Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in
|
|
|
- Elwin Cook
- 6 years ago
- Views:
Transcription
1 9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade in human NFLD and HVC and is not expressed in hepatic stellate cells of sinusoidal endothelial cells.. Interferon regulatory factor (IRF) mrn expression in liver biopsies from control patients with normal liver (control; n=), patients with fatty liver (n=1), non-alcoholic steatohepatitis (NSH; n=) and with viral hepatitis C (HCV; n=11) stratified by their state of steatosis. B. Representative co-immunostaining images of IRF (pink stain) with erythroblast transformation-specific-related gene (ERG; brown stain) or αsmooth muscle actin (αsm; brown stain) in liver sections from selected patients, scale bar=1µm. Differences between patient groups tested by one-way NOV. 1
2 9-INS-RG-TR- B. IRF mrn expression HFDwks RP HE HFD1wks Total liver 1 Weeks on HFD F/+ cells IRF mrn expression IRF F/ Weeks on HFD Figure S. IRF expression is not modulated under high-fat feeding in mice. Representative images of histological analysis of liver sections from mice maintained on a high-fat diet (HFD) for 1 and weeks. Liver sections stained with hematoxylin and eosin (HE) red picrosirius (RP) to visualize collagen fibres. Immunohistochemical analysis of F/ and interferon regulatory factor (IRF). B. IRF mrn expression in total liver lysate and liver F/+ cells. Differences between diets/treatments determined by one-way NOV. ll values reported as mean ± SEM.
3 IRF mrn expression Hepatocytes CTRL MCD BDL CCl. CTRL MCD BDL CCl B *** IRF mrn expression 3 1 *** Total liver Hepatocytes F/ + cells F/ - cells Total liver Hepatocytes F/ + cells F/ - cells Total liver Hepatocytes F/ + cells F/ - cells Total liver Hepatocytes F/ + cells F/ - cells CTRL MCD BDL CCl Figure S3. IRF mrn expression is not modulated in hepatocytes and is restricted to F/ + cells.. Interferon regulatory factor (IRF) mrn expression in hepatocytes from mice upon normal chow (CTRL), methionine-and-choline deficient (MCD) feeding, bile duct ligation (BDL) or carbon tetrachloride (CCl ) treatment. B. IRF mrn expression from total liver lysate, isolated hepatocytes and immunoselected F/ + and F/ - cells of mice upon NC, MCD feeding, BDL or CCl. n= per group, differences between groups determined by two-way NOV. ll values reported as mean ± SEM. *p<, ** p<,1 *** p<,1. 3
4 MWT+CCl hrs F/ + LMNCs MKO+CCl hrs IRF kda ctin kda Figure S. Myeloid-specific deletion of IRF in liver F/ + cells.. Immunoblot of interferon regulatory factor (IRF) protein in immunoselected liver F/ + cells from wildtype (MWT) mice and mice with a myeloid-specific deletion of IRF (MKO) upon carbon tetrachloride (CCl ) treatment. n=3 per group, differences between groups determined by two-way NOV. ll values reported as mean ± SEM. *p<, ** p<,1 *** p<,1.
5 MWT CCl wks MKO Ccl Irf B CCL mrn expression 1 1 F/ + cells ** CCL mrn expression 1 1 F/ + cells *** MWT MKO MWT MKO MWT MKO MWT MKO Sham CCl wks Sham CCl hrs Figure S. Decreased CCL expression in IRF-deficient macrophages.. heatmap from transcriptomic analysis of chemokine (C-C motif) ligand (CCL) and interferon regulatory factor (IRF) mrn expression in liver F/ + cells from mice with myeloid specific deletion of IRF (MKO) and wild-type littermates (MWT) following experimental fibrosis (wks) by carbon tetrachloride (CCl ) administration. B. IRF mrn expression in liver F/ + cells following experimental fibrosis (wks) and acute toxicity (hrs) by CCl. N= per group. ll values reported as mean ± SEM. *p<, ** p<,1 *** p<,1.
6 B 1 kb IRF peaks ** *** Genes IRF hrs IRF peaks hrs IRF hrs IRF peaks hrs Fasl 3 3 FasL mrn expression Time of LPS stimulation (hrs) Figure S. IRF directly regulated FasL gene expression.. Representative USCS Genome Browser tracks in the Fas ligand (FasL) locus for interferon regulatory factor (IRF) of unstimulated (hrs) or LPS-stimulated (hrs) bone marrow derived macrophages (BMDM). IRF expression and binding peaks highlighted by green bands. B. FasL and IRF mrn expression in unstimulated (hrs) and LPS-stimulated (hrs and hrs) BMDM from wild-type mice (MWT) and mice with myeloid-deficiency of IRF (MKO). N=3. ll values reported as mean ± SEM. *p<, ** p<,1 *** p<,1.
7 FasL mrn expression 1 1 Fas mrn expression 3 1 < < < < Steatosis (%) Steatosis (%) B 1 9 r=.3 p<. 1 9 r=.33 p<. log ST (U/L) log ST (U/L) FasL mrn expression Fas mrn expression log LT (U/L) 1 9 r=.3 p<. log LT (U/L) 1 9 r=.39 p< FasL mrn expression Fas mrn expression log Bilirubin (mg/dl) 3 r=. p<. log Bilirubin (mg/dl) 3 r=.1 p< FasL mrn expression Fas mrn expression 1 r=-. p<.1 1 r=-.3 p<. Prothrombin time (%) 1 Prothrombin time (%) FasL mrn expression Fas mrn expression
8 Figure S. Fas and FasL expression are independent of steatosis in human liver but correlate to markers of liver damage.. Fas ligand (FasL) and Fas mrn expression in liver biopsies from control patients with normal liver (n=), patients with fatty liver (n=1), non-alcoholic steatohepatitis (NSH; n=) and with viral hepatitis C (HCV; n=11) stratified by steatosis grade. B. Correlative analyses between Fas and FasL mrn expression with plasma aspartate and alanine transaminase (ST and LT, respectively) levels, bilirubin levels and prothrombin time (PT) from the same cohort of patients (n=3). Differences between patient groups determined by one-way NOV. Correlative analyses were assessed by Spearman s test. ll values reported as mean ± SEM. *p<, ** p<,1 *** p<,1.
9 Table S1. Significantly enriched KEGG terms amongst up-regulated transcripts in IRF MKO mice versus MWT mice following experimental fibrosis by CCl KEGG TERM p-value Glycine, serine and threonine metabolism 3,x1-1 Tryptophan metabolism,x1 - Metabolism of xenobiotics by cytochrome P,1x1 - Fatty acid metabolism,1x1 - PPR signaling pathway 1,x1 - KEGG: Kyoto encyclopedia of genes and genomes; MKO: myeloid-specific knockout; MWT: wild-type; CCl : carbon tetrachloride. Table S. Significantly enriched GO terms amongst up-regulated transcripts in IRF MKO mice versus MWT mice following experimental fibrosis by CCl GO TERM p-value Carboxylic acid metabolic process,x1-3 Oxoacid metabolic process,x1-3 Fatty acid metabolic process 1,x1-11 Lipid metabolic process,x1-11 Gluconeogenesis 1,x1 - GO: gene ontology; MKO: myeloid-specific knockout; MWT: wild-type; CCl : carbon tetrachloride. 9
10 Table S3. Primers applied for PCR genotyping of MWT and MKO mice Primer IRF flox forward IRF flox reverse LyzM cre mutant LyzM cre wild-type LyzM cre common Sequence '-3' CGT GT GC CTC CT GCT CT GG GCC TGT CC G TT GG CCC G T GCC G TT CG TT CG TCG GCC GG CTG C CTT GGG CTG CC G TTT CTC 1
11 Table S. Primers applied for qrt-pcr analysis of gene expression in human and murine samples with use of SYBR green chemistry. Gene Forward sequence '-3' Reverse sequence '-3' IRF (mouse) GTGGGGCCCCTCTT GGCTTTTGTTGGGCCG F/ (mouse) CTCTGTGGCTGCCTCCCT CCTTGGGGCCTTCTGGTC Col1α1 (mouse) CCCCCGCGGCTCT GCCCCTTGTGTCTCTCCTC IRF (human) TTTTCTGCTCCCCTGGG GCTCTTGTTGGGCCGC GPDH (human) TCCCTCCCTCTTCC TGGCTCCCGCGTCTC 1S (human) TTCGCGTCTGCCCTTC TGGTGGCCGGCGCT TNF (human) CGCCTCTTCTCCTTCCTG GCCGGGGCTGTTGG IL1β (human) CGTGGTGCTCCTTCC GTCGGGTTCGTGCTGGT αsm (mouse) GGCTCTCCTTCCG CCTTCGCTCTCTCC IL1β (mouse) CCCCGTGTTTCTCCTG GTCCCCTCTCCGCTGC MHCII (mouse) GCTCTCGGGCCTTGCG CGGCCCTCTGGCC IL (mouse) CCCGGCCTTCCCTCTTC TCCCGTTTCCCGGC TNF (mouse) CCCCCGCTCTTCTGTCT CCTTGGTGGTTTGCTCG RG1 (mouse) CTTTGGGTGGTGCTCC TGGTCTCTGGGCTTTCCTTT TGFβ1 (mouse) CCCTGCCCCTTTTTGG TGGTTGTGGGGCGGC IL1 (mouse) GGTTGCCGCCTTTCGG CCTGCTCCCTGCCTTGCT CD (mouse) CCTCTGGTGCGGTGT CTTCCTTTGGTCGCTTTGG FasL (mouse) CTCCCCCTCCCCTG GTTCTGCCGTTCCTTCTGC Fas (mouse) TGTGCTGGCCCTTG TTCGGGTCTCCTGTCTCC BCL (mouse) TGGTCCTGCCGGCTCT GCTCCCGCCTCCGTTT BCL-X L (mouse) GCTGGGCCTTTTGTGGT TGTCTGGTCCTTCCGCTG Fas (human) TCGTCGGGTTGGGGG CGGCCTTCCGTTCTGG FasL (human) GCCTTTGGGTTCTTTCC CCTCCTTTGTCTGGCTCT GPDH (mouse) GTGGCCTCTGGCCTCT TGTGGGGGTGCTCGTG 1S (mouse) GGGGCCTGGCGGC GGGTCGGGGTGGGTTTT 11
12 Table S. ntibodies applied for immunohistochemical analysis of protein expression in human and murine samples. Epitope Working dilution Company Product number F/ (mouse) 1:1 bcam ab αsm (mouse) 1: bcam ab9 FasL (mouse) 1:1 bcam ab1 IRF (mouse) 1: bcam ab33 IRF (human) 1: Proteintech 1-1-P CD (human) 1: Dako M11 ERG (human) 1: bcam ab913 αsm (human) 1: Dako M1 1
13 Table S. ntibodies applied for flow cytometric analysis of murine leukocyte populations. Marker Flourochrome Product number Company Working dilution Epitope position Viability mcyan L39 Life Tech 1:1 surface TCRβ Brilliant Violet BD 1:1 surface F/ PE-Cy -- ebiosciences 1: surface CD Brilliant Violet 13 BioLegend 1: surface CD PE-eFlour ebiosciences 1:1 surface CD PerCP-Cy. 99 BD 1:3 surface CD lexa Flour -1- ebiosciences 1: surface CD PC 19 BD 1: surface CD FITC 11 BioLegend 1: surface CD19 Brilliant Violet 111 BioLegend 1:3 surface CD11c PC ebiosciences 1:1 surface CD11b Brilliant Violet 113 BioLegend 1:3 surface TNF eflour -31- ebiosciences 1: intracellular IL PE ebiosciences 1:1 intracellular IL1 Brilliant Violet 11 BD 1:1 intracellular IL13 PECy ebiosciences 1:1 intracellular Il1 PC ebiosciences 1:1 intracellular IFNγ FITC 11 BD 1:1 intracellular FoxP3 PE 1-3- ebiosciences 1:1 intracellular FSL PerCP-eFlour ebiosciences 1:3 intracellular 13
Nature Immunology: doi: /ni.3836
Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:
Supplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E
Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili
Understanding Root Cause: Pathogenesis of Hepatic Fibrosis
10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
McAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers.
Mclpine PERK-GSK3 regulates foam cell formation Supplemental Material Supplementary Table I. Sequences of real time PCR primers. Primer Name Primer Sequences (5-3 ) Product Size (bp) GRP78 (human) Fwd:
Supplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
Supplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
SUPPLEMENTAL FIGURE 1
SUPPLEMENTL FIGURE 1 C Supplemental Figure 1. pproach for removal of snorns from Rpl13a gene. () Wild type Rpl13a exonintron structure is shown, with exo in black and intronic snorns in red rectangles.
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
D CD8 T cell number (x10 6 )
IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p
Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils
Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
Stimulating healthy tissue regeneration by targeting the 5-HT 2B receptor in chronic liver disease.
Stimulating healthy tissue regeneration by targeting the 5-HT 2B receptor in chronic liver disease. Mohammad R Ebrahimkhani, Fiona Oakley, Lindsay B Murphy, Jelena Mann, Anna Moles, Maria J Perugorria,
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
Viral hepatitis, which affects half a billion people
GASTROENTEROLOGY 2006;130:435 452 BASIC LIVER, PANCREAS, AND BILIARY TRACT Natural Killer Cells Ameliorate Liver Fibrosis by Killing Activated Stellate Cells in NKG2D-Dependent and Tumor Necrosis Factor
(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,
1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of
Supplementary Figures
Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,
Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
Exploring a Link Between Spy1 and Hepatocellular Carcinoma Progression
University of Windsor Scholarship at UWindsor UWill Discover Undergraduate Conference UWill Discover 2016 Mar 29th, 4:00 PM - 5:00 PM Exploring a Link Between Spy1 and Hepatocellular Carcinoma Progression
CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'
Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action Supplementary Figure : Expression levels of toll-like receptor 4 (Tlr4) in muse lung does not change throughout the
Supplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1
Takamura_Fig. S1 brain heart lung spleen stomach colon kidney SM Supplemental Figure 1 Histological findings of tg5 flox/flox ;CG-Cre mouse tissues. H&E staining of the brain, heart, lung, spleen, stomach,
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype
J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high
Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer
Supplementary Information Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer Grit S. Herter-Sprie, Shohei Koyama, Houari Korideck, Josephine Hai, Jiehui Deng, Yvonne Y. Li, Kevin A. Buczkowski,
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.
Cell cycle analysis For cell cycle analysis, single cell suspensions of E12.5 fetal liver cells were suspended in 4 ml ice-cold 7% ethanol with gentle vortexing, incubated at -2 C for 4 hours, and washed
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
Supplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N
MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using
c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
Supplemental Figures: Supplemental Figure 1
Supplemental Figures: Supplemental Figure 1 Suppl. Figure 1. BM-DC infection with H. pylori does not induce cytotoxicity and treatment of BM-DCs with H. pylori sonicate, but not heat-inactivated bacteria,
Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A
Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride
Pair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade
Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha
Loyer, et al. microrna-21 contributes to NASH Suppl 1/15
Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 SUPPLEMENTARY MATERIAL: Liver MicroRNA-21 is Overexpressed in Non Alcoholic Steatohepatitis and Contributes to the Disease in Experimental Models
MS/MS analysis of plasma from AD patients and healthy volunteers (n=8 healthy volunteers
Figure S. PGFα, - and -HETE are elevated in of patients with Acute Decompensation (AD) when compared with healthy volunteers. (a-g) Lipidomic LC/ESI- MS/MS analysis of from AD patients and healthy volunteers
Supplemental Data. Epithelial-Macrophage Interactions Determine Pulmonary Fibrosis Susceptibility in. Hermansky-Pudlak Syndrome
Page 1 Supplemental Data Epithelial-Macrophage Interactions Determine Pulmonary Fibrosis Susceptibility in Hermansky-Pudlak Syndrome Lisa R. Young, Peter M. Gulleman, Chelsi W. Short, Harikrishna Tanjore,
10/10/2015. Disclosure. Fatty Liver Disease Significance in Children
Mixed Lineage Kinase 3 Mediates Release of C-X-C Motif Ligand 10-earing Extracellular Vesicles from lipotoxic hepatocytes 10/10/2015 Samar H. Ibrahim, Petra Hirsova, Steven F. ronk, Nathan W. Werneburg,
Online supplement. Xiaoyu Wang, Michael Hausding, Shih-Yen Weng, Yong Ook Kim, Sebastian Steven, Thomas Klein, Andreas Daiber, Detlef Schuppan
Wang et al. - DPP-4 inhibition, NSH and vascular dysfunction online supplement Online supplement Gliptins suppress inflammatory macrophage activation to mitigate inflammation, fibrosis, oxidative stress
Kerdiles et al - Figure S1
Kerdiles et al - Figure S1 a b Homo sapiens T B ce ce l ls c l M ls ac r PM oph N ag es Mus musculus Foxo1 PLCγ Supplementary Figure 1 Foxo1 expression pattern is conserved between mouse and human. (a)
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
Probe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,
a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
Kinase-independent functions of RIPK1 regulate hepatocyte survival and liver carcinogenesis
The Journal of Clinical Investigation Kinase-independent functions of RIPK1 regulate hepatocyte survival and liver carcinogenesis Trieu-My Van, 1,2,3 Apostolos Polykratis, 1,2,3 Beate Katharina Straub,
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Systems biology approaches and pathway tools for investigating cardiovascular disease
Systems biology approaches and pathway tools for investigating cardiovascular disease Craig E. Wheelock 1,2*, Åsa M. Wheelock 2,3,4, Shuichi Kawashima 5, Diego Diez 2, Minoru Kanehisa 2,5, Marjan van Erk
Title. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL)
Title Toll-like receptor 3 signal augments radiation-induc Yoshida, Sumito; Shime, Hiroaki; Takeda, Yohei; Nam, Author(s) Hiroki; Kasahara, Masanori; Seya, Tsukasa CitationCancer science, 19(): 956-965
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
Optimizing Intracellular Flow Cytometry:
Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors Presented by Jurg Rohrer, PhD, BD Biosciences 23-10780-00 Outline Introduction Cytokines Transcription
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
![Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.](/thumbs/90/103696086.jpg "Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.")
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
Supplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
SUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
SUPPLEMENTARY RESULTS
SUPPLEMENTARY RESULTS Supplementary Table 1. hfpr1- Flpln-CHO hfpr2-flpln-cho pec 50 E max (%) Log( /K A) Log( /K A) N pec 50 E max (%) Log( /K A) Log( /K A) n ERK1/2 phosphorylation fmlp 9.0±0.6 80±7
without LOI phenotype by breeding female wild-type C57BL/6J and male H19 +/.
Sakatani et al. 1 Supporting Online Material Materials and methods Mice and genotyping: H19 mutant mice with C57BL/6J background carrying a deletion in the structural H19 gene (3 kb) and 10 kb of 5 flanking