS 222 (Instructor: Dr. Amin Ahmadzadeh) Chapter 5 I. DEFINITIONS A. Endocrine Gland B. Hormone Chemical messenger
More informationHormonal regulation of. Physiology Department Medical School, University of Sumatera Utara
Hormonal regulation of nutrient metabolism Physiology Department Medical School, University of Sumatera Utara Homeostasis & Controls Successful compensation Homeostasis reestablished Failure to compensate
More informationProtein & Amino Acid Metabolism
Pathophysiology 101-823 Unit 4 Metabolism & Metabolic Disease Protein & Amino Acid Metabolism Paul Anderson FALL 2008 Learning Objectives 1. List the metabolic functions of proteins & amino acids. 2. Explain
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationLa via del segnale PI3K/AKT/mTOR Inibitori di mtor nel carcinoma mammario
La via del segnale PI3K/AKT/mTOR Inibitori di mtor nel carcinoma mammario Alessandra Modena U.O.C. Oncologia Medica Direttore: Dott.ssa Stefania Gori Ospedale Sacro Cuore - Don Calabria 29 novembre 2016
More informationThe orphan nuclear receptor small heterodimer partner mediates male infertility induced by diethylstilbestrol in mice
Research article The orphan nuclear receptor small heterodimer partner mediates male infertility induced by diethylstilbestrol in mice David H. Volle, 1,2 Mélanie Decourteix, 1,2 Erwan Garo, 3 Judy McNeilly,
More informationREPRODUCTION & GENETICS. Hormones
REPRODUCTION & GENETICS Hormones http://www.youtube.com/watch?v=np0wfu_mgzo Objectives 2 Define what hormones are; Compare and contrast the male and female hormones; Explain what each hormone in the mail
More informationOver-Activation of Hypoxia-Inducible Transcription Factor 1 alpha (HIF)-1α by Chronic Hypoxia Mediates Chronic Ischemic Renal Injury
Over-Activation of Hypoxia-Inducible Transcription Factor 1 alpha (HIF)-1α by Chronic Hypoxia Mediates Chronic Ischemic Renal Injury Romesh Dhaduk Department of Pharmocology and Toxicology Virginia Commonwealth
More information/06/$15.00/0 Molecular Endocrinology 20(9): Copyright 2006 by The Endocrine Society doi: /me
0888-8809/06/$15.00/0 Molecular Endocrinology 20(9):2062 2079 Printed in U.S.A. Copyright 2006 by The Endocrine Society doi: 10.1210/me.2005-0316 Androgens, Progestins, and Glucocorticoids Induce Follicle-Stimulating
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationCampbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 26 Hormones and the Endocrine System Multiple-Choice Questions
Campbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 26 Hormones and the Endocrine System 26.1 Multiple-Choice Questions 1) Hormones are chemicals produced by the endocrine system that
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationNNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update
NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update 1 Overview The natural growth factor IGF-1 is broken down in the body to IGF-1[1-3] NNZ-2566 is an analogue of IGF-1[1-3] developed
More informationHigh Protein Diets in Weight Reduction
High Protein Diets in Weight Reduction Effects on fat mass, muscle mass and risk factors of the metabolic syndrome Donald K. Layman and Layne E. Norton Department of Food Science & Human Nutrition University
More informationPathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
More informationDiabetes Mellitus and Breast Cancer
Masur K, Thévenod F, Zänker KS (eds): Diabetes and Cancer. Epidemiological Evidence and Molecular Links. Front Diabetes. Basel, Karger, 2008, vol 19, pp 97 113 Diabetes Mellitus and Breast Cancer Ido Wolf
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More informationInsulin Resistance. Biol 405 Molecular Medicine
Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent
More informationVictor Chaban, Ph.D., MSCR
Hormonal Modulation of Pain : Estrogen Modulation of Visceral Nociception Victor Chaban, Ph.D., MSCR Department of Internal Medicine Charles R. Drew University of Medicine and Science Department of Medicine
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationMedical Management of Endometriosis: Novel Targets and Future Treatments Erkut Attar, M.D. PhD.
Medical Management of Endometriosis: Novel Targets and Future Treatments Erkut Attar, M.D. PhD. Istanbul University Istanbul Medical School Department of Obstetrics & Gynecology Division of Reproductive
More informationINDUCTION OF OVULATION IN URETHANE-TREATED RATS
5 INDUCTION OF OVULATION IN URETHANE-TREATED RATS Ronald D. Johnson* and Barbara Shirley Faculty of Natural Sciences, University of Tulsa, Tulsa, Oklahoma 74104 Subcutaneous injection of urethane (1 g/kg
More informationSalt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice
Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice Julien Bricambert,, Catherine Postic, Renaud Dentin J Clin
More informationConnecting Links for Reducing Risks: Understanding the impact of obesity on cancer development. Kristi Acker, DNP, FNP-BC, AOCNP, ACHPN
Connecting Links for Reducing Risks: Understanding the impact of obesity on cancer development Kristi Acker, DNP, FNP-BC, AOCNP, ACHPN Objectives 1) Identify factors that contribute to the financial burden
More informationHomeostasis. Endocrine System Nervous System
Homeostasis Endocrine System Nervous System 2004-2005 Regulation Why are hormones needed? chemical messages from one body part to another communication needed to coordinate whole body homeostasis & regulation
More information1st Year MB/BDS Plenary Lecture What is a Hormone?
1st Year MB/BDS Plenary Lecture What is a Hormone? The term hormone (from the Greek for I arouse to activity or I excite) was first used by Starling in 1905. Hormones are just one type of first (or primary)
More informationSupplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationPI3Ka inactivation in leptin receptor cells increases leptin sensitivity but disrupts growth and reproduction
PI3Ka inactivation in leptin receptor cells increases leptin sensitivity but disrupts growth and reproduction David Garcia-Galiano,, Jennifer W. Hill, Carol F. Elias JCI Insight. 2017;2(23):e96728.. Research
More informationHORMONES AND CELL SIGNALLING
HORMONES AND CELL SIGNALLING TYPES OF CELL JUNCTIONS CHEMICAL SIGNALS AND MODES OF ACTION Endocrine system produces chemical messages = hormones that are transported from endocrine gland to target cell
More informationMultimedia Appendix 6 Educational Materials Table of Contents. Intervention Educational Materials Audio Script (version 1)
Multimedia Appendix 6 Educational Materials Table of Contents Intervention Educational Materials... 1 Audio Script (version 1)... 1 Text (version 1)... 5 Slides (version 1)... 17 Audio Script (version
More informationOver-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
More informationBreast Cancer Carcinogenesis: Mechanisms and Pathways in Hormone Receptor Positive Disease
Breast Cancer Carcinogenesis: Mechanisms and Pathways in Hormone Receptor Positive Disease 1 Nearly Two-Thirds of Metastatic Breast Cancers Express Hormone Receptors Breast cancer tumors are often classified
More informationEndocrine System Hormones
Endocrine System Hormones 2007-2008 Regulation Why are hormones needed? chemical messages from one body part to another communication needed to coordinate whole body homeostasis & regulation metabolism
More informationNuclear Receptors. Estrogen and Thyroid Hormone Receptors and their Interaction. Estrogen Hormone Receptor.
SZENT ISTVÁN UNIVERSITY FACULTY OF VETERINARY MEDICINE Nuclear Receptors Estrogen and Thyroid Hormone Receptors and their Interaction Lior Kerner Budapest, 2012 What are Nuclear Receptors? o Proteins located
More informationSupplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
More informationCannabinoid Type 1 Receptors in Astrocytes. Giovanni Marsicano, PhD
Cannabinoid Type 1 Receptors in Astrocytes EndoCannabinoids and NeuroAdaptation INSERM U862 NeuroCentre Magendie Bordeaux, France 1 Cannabinoid type 1 receptors in astrocytes 1964 OH O 9 -Tetrahydrocannabinol
More informationReproductive Endocrinology
Reproductive Endocrinology Reproductive Endocrinology Hypothalamic hormones Gonadotropin releasing hormone (GnRH) - stimulate release of FSH = follicle stimulating hormone LH = luteinizing hormone from
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationPAX8-PPARγ Fusion Protein in thyroid carcinoma
Sidney H. Ingbar Lecture, ATA 10/17/2013: PAX8-PPARγ Fusion Protein in thyroid carcinoma Ronald J. Koenig, MD, PhD Division of Metabolism, Endocrinology & Diabetes University of Michigan Learning Objectives
More informationChapter 20 Endocrine System
Chapter 20 Endocrine System The endocrine system consists of glands and tissues that secrete Hormones are chemicals that affect other glands or tissues, many times far away from the site of hormone production
More informationTITLE: A PSCA Promoter Based Avian Retroviral Transgene Model of Normal and Malignant Prostate
AD Award Number: DAMD17-03-1-0163 TITLE: A PSCA Promoter Based Avian Retroviral Transgene Model of Normal and Malignant Prostate PRINCIPAL INVESTIGATOR: Robert Reiter, M.D. CONTRACTING ORGANIZATION: The
More informationDissecting the Obesity-Cancer Link: Mechanistic Insights from Animal Models Stephen D. Hursting, PhD, MPH
Dissecting the Obesity-Cancer Link: Mechanistic Insights from Animal Models Stephen D. Hursting, PhD, MPH Professor and Chair Department of Nutritional Sciences University of Texas at Austin and Professor,
More informationEstrogen (ER) receptor biology: Implications for HRT? Dr. Christoph A. Meier Endocrine Unit University Hospital Geneva
Estrogen (ER) receptor biology: Implications for HRT? Dr. Christoph A. Meier Endocrine Unit University Hospital Geneva Estrogens prevent postmenopausal bone-loss HRT & osteoporosis bip & estrogen bip
More informationEndocrine Notes Mrs. Laux AP Biology I. Endocrine System consists of endocrine glands (ductless), cells, tissues secrete hormones
I. Endocrine System consists of endocrine glands (ductless), cells, tissues secrete hormones regulates metabolism, fluid balance, growth, reproduction A. Hormones 1. chemical signals-cell to cell communication
More informationFertility and early embryonic development. Chris Willoughby, Huntingdon Life Sciences 11 October 2012
Fertility and early embryonic development Chris Willoughby, Huntingdon Life Sciences 11 October 2012 Outline 2 What sort of compounds may affect fertility? What areas of reproduction are we assessing in
More informationSupplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
More informationSupplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
More informationChapter 20. Endocrine System Chemical signals coordinate body functions Chemical signals coordinate body functions. !
26.1 Chemical signals coordinate body functions Chapter 20 Endocrine System! Hormones Chemical signals Secreted by endocrine glands Usually carried in the blood Cause specific changes in target cells Secretory
More informationSuccessful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
More information