Chapter 4 INSIG2 Polymorphism and BMI in Indian Population
|
|
- Shona Wiggins
- 5 years ago
- Views:
Transcription
1 Chapter 4 INSIG2 Polymorphism and BMI in Indian Population
2 4.1 INTRODUCTION Diseases like cardiovascular disorders (CVD) are emerging as major causes of death in India (Ghaffar A et. al., 2004). Various studies have shown that higher body mass index (BMI) or accelerated gain in BMI is associated with an increased risk for CVD (Must A et. al., 1992; Dietz WH et. al., 1998; Eriksson JG et. al., 2001; Gunnell DJ et. al., 1998;). BMI is used as a surrogate measurement for obesity and is calculated as weight/(height) 2 in kg/m 2. Individuals with a BMI > 25 kg/m 2 are classified as overweight and those with a BMI >30 kg/m 2 are considered obese. The incidence of obesity worldwide is on the rise and has reached epidemic proportions in many developed and developing countries. According to the World Health Organization, there are an estimated 1 billion adults who are overweight and 300 million of these are considered clinically obese. The criterion of being obese can vary in different ethnic groups. South Asians have a lower muscle mass and a higher percentage body fat. They are more centrally obese than the whites of comparable ages and BMIs (McKeigue PM et. al., 1991; Chowdhury B et. al., 1996; Banerji MA et. al., 1999; Chandalia M et. al., 1999; Yajnik CS, 2004; Yajnik CS et. al., 2004). In India, modified World Health Organization guidelines are used to define obesity. According to these guidelines, individuals with BMI > 23kg/m 2 are classified as overweight while those with BMI > 25 kg/m 2 are defined as obese (Sachdev HS et. al., 2005). Obese individuals are at an increased risk of suffering from Type 2 Diabetes mellitus, CVD, metabolic syndrome, hypertension, stroke resulting in premature mortality (Vanhala M et. al., 1998). The current trend of decreased physical activity and increased caloric intake acting on a person s genetic makeup is mainly attributable to the rise in obesity. The common forms of obesity have a strong genetic component. Based on family studies and twin studies it has been estimated that the heritability of obesity ranges from 30% to 70% (Allison DB et. al., 1996). Several studies have shown associations between BMI or obesity and common genetic variants (Perusse L et. al., 2003; Duarte SF et. al., 2006). However, none of these have been consistently replicated. There are many interesting 80
3 candidate genes in the list including leptin (Duarte SF et. al., 2006), melanocortin 4 receptor (MC4R) (Perusse L et. al., 2003). The leptin and melanocortin pathways are assumed to play important roles in rare obesity cases and not the common forms of obesity. Linkage studies have also been carried out to identify regions linked to obesity albeit with limited success as the results vary greatly (Deng HW et. al., 2002). Recently, Herbert et. al. used a dense whole-genome scan of DNA samples from families enrolled in the Framingham Heart Study and identified a common genetic variant (rs ) about 10 kb upstream of the transcription start site of Insulin induced gene 2 (INSIG2) (Herbert A et. al., 2006). They reported the association of the CC genotype with obesity in three different family-based samples and three studies of unrelated individuals. Furthermore, a meta analysis of case-control samples showed that the CC genotype was significantly associated with obesity under recessive model. The protein product of INSIG2 inhibits the synthesis of fatty acid and cholesterol and thus in individuals with altered INSIG2 activity it can be perceived to result in obesity due to elevated triglyceride levels with subsequent storage in adipose tissues (Yabe D et. al., 2002). Interestingly, INSIG2 region has been identified as a factor in obesity by linkage studies both in mice and humans (Deng HW et. al., 2002; Cheverud JM et. al., 2004). In our AIIMS study, we have found that CAD patients had a significantly higher BMI than controls after adjusting for other confounding factors like diet, age, sex, homocysteine levels, vitamin B12 levels, hypertension, diabetes mellitus etc. Increased BMI increases the mortality in adult and elderly patients with CAD (Stevens J et. al., 1998; Rea TD et. al., 2001). In this study, we thus attempted to find out if the genetic variant rs upstream of INSIG2 gene is associated with BMI, as reported by Herbert et. al. in a cohort of 610 unrelated CAD patients and controls from our AIIMS study individuals. Since India has a large social, cultural, linguistic and biological diversity, we also screened more than 1500 individuals from various parts of the country and checked for the association of this variant with BMI. 81
4 4.2 MATERIALS AND METHODS Individuals were recruited as a part of the Indian Genome Variation Consortium (IGVC) project from various populations based on certain criteria that include linguistic lineages, ethnicity, geographical location etc. Keeping in view the linguistic and geographical diversity in India, we genotyped 1577 individuals from 37 sub-populations belonging to three linguistic lineages (Indo European, Dravidian and Tibeto-Burman) from different geographical locations of the country. Blood samples were also collected from a cohort consisting of 255 angiographically proven CAD patients and 355 controls recruited at a tertiary care centre, New Delhi, India. Individuals in this cohort consisted mainly of Indo-European linguistic lineage. The ethics committee approved this study. Written consent was obtained from all the participants. A detailed questionnaire was filled for each individual that included information about subject s height, weight measurements, etc. Blood samples were collected from volunteers into tubes containing anticoagulant and plasma was separated from the blood samples within an hour of collection. DNA was isolated from the blood samples after removal of the plasma using the modified salting out method as described earlier (Miller SA et. al., 1988). Oligonucleotides for PCR and genotyping were designed using the primer select module of the software DNA star (Table 4.1). Table 4.1: List of oligonucleotides used for PCR amplifications and genotyping. S.No. Primer Name Seuqence (5 to 3 ) Product length 1 INSIG2-For CTCCTACCTCCCTCCAATACC C INSIG2-Rev TCCCCGCCTCGTTTTCTAAG 3 INSIG2-SS CAGACCTAAAGGACCAC Polymerase chain reaction (PCR) conditions were optimized by varying MgCl2 concentrations and annealing temperature. PCR was carried 82
5 out using GeneAmp PCR system 9700 (Applied Biosystems, Foster City, USA), in a total volume of 10µl with 1.5mM MgCl2, 0.1mM of each dntp (Amersham Biosciences, New Jersey, USA), 20ng of genomic DNA, 0.1 picomol/µl of each forward and reverse primer, 0.03U/µl of Taq DNA polymerase (Bangalore Genie, India) and the buffer recommended by the supplier. SNaPshot reactions were set using ~50-75ng of the purified amplicon, 2 pmol of the genotyping primer, 0.5µl of the SNaPshot ready reaction mix (ABI, Foster City, CA) and milliq water to make the final volume up to 5µl. An aliquot (1 µl) of this product was analyzed by electrophoresis in a DNA analyzer (ABI Prism 3700). The software GeneScan analysis (ABI, Foster City, CA) was used to analyze the results. Genotypes were checked for the conformance of Hardy-Weinberg equilibrium using De-finetti program ( ). Genotypic associations were performed under the assumption of different models. Statistical analyses were performed using Simple Interactive Statistical Analysis (SISA) ( and Statistical Package for Social Sciences (SPSS) Windows, version 10. P-value <0.05 was interpreted as statistically significant. 83
6 4.3 RESULTS To study the relevance of the variant rs with respect to obesity in Indian population, we genotyped individuals from two studies- 1) AIIMS study and 2) IGVC study. General characteristics of the individuals recruited in the study are given in table 4.2. Genotypic and allelic distribution for the polymorphism rs in these cohorts is shown in table 4.3. Table 4.2: General/clinical characteristics of the individuals recruited for the study. Characteristics AIIMS Cohort IGV Cohort Age (Years)* 50 (45-58) 36 (27-48) Male (Number/%) 522 (86%) 900 (58%) BMI (Kg/m 2 )* 24.8 ( ) 22.0 ( ) Obese (Number/%) 301 (49%) 397 (26%) * Values shown are median (Interquartile Range). Table 4.3: Genotype distribution and allele frequencies of INSIG2 gene polymorphism in the two cohorts studied. Name of Cohort No of Genotypes Allele Frequency GG (%) GC (%) CC (%) G C AIIMS 313 (51.3) 253 (41.5) 44 (7.2) IGVC 774 (49.1) 659 (41.8) 144 (9.1) The minor allele frequency was found to be 0.30 and 0.28 in the two cohorts which was comparable to that reported by Herbert et. al. (0.37) (Herbert A et. al., 2006). The genotypic distribution in samples categorized as obese (BMI > 25 kg/m 2 ) and non-obese (BMI < 25 kg/m 2 ) is shown in table 4.4. The frequency of CC genotype was significantly higher in non-obese individuals as compared to the obese individuals under a recessive model in our AIIMS study (p=0.04) (Table 4.4). This trend of higher frequency of CC genotypes in non-obese individuals was also observed in the IGVC although the difference in the distribution was not statistically significant in this case (Table 4.4). These observations are in contrast to the earlier report where Herbert et. al. showed that the CC genotype was significantly more frequent in obese individuals. 84
7 Table 4.4: Genotypic variations at rs polymorphism between obese (BMI > 25 kg/m 2 ) and non-obese (BMI < 25 kg/m 2 ) under dominant and recessive models. Study Population Model Genotype Number (% Obese) Number (% Non-obese) Chi-square (p value) AIIMS Cohort Dominant GG 155 (52.2) 158 (50.5) 0.2 (0.67) CG+CC 142 (47.8) 155 (49.5) Recessive GG+CG 282 (95.0) 284 (90.8) 4.1 (0.04) CC 15 (5.05) 29 (9.2) IGVC Cohort Dominant GG 188 (49.5) 586 (49.0) 0.03 (0.9) CG+CC 192 (50.5) 611 (51.0) Recessive GG+CG 351 (92.4) 1082 (90.4) 1.4 (0.2) CC 29 (7.6) 115 (9.6) In general, Indian population to a large extent can be sub-structured on the basis of their ethnic origin as well as linguistic lineages. Linguistically, Indian population can be classified into four major families: Indo-European, Dravidian, Tibeto-Burman and Austro-Asiatic. When the samples of our IGVC were further classified on the basis of the linguistic lineage similar observations were obtained in Indo-European and Dravidian samples (Table 4.5). Table 4.5: Genotypic variations at rs polymorphism between obese (BMI > 25 kg/m2) and non-obese (BMI < 25 kg/m2) in three linguistic groups from IGVC cohort. Study Population Model Genotype Number (% Obese) Number (% Non-obese) Chi-squre (p value) Indo-European Dominant GG 130 (44.7) 449 (48.9) 1.6 (0.21) CG+CC 161 (51.5) 469 (50.3) Recessive GG+CG 271 (93.2) 829 (90.3) 2.3 (0.13) CC 20 (6.8) 89 (9.7) Dravidian Dominant GG 46 (67.7) 95 (50.3) 6.2 (0.01) CG+CC 22 (32.3) 94 (49.7) Recessive GG+CG 62 (91.2) 167 (88.4) 0.4 (0.52) CC 6 (8.8) 22 (11.6) Tibeto-Burman Dominant GG 10 (52.6) 41 (47.1) 0.2 (0.66) CG+CC 9 (47.4) 46 (52.9) Recessive GG+CG 16 (84.2) 83 (95.4) 2.5 (0.11) CC 3 (15.8) 4 (4.6) 85
8 The percentage of CC genotype was found to be 6.8 and 9.7 in Indo- European samples for obese and non-obese categories respectively. However, the difference was not statistically significant. Similarly, Tibeto-Burman population also did not show any association. However, in Dravidian population, the percentage of CC genotype was 8.8 and 11.6 in obese and nonobese categories respectively (Table 4.5). The difference in distribution of genotype with respect to obesity was found to be statistically significant under the assumption of recessive model. We also checked the status of BMI in our IGVC cohort as a function of age, sex and genotype. Under the assumption of a recessive model, BMI did not vary significantly in individuals with CC genotype as compared to those with GG or CG genotype regardless of age (Figure 4.1). Data for individuals below the age of 20 and over the age of 70 were excluded as there were very few samples with CC genotype in this age group. Even when the samples were segregated on the basis of sex, we didn t find significant difference in BMI as a function of age (Table 4.6). Figure 4.1: BMI as a function of age and genotype. Mean BMI comparison between individuals with CC genotype (homozygous variant) and CG+GG genotypes (homozygous wild type and heterozygous genotypes respectively). 86
9 Table 4.6: Effect of age, sex and genotype on BMI. Age Group (Years) Total Genotype Total Individuals Males Females GG+CG CC Total Genotype GG+CG CC Total Genotype GG+CG CC Upt (3.1) 20.9 (3.1) 20.1 (3.0) 20.9 (2.8) 20.9 (2.8) 20.8 (2.9) 20.6 (3.7) 20.8 (3.7) 17.7 (2.6) (10.5) 21.7 (3.3) 21.1 (3.4) 21.8 (3.2) 21.9 (3.2) 21.7 (2.7) 21.2 (3.6) 21.4 (3.5) 20.1 (4.2) (4.4) 22.7 (4.3) 22.4 (4.7) 22.8 (4.2) 22.8 (4.3) 22.6 (4.2) 22.6 (4.5) 22.7 (4.4) 22.3 (5.o) (4.8) 23.7 (4.6) 24.3 (6.3) 23.5 (4.8) 23.4 (4.6) 24.2 (6.8) 24.2 (4.8) 24.1 (4.7) 24.4 (5.7) (5.1) 23.7 (5.2) 21.8 (3.5) 23.2 (5.4) 23.4 (5.4) 19.5 (1.8) 23.9 (4.8) 24.0 (4.9) 23.1 (3.6) (4.8) 22.4 (4.9) 21.7 (4.2) 22.4 (4.6) 22.5 (4.7) 23.3 (6.3) 22.1 (5.2) 22.2 (5.3) 25.o* Values shown are mean BMI (Standard Deviation). *Only one individual was observed in this category. 87
10 4.4 DISCUSSION Obesity is emerging as an important health problem and acts as a strong risk factor for various diseases like CAD, type 2 diabetes, hypertension, stroke etc. Although several genetic variants have been associated with obesity none of these has been consistently replicated. In this regard, the polymorphism rs in the upstream region of INSIG2 gene has raised great hopes as it has been shown to be associated with obesity in four out of five different populations studied by Herbert et. al. (Herbert A et. al., 2006). However, we failed to find any significant association of this polymorphism with BMI in Indian population. The fact that polymorphism reported to be associated with obesity does not show any association in Indian population is not entirely surprising as several instances of differences between Indian and world populations are being increasingly revealed in complex disorders (Kumar J et. al., 2005; Kukreti R et. al., 2005; Sharma S et. al., 2005; Verma R et. al., 2005). Various other studies done in different cohorts from many countries have also failed to show the association in few of these cohorts (Smith et. al., 2007; Lyon HN et. al., 2008). Lyon et. al. tested the effect of INSIG2 polymorphism on about individuals from eight different populations using family based, population based and case-control study designs. Out of eight cohorts studied, they were able to find out the association in five cohorts but failed to observe any association in another three cohorts. Smith et. al. also failed to detect any association of the polymorphism in Caucasian, Afro-Caribbean and Indian individuals (Smith et. al., 2007). Differences in the genetic and environmental modifiers among populations might be a possibility for observing differences in associations. Since this SNP is present in the intergenic region, it might be possible that it is in linkage disequilibrium with some other SNP that is playing a role in obesity. Dense SNP map around this SNP needs to be scanned to resolve this issue. Further, more population needs to be screened to find out the exact position of the SNP in relation to obesity. Additional data regarding confounding factors for obesity also needs to be considered in the further studies to esimeate the exact role of this SNP. 88
11 In conclusion we have shown that the newly discovered association of the variant upstream of INSIG 2 gene (rs ) is not relevant in Indian population with respect to BMI. Further studies on the determinants of BMI are required to obtain a clear picture of high risk population for both extremes of BMI. 89
Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women
www.bioinformation.net Volume 13(5) Hypothesis Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women Maniraja Jesintha
More informationMyoglobin A79G polymorphism association with exercise-induced skeletal muscle damage
Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage T. Cui and M.S. Jiang College of Physical Education, Shandong University of Finance and Economics, Ji nan, Shandong,
More informationDiversity and Frequencies of HLA Class I and Class II Genes of an East African Population
Open Journal of Genetics, 2014, 4, 99-124 Published Online April 2014 in SciRes. http://www.scirp.org/journal/ojgen http://dx.doi.org/10.4236/ojgen.2014.42013 Diversity and Frequencies of HLA Class I and
More information2 International Conference on Predictive, Preventive and Personalized Medicine and Molecular Diagnostics
Dr. Cristina Patassini 2 International Conference on Predictive, Preventive and Personalized Medicine and Molecular Diagnostics Las Vegas, 3-5 november 2014 Obesity worldwide According to the World Health
More informationRole of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis
EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol
More informationJ. Environ. Res. Develop. Journal of Environmental Research And Development Vol. 8 No. 3A, January-March 2014
ASSOCIATION OF THE 45 T/G AND 276 G/T POLYMOR- PHISMS IN THE ADIPONECTIN GENE WITH TYPE 2 DIABETES IN SOUTH INDIAN POPULATION Thirunavukkarasu A.,* Nithya R., 1 Muthukumaran K. and Sivasankari C. 2 1.
More informationBritish Journal of Nutrition
(2009), 101, 322 327 q The Authors 2008 doi:10.1017/s0007114508006557 The single nucleotide polymorphism upstream of insulin-induced gene 2 (INSIG2) is associated with the prevalence of hypercholesterolaemia,
More informationFTO gene variants are strongly associated with type 2 diabetes in South Asian Indians
Diabetologia (2009) 52:247 252 DOI 10.1007/s00125-008-1186-6 SHORT COMMUNICATION FTO gene variants are strongly associated with type 2 diabetes in South Asian Indians C. S. Yajnik & C. S. Janipalli & S.
More informationUniversity of Groningen. Metabolic risk in people with psychotic disorders Bruins, Jojanneke
University of Groningen Metabolic risk in people with psychotic disorders Bruins, Jojanneke IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from
More informationSupplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC
Supplementary Table 1. The distribution of IFNL rs12979860 and rs8099917 and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC rs12979860 (n=3129) CC 1127 1145.8 CT 1533 1495.3 TT
More informationOriginal Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population
Int J Clin Exp Med 2014;7(12):5832-5836 www.ijcem.com /ISSN:1940-5901/IJCEM0002117 Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk
More informationSUPPLEMENTARY DATA. 1. Characteristics of individual studies
1. Characteristics of individual studies 1.1. RISC (Relationship between Insulin Sensitivity and Cardiovascular disease) The RISC study is based on unrelated individuals of European descent, aged 30 60
More informationAssociation between interleukin-17a polymorphism and coronary artery disease susceptibility in the Chinese Han population
Association between interleukin-17a polymorphism and coronary artery disease susceptibility in the Chinese Han population G.B. Su, X.L. Guo, X.C. Liu, Q.T. Cui and C.Y. Zhou Department of Cardiothoracic
More informationTable S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon
More informationAward Number: W81XWH TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer
AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. Rajvir Dahiya, Ph.D. CONTRACTING ORGANIZATION:
More informationSupplementary Figures
Supplementary Figures Supplementary Fig 1. Comparison of sub-samples on the first two principal components of genetic variation. TheBritishsampleisplottedwithredpoints.The sub-samples of the diverse sample
More informationnutrients ISSN
Nutrients 2014, 6, 2436-2465; doi:10.3390/nu6062436 Article OPEN ACCESS nutrients ISSN 2072-6643 www.mdpi.com/journal/nutrients Interleukin-6 Gene Polymorphisms, Dietary Fat Intake, Obesity and Serum Lipid
More informationThe omics approach in measuring the double burden of malnutrition
IAEA Headquarter, Vienna, Austria, 3-5 October 2017 Joint IAEA-WHO-UNICEF workshop on analysis of biological pathways to better understand the double burden of malnutrition and to inform action planning
More informationDuring the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin,
ESM Methods Hyperinsulinemic-euglycemic clamp procedure During the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin, Clayton, NC) was followed by a constant rate (60 mu m
More informationCS2220 Introduction to Computational Biology
CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS
More informationSupplementary Figure 1 Forest plots of genetic variants in GDM with all included studies. (A) IGF2BP2
Supplementary Figure 1 Forest plots of genetic variants in GDM with all included studies. (A) IGF2BP2 rs4402960, (B) MTNR1B rs10830963, (C) TCF7L2 rs7903146, (D) IRS1 rs1801278, (E) PPARG rs1801282, (F)
More informationY. Zhan, C. Li, Q. Gao, J. Chen, S. Yu and S.G. Liu. Corresponding author: Y. Zhan
Association between the rs4753426 polymorphism in MTNR1B with fasting plasma glucose level and pancreatic β-cell function in gestational diabetes mellitus Y. Zhan, C. Li, Q. Gao, J. Chen, S. Yu and S.G.
More informationTITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer
AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. CONTRACTING ORGANIZATION: Northern California
More informationClinical Importance of MTHFR Gene Polymorphism in Coronary Artery Disease: A Study from India
Human Journals Research Article September 2018 Vol.:13, Issue:2 All rights are reserved by Alpana Saxena et al. Clinical Importance of MTHFR Gene Polymorphism in Coronary Artery Disease: A Study from India
More informationReport Date: 11/20/2017
Name: Sample Report Report Date: 11/20/2017 Consult with a licensed healthcare professional before making changes based upon any information contained within this report. These recommendations and explanations
More informationAssociation between the CYP11B2 gene 344T>C polymorphism and coronary artery disease: a meta-analysis
Association between the CYP11B2 gene 344T>C polymorphism and coronary artery disease: a meta-analysis Y. Liu, H.L. Liu, W. Han, S.J. Yu and J. Zhang Department of Cardiology, The General Hospital of the
More informationResearch Article Polymorphism on Chromosome 9p21.3 Is Associated with Severity and Early-Onset CAD in Type 2 Diabetic Tunisian Population
Disease Markers Volume 2015, Article ID 792679, 6 pages http://dx.doi.org/10.1155/2015/792679 Research Article Polymorphism on Chromosome 9p21.3 Is Associated with Severity and Early-Onset CAD in Type
More informationSupplemental Table 1 Age and gender-specific cut-points used for MHO.
Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123
More informationAssociation between interleukin gene polymorphisms and risk of recurrent oral ulceration
Association between interleukin gene polymorphisms and risk of recurrent oral ulceration C. Jing and J.-Q. Zhang Department of Stomatology, The First Affiliated Hospital of PLA General Hospital, Beijing,
More informationCt=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
More informationRole of inflammatory parameters in the susceptibility of cerebral thrombosis
Role of inflammatory parameters in the susceptibility of cerebral thrombosis X.F. Qi 1, T.J. Feng 2, P. Yang 1, H.Y. Feng 3, P. Zhang 2, L.Y. Kong 1, D.L. Liang 1, P.F. Li 4, W. Na 5, Y.W. Li 5 and Y.
More informationLack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population
Lack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population J. Zhu 1 *, F. He 2 *, D.D. Zhang 2 *, J.Y. Yang 2, J. Cheng 1, R. Wu 1, B. Gong 2, X.Q. Liu
More informationThe association between TCM syndromes and SCAP polymorphisms in subjects with non-alcoholic fatty liver disease
The association between TCM syndromes and SCAP polymorphisms in subjects with non-alcoholic fatty liver disease Shanshan Sun, Tao Wu, Miao Wang, Wei Li, Lin Wang, Songhua He, Huafeng Wei, Haiyan Song,
More informationAssociation between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population
Association between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population R. Zhao and M.F. Ying Department of Pharmacy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University,
More informationDrug Metabolism Disposition
Drug Metabolism Disposition The CYP2C19 intron 2 branch point SNP is the ancestral polymorphism contributing to the poor metabolizer phenotype in livers with CYP2C19*35 and CYP2C19*2 alleles Amarjit S.
More informationLetter to the Editor. Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes *
814 Biomed Environ Sci, 2016; 29(11): 814-817 Letter to the Editor Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes * ZHANG Lu 1,^,
More informationFTO Polymorphisms Are Associated with Obesity But Not with Diabetes in East Asian Populations: A Meta analysis
BIOMEDICAL AND ENVIRONMENTAL SCIENCES 22, 449 457 (2009) www.besjournal.com FTO Polymorphisms Are Associated with Obesity But Not with Diabetes in East Asian Populations: A Meta analysis BO XI #, + AND
More informationGenetic Terms DNA. Proteins. Genes. Variations. Epigenetics. Alleles
Name: SAMPLE REPORT Consult with a licensed healthcare professional before making changes based upon any information contained within this report. These recommendations and explanations are based upon
More informationProtein tyrosine phosphatase 1B is not a major susceptibility gene for type 2 diabetes mellitus or obesity among Pima Indians
Diabetologia (2007) 50:985 989 DOI 10.1007/s00125-007-0611-6 SHORT COMMUNICATION Protein tyrosine phosphatase 1B is not a major susceptibility gene for type 2 diabetes mellitus or obesity among Pima Indians
More informationmir-146a and mir-196a2 polymorphisms in ovarian cancer risk
mir-146a and mir-196a2 polymorphisms in ovarian cancer risk X.C. Sun, A.C. Zhang, L.L. Tong, K. Wang, X. Wang, Z.Q. Sun and H.Y. Zhang Department of Obstetrics and Gynecology, China-Japan Union Hospital
More informationLack of association between ERCC5 gene polymorphisms and gastric cancer risk in a Chinese population
Lack of association between ERCC5 gene polymorphisms and gastric cancer risk in a Chinese population J.J. Lu, H.Q. Zhang, P. Mai, X. Ma, X. Chen, Y.X. Yang and L.P. Zhang Gansu Provincial Hospital, Donggang
More informationTutorial on Genome-Wide Association Studies
Tutorial on Genome-Wide Association Studies Assistant Professor Institute for Computational Biology Department of Epidemiology and Biostatistics Case Western Reserve University Acknowledgements Dana Crawford
More informationRole of interleukin-6 gene polymorphisms in the risk of coronary artery disease
Role of interleukin-6 gene polymorphisms in the risk of coronary artery disease K. Wang 1, P.S. Dong 1, H.F. Zhang 1, Z.J. Li 1, X.M. Yang 1 and H. Liu 2 1 Department of Cardiovascular Medicine, The First
More informationPOST GRADUATE DIPLOMA IN CLINICAL CARDIOLOGY (PGDCC) Term-End Examination June, 2015
No. of Printed Pages : 20 MCC-006 POST GRADUATE DIPLOMA IN CLINICAL 0 CARDIOLOGY (PGDCC) Term-End Examination June, 2015 MCC-006 : CARDIO VASCULAR EPIDEMIOLOGY Time : 2 hours Maximum Marks : 60 Note :
More informationChapter 6. Candidate gene analysis Part II
Chapter 6 Candidate gene analysis Part II Relationship of Beta2-Adrenergic Receptor polymorphism with obesity in type 2 diabetes mellitus Jonathan H van Tilburg, 1 Cisca Wijmenga, 1 Leida Roseman, 1 Eric
More informationSupplementary Methods
Supplementary Methods Populations ascertainment and characterization Our genotyping strategy included 3 stages of SNP selection, with individuals from 3 populations (Europeans, Indian Asians and Mexicans).
More informationTEACHER S GUIDE. Case Study. Lactose tolerance. Steve Cross, Bronwyn Terrill and colleagues. Wellcome Trust Sanger Institute Hinxton. Version 1.
TEACHER S GUIDE Case Study Lactose tolerance Version 1.1 Steve Cross, Bronwyn Terrill and colleagues Wellcome Trust Sanger Institute Hinxton Lactose tolerance The majority of people living today are unable
More informationInfluence of interleukin-17 gene polymorphisms on the development of pulmonary tuberculosis
Influence of interleukin-17 gene polymorphisms on the development of pulmonary tuberculosis G.-C. Shi and L.-G. Zhang Department of Tuberculosis, The First Affiliated Hospital of Xinxiang Medical University,
More informationOriginal Research Article
A STUDY TO ESTIMATE SUBCLINICAL ATHEROSCLEROSIS IN PATIENTS WITH TYPE 2 DIABETES MELLITUS BY MEASURING THE CAROTID INTIMAL MEDIAL THICKNESS Natarajan Kandasamy 1, Rajan Ganesan 2, Thilakavathi Rajendiran
More informationTHE ROLE OF microrna POLYMORPHISMS IN GASTRIC CANCER PATHOGENESIS
UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA DOCTORAL SCHOOL THE ROLE OF microrna POLYMORPHISMS IN GASTRIC CANCER PATHOGENESIS PhD THESIS ABSTRACT SCIENTIFIC ADVISOR: PROF. UNIV. DR. ION ROGOVEANU PhD student:
More informationiplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
More informationSupplementary materials
Supplementary materials Genome-wide analysis correlates Ayurveda Prakriti Periyasamy Govindaraj 1,+, Sheikh Nizamuddin 1,+, Anugula Sharath 1, Vuskamalla Jyothi 1, Harish Rotti 2, Ritu Raval 2, Jayakrishna
More informationAssociation of Methylenetetrahydrofolate reductase (MTHFR 677C>T) polymorphisms with Ovarian Malignancy in women of Northern India
214 Association of Methylenetetrahydrofolate reductase (MTHFR 677C>T) polymorphisms with Ovarian Malignancy in women of Northern India Authors:, Rinki Kumari 1, Anamika Tiwari, Aruna Agrwal, G.P.I. Singh,
More informationInfluence of the c.1517g>c genetic variant in the XRCC1 gene on pancreatic cancer susceptibility in a Chinese population
Influence of the c.1517g>c genetic variant in the XRCC1 gene on pancreatic cancer susceptibility in a Chinese population Z.M. Zhao*, C.G. Li*, M.G. Hu, Y.X. Gao and R. Liu Department of Surgical Oncology,
More informationMULTIFACTORIAL DISEASES. MG L-10 July 7 th 2014
MULTIFACTORIAL DISEASES MG L-10 July 7 th 2014 Genetic Diseases Unifactorial Chromosomal Multifactorial AD Numerical AR Structural X-linked Microdeletions Mitochondrial Spectrum of Alterations in DNA Sequence
More informationFour SNPs of insulin-induced gene 1 associated with growth and carcass traits in Qinchuan cattle in China
Four SNPs of insulin-induced gene 1 associated with growth and carcass traits in Qinchuan cattle in China Y. Liu, X.L. Liu, H. He and Y.L. Gu Shaanxi Key Laboratory of Molecular Biology for Agriculture,
More informationPolymorphisms of DNA repair-related genes with susceptibility and prognosis of prostate cancer
Polymorphisms of DNA repair-related genes with susceptibility and prognosis of prostate cancer X.J. Zhang, P. Liu and F. Zhu Urology Department, The First Affiliated Hospital of Xinxiang Medical University,
More informationIL10 rs polymorphism is associated with liver cirrhosis and chronic hepatitis B
IL10 rs1800896 polymorphism is associated with liver cirrhosis and chronic hepatitis B L.N. Cao 1, S.L. Cheng 2 and W. Liu 3 1 Kidney Disease Department of Internal Medicine, Xianyang Central Hospital,
More informationGenerating Mouse Models of Pancreatic Cancer
Generating Mouse Models of Pancreatic Cancer Aom Isbell http://www2.massgeneral.org/cancerresourceroom/types/gi/index.asp Spring/Summer 1, 2012 Alexandros Tzatsos, MD PhD Bardeesy Lab: Goals and Objectives
More informationSupplementary Table 1. Association of rs with risk of obesity among participants in NHS and HPFS
Supplementary Table 1. Association of rs3826795 with risk of obesity among participants in NHS and HPFS Case/control NHS (1990) HPFS (1996) OR (95% CI) P- value Case/control OR (95% CI) P- value Obesity
More informationHuman population sub-structure and genetic association studies
Human population sub-structure and genetic association studies Stephanie A. Santorico, Ph.D. Department of Mathematical & Statistical Sciences Stephanie.Santorico@ucdenver.edu Global Similarity Map from
More informationSupplemental Data: Detailed Characteristics of Patients with MKRN3. Patient 1 was born after an uneventful pregnancy. She presented in our
1 2 Supplemental Data: Detailed Characteristics of Patients with MKRN3 Mutations 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Patient 1 was born after an uneventful pregnancy. She presented
More informationSALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes
More informationSalt, soft drinks & obesity Dr. Feng He
Salt, soft drinks & obesity Dr. Feng He Wolfson Institute of Preventive Medicine, Barts and The London School of Medicine & Dentistry, Queen Mary University of London, UK f.he@qmul.ac.uk BP Salt CVD Obesity
More informationInvestigating causality in the association between 25(OH)D and schizophrenia
Investigating causality in the association between 25(OH)D and schizophrenia Amy E. Taylor PhD 1,2,3, Stephen Burgess PhD 1,4, Jennifer J. Ware PhD 1,2,5, Suzanne H. Gage PhD 1,2,3, SUNLIGHT consortium,
More informationSu Yon Jung 1*, Eric M. Sobel 2, Jeanette C. Papp 2 and Zuo-Feng Zhang 3
Jung et al. BMC Cancer (2017) 17:290 DOI 10.1186/s12885-017-3284-7 RESEARCH ARTICLE Open Access Effect of genetic variants and traits related to glucose metabolism and their interaction with obesity on
More informationAssociation between rs G<C gene polymorphism and susceptibility to pancreatic cancer in a Chinese population
Association between rs9904341 G
More informationTCF7L2 polymorphisms are associated with type 2 diabetes in northern Sweden
(2007) 15, 342 346 & 2007 Nature Publishing Group All rights reserved 1018-4813/07 $30.00 ARTICLE www.nature.com/ejhg TCF7L2 polymorphisms are associated with type 2 diabetes in northern Sweden Sofia Mayans
More informationEffect of Weight Gain and Weight Loss on Risk of Diabetes amongst Over Weight Subjects: A Hospital Based Study
Original article: Effect of Weight Gain and Weight Loss on Risk of Diabetes amongst Over Weight Subjects: A Hospital Based Study Hanuman Ram Choudhary Junior Specialist (General Medicine), Government Hospital,
More informationOrdering Healthcare Professional Nilesh Dharajiya, M.D Nexus Center Drive San Diego, CA US
IMPORTANT INFORMATION PAGE 2 Personal Details Name: SAMPLE PATIENT DOB: Jan 1, 19XX Gender: Female Ethnicity: Caucasian Report Date: Nov 12, 2015 Received Date: Nov 2, 2015 Test Performed / Method Genotyping
More informationInfluence of interleukin-18 gene polymorphisms on acute pancreatitis susceptibility in a Chinese population
Influence of interleukin-18 gene polymorphisms on acute pancreatitis susceptibility in a Chinese population H.B. Gui 1, X.G. Du 2, Z.H. Fu 3 and X.M. Chen 1 1 Department of Emergency, The First Affiliated
More informationCYP1A2-163C/A (rs762551) polymorphism and bladder cancer risk: a case-control study
CYP1A2-163C/A (rs762551) polymorphism and bladder cancer risk: a case-control study Y.L. Song 1,2, L. Wang 2, J.C. Ren 1 and Z.H. Xu 1 1 Department of Urology, Qilu Hospital, Shandong University, Jinan,
More informationMendelian Randomization
Mendelian Randomization Drawback with observational studies Risk factor X Y Outcome Risk factor X? Y Outcome C (Unobserved) Confounders The power of genetics Intermediate phenotype (risk factor) Genetic
More informationInvestigation of Programmed Cell Death-1 (PD-1) Gene Variations at Positions PD1.3 and PD1.5 in Iranian Patients with Non-small Cell Lung Cancer
Original Article Middle East Journal of Cancer; January 2018; 9(1): 13-17 Investigation of Programmed Cell Death-1 (PD-1) Gene Variations at Positions PD1.3 and PD1.5 in Iranian Patients with Non-small
More informationWhy Do We Treat Obesity? Epidemiology
Why Do We Treat Obesity? Epidemiology Epidemiology of Obesity U.S. Epidemic 2 More than Two Thirds of US Adults Are Overweight or Obese 87.5 NHANES Data US Adults Age 2 Years (Crude Estimate) Population
More information696 Biomed Environ Sci, 2015; 28(9):
696 Biomed Environ Sci, 2015; 28(9): 696-700 Letter to the Editor Fluoride Exposure, Follicle Stimulating Hormone Receptor Gene Polymorphism and Hypothalamus-pituitary-ovarian Axis Hormones in Chinese
More informationHeritability and genetic correlations explained by common SNPs for MetS traits. Shashaank Vattikuti, Juen Guo and Carson Chow LBM/NIDDK
Heritability and genetic correlations explained by common SNPs for MetS traits Shashaank Vattikuti, Juen Guo and Carson Chow LBM/NIDDK The Genomewide Association Study. Manolio TA. N Engl J Med 2010;363:166-176.
More informationThe Uncoupling Protein 2 Ala55val Polymorphism is Associated with Diabetes Mellitus in a Balinese Population
Original Article 39 The Uncoupling Protein 2 Ala55val Polymorphism is Associated with Diabetes Mellitus in a Balinese Population Abstract Background. The activity of uncoupling proteins have been reported
More informationWarfarin Dosing Using Genetic Information A Model for Hospital Policy Development
Warfarin Dosing Using Genetic Information A Model for Hospital Policy Development Jean Lopategui, MD Director, Molecular Pathology Jean.lopategui@cshs.org Warfarin Pharmacogenomics Part I Background Information
More informationThe Thr92Ala polymorphism in the type 2 deiodinase is not associated with thyroxin dose in athyroid patients or patients with Hashimoto thyroiditis
12 The Thr92Ala polymorphism in the type 2 deiodinase is not associated with thyroxin dose in athyroid patients or patients with Hashimoto thyroiditis K.A. Heemstra, H.C. Hoftijzer, W.M. van der Deure,
More informationGenome-wide Association Analysis Applied to Asthma-Susceptibility Gene. McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S.
Genome-wide Association Analysis Applied to Asthma-Susceptibility Gene McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S. December 17, 2014 1 Introduction Asthma is a chronic respiratory disease affecting
More informationRelationship between polymorphism of SOCS- 3 and dyslipidemia in China Xinjiang Uygur
Relationship between polymorphism of SOCS- 3 and dyslipidemia in China Xinjiang Uygur X.G. Yao, J. Meng, L. Zhou, N. Lin, J. Hong, M. Heizhati and N.F. Li Hypertension Institute of Xinjiang China, Hypertension
More informationCONTENT SUPPLEMENTARY FIGURE E. INSTRUMENTAL VARIABLE ANALYSIS USING DESEASONALISED PLASMA 25-HYDROXYVITAMIN D. 7
CONTENT FIGURES 3 SUPPLEMENTARY FIGURE A. NUMBER OF PARTICIPANTS AND EVENTS IN THE OBSERVATIONAL AND GENETIC ANALYSES. 3 SUPPLEMENTARY FIGURE B. FLOWCHART SHOWING THE SELECTION PROCESS FOR DETERMINING
More informationBST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis
BST227 Introduction to Statistical Genetics Lecture 4: Introduction to linkage and association analysis 1 Housekeeping Homework #1 due today Homework #2 posted (due Monday) Lab at 5:30PM today (FXB G13)
More informationLoughborough University Institutional Repository. This item was submitted to Loughborough University's Institutional Repository by the/an author.
Loughborough University Institutional Repository Risk of depression in subjects with type 2 diabetes Is modulated by a genetic variant within DRD4 gene: North Indian diabetes-depression link exploration
More informationLeveraging Clinical Databases for Epidemiologic (Population) Research. The Pan Asian Cohort Study (PACS) at the Palo Alto Medical Foundation (PAMF)
Leveraging Clinical Databases for Epidemiologic (Population) Research The Pan Asian Cohort Study (PACS) at the Palo Alto Medical Foundation (PAMF) Palo Alto Medical Foundation (PAMF) San Francisco Bay
More informationSHORT COMMUNICATION. K. Lukacs & N. Hosszufalusi & E. Dinya & M. Bakacs & L. Madacsy & P. Panczel
Diabetologia (2012) 55:689 693 DOI 10.1007/s00125-011-2378-z SHORT COMMUNICATION The type 2 diabetes-associated variant in TCF7L2 is associated with latent autoimmune diabetes in adult Europeans and the
More informationRelation between the angiotensinogen (AGT) M235T gene polymorphism and blood pressure in a large, homogeneous study population
(2003) 17, 555 559 & 2003 Nature Publishing Group All rights reserved 0950-9240/03 $25.00 www.nature.com/jhh ORIGINAL ARTICLE Relation between the angiotensinogen (AGT) M235T gene polymorphism and blood
More informationLEPTIN AS A NOVEL PREDICTOR OF DEPRESSION IN PATIENTS WITH THE METABOLIC SYNDROME
LEPTIN AS A NOVEL PREDICTOR OF DEPRESSION IN PATIENTS WITH THE METABOLIC SYNDROME Diana A. Chirinos, Ronald Goldberg, Elias Querales-Mago, Miriam Gutt, Judith R. McCalla, Marc Gellman and Neil Schneiderman
More informationPrevalence and risk factors of hypertension, among adults residing in an urban area of North India
Available online at www.ijpab.com INTERNATIONAL JOURNAL OF PURE & APPLIED BIOSCIENCE ISSN: 2320 7051 Int. J. Pure App. Biosci. 3 (2): 338-344 (2015) Research Article Prevalence and risk factors of hypertension,
More informationA case control association study of COMT gene polymorphism (I/D) with type 2 diabetes and its related factors in Pakistani Punjabi population
Zain et al. Journal of Diabetes & Metabolic Disorders (2015) 14:40 DOI 10.1186/s40200-015-0166-x RESEARCH ARTICLE Open Access A case control association study of COMT gene polymorphism (I/D) with type
More informationSingle Nucleotide Polymorphisms in Homocysteine Metabolism Pathway Genes. With Hyperhomocysteinemia
Single Nucleotide Polymorphisms in Homocysteine Metabolism Pathway Genes Association of CHDH A119C and MTHFR C677T With Hyperhomocysteinemia Jitender Kumar, PhD; Gaurav Garg, MSc; Arun Kumar, PhD; Elayanambi
More informationJournal of Research in Obesity
Journal of Research in Obesity Vol. 2016 (2016), Article ID 216173, 20 minipages. DOI:10.5171/2016.216173 www.ibimapublishing.com Copyright 2016. Asma Sultana, Sujan Banik, Mohammad Salim Hossain, Mustahsan
More informationChapter 2 The Link Between Obesity and Breast Cancer Risk: Epidemiological Evidence
Chapter 2 The Link Between Obesity and Breast Cancer Risk: Epidemiological Evidence 2.1 BMI and Breast Cancer Risk BMI is routinely used to qualify an individual s adiposity, yet it is simply a measure
More informationIntroduction to Genetics and Genomics
2016 Introduction to enetics and enomics 3. ssociation Studies ggibson.gt@gmail.com http://www.cig.gatech.edu Outline eneral overview of association studies Sample results hree steps to WS: primary scan,
More informationEXTRACTION AND IDENTIFICATION OF KNOWN GENES OF LIFESTYLE DISEASES IN MEN AND WOMEN 20 YEARS AND OVER: A PILOT STUDY IN ILOCOS, BICOL AND METRO MANILA
EXTRACTION AND IDENTIFICATION OF KNOWN GENES OF LIFESTYLE DISEASES IN MEN AND WOMEN 20 YEARS AND OVER: A PILOT STUDY IN ILOCOS, BICOL AND METRO MANILA Celeste C. Tancho, Ph.D., Mario V. Capanzana, Ph.D.,
More informationCHAPTER IV RESULTS Microcephaly General description
47 CHAPTER IV RESULTS 4.1. Microcephaly 4.1.1. General description This study found that from a previous study of 527 individuals with MR, 48 (23 female and 25 male) unrelated individuals were identified
More informationOverweight and Obesity in Older Persons: Impact Upon Health and Mortality Outcomes
Overweight and Obesity in Older Persons: Impact Upon Health and Mortality Outcomes Gordon L Jensen, MD, PhD Senior Associate Dean for Research Professor of Medicine and Nutrition Objectives Health outcomes
More informationInvestigation of the role of XRCC1 genetic polymorphisms in the development of gliomas in a Chinese population
Investigation of the role of XRCC1 genetic polymorphisms in the development of gliomas in a Chinese population S.C. Fan 1, J.G. Zhou 2 and J.Z. Yin 1 1 Department of Neurosurgery, The People s Hospital
More informationFor more information about how to cite these materials visit
Author(s): Kerby Shedden, Ph.D., 2010 License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution Share Alike 3.0 License: http://creativecommons.org/licenses/by-sa/3.0/
More information