SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
|
|
- Baldric Griffith
- 5 years ago
- Views:
Transcription
1 Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG AGG ACT TCA C-3' 5'-GGA GGA CTC TCG TAG CTC GAA -3' 5'-GTGAACCCGACAACTTCCGAA -3' 5'-TGAAACTCCGGCTGAGAAGAT-3' 5'-TAT GGA GTG ACA TAG AGT GTG CT- 3' 5'-CCA CTT CAA TCC ACC CAG AAA G -3' 5'-AATTATGCCTCGGAGAAGACCG-3' 5'-GGCAGTTGCCTAGTGAAAGGT-3' 5'-TCC GCG TTC TCA TGT AGG TCT-3' 5'-GGA CCT GAT GCA ACC CTA TGA-3' 5'-TGC TCT TCT GTA TCG CCC AGT-3' 5'-GCC GTG TTA AGG AAT CTG CTG-3' 5'-TGT GGG GAT CTC AGC CAT AGT -3' 5'-AGT GGG CTA AGA CCC ATC CTG -3' 5'-TCGCTGATGCACTGCCTATG-3' 5'-GAGAGGTCCACAGAGCTGATT-3' 5'-AAGGTGAAGAGCATCATAACCCT-3' 5'-TCACGCCTTTCATAACACATTCC-3' 5'-GGAATGTGGAGCGTGCTAAAA-3' 5'-GCTGGAAAAACACTTCGGAATA-3' 5'-GGAGGCAAGCATAAGACTGG-3' 5'-CCATCAGGGTATCCTCTC-3' 5'-CCCGATTGAAGTAAAGGCTGT-3' 5'-TGGTAAGCCAGTAGCACTCTG-3' 5'-AGCACGGAGTGACCCAAAC-3' 5'-TGTACGTGGCTACATGGACCT-3' 5'-CCGCAAGGGAAAGATGAAAGAC-3' 5'-TCGTTTGGTTTCGGGGTTTC-3' 5'-GCCAGCCTCTCCTGATTTTAGTGT-3' 5'-GGGAACACAAAAGACCTCTTCTGG-3' 5'-GCAGGAGTACGATGAGTCCG-3' 5'-ACGCAGCTCAGTAACAGTCC-3'
2 Supplementary Table 2. Primary antibodies for western blotting Antibodies Company Catalog No. Dilution PRDM16 Abcam ab :1000 UCP1 Abcam ab23841 ab :1000 (WB) 1:100 (IF) PGC1α Santa Cruz sc :1000 Dio2 Abcam Ab :500 PTEN Santa Cruz sc :1000 AMPKα Cell Signaling #2793 1:1000 p-ampkα (Thr172) Cell Signaling #2535 1:1000 β-actin Santa Cruz sc :1000
3 Supplementary Figure 1. BLC attenuates hepatic lipid accumulation and stimulates the expression of thermogenic gene expressions in the liver. A: Total lipid and triglyceride (TG) contents of livers in the mice. B: Representative images of H&E-stained sections and gross morphology of livers (original magnification, 200). C: Thermogenic gene expression analyzed by qpcr. Data are mean ± SEM (n=10 per group). *p<0.05, **p<0.01 and ***p<0.001 vs. HFD group.
4 Supplementary Figure 2. BLC does not induce toxicity. A: Appearance of the experimental mice. B: alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were measured in the serum of the experimental mice fed BLC for 11 weeks.
5 Supplementary Figure 3. Expression of brown adipocyte specific genes in the scwat of HBLC mice to BAT of HFD mice. Thermogenic gene expression analyzed by RT-qPCR. Data are mean ± SEM (n=10 per group). **p<0.01, ***p<0.001 vs. scwat-hfd group. # p<0.05, ## p<0.01 vs. scwat- HBLC group.
6 Supplementary Figure 4. Cold exposure increases fat browning and mitochondrial function. Male C57BL/6 mice (8 weeks old) were either kept at room temperature (RT) or exposed to 4 C for 4 hours per day during 3 consecutive days (CE). A-D: Expression levels of brown adipocyte-specific genes and proteins and mitochondria function-related genes and proteins were analyzed by qpcr and western blotting, respectively, in the scwat (A and B) and muscle (C and D) of mice that were exposed to cold (CE) or room temperature (RT). Data are expressed as mean ± SEM (*p<0.05 and **p<0.01 vs. RT group).
7 Supplementary Figure 5. Expression ratio of brown adipocyte specific genes normalized by AP2. SVFs were differentiated into white adipocyte and analyzed the expression of brown adipocyte specific gene after normalization by adipocyte specific marker, AP2. *p<0.05, **p<0.01 and ***p<0.001 vs. control.
8 Supplementary Figure 6. BLC induces fat browning through activation of AMPK. SVFs were transfected with ctrl-sirna or AMPK sirna for 2 days and differentiated into beige adipocytes for 6 days in the presence and absence of BLC (1 μm). The expression of UCP1 was quantified by western blotting.
9 Supplementary Figure 7. BLC stimulates differentiation into beige adipocytes through mediation of T3. A-D: SVFs were differentiated into beige adipocytes with BLC or without BLC under T3-deleted conditions and compared to adipocytes under T3-enriched conditions. Quantitative RT-PCR analysis of UCP1 (A), PGC1α (B), and Dio2 (C) mrna expression, as well as western blotting for UCP1 (D), in SVF-differentiated adipocytes. E: The concentration of T3 in the serum and tissues analyzed by ELISA kit (Calbiotech, Spring Valley, CA). F: SVFs were differentiated into adipocytes in the presence or absence of TR antagonist, (5μM). The UCP1 mrna and protein levels was quantified by qrt-pcr and western blotting. Data are expressed as mean ± SEM.
Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
More informationSupplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
More informationc Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationCD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'
Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA
More informationAbbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
More informationSupplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer
More informationa) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
More informationSupplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N
MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
More informationSupplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for
More informationFigure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationSupplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
More informationCitation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.
University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and
More informationAstaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E
Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili
More informationTable S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments
SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M
More informationToluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in
More informationJournal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype
J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high
More informationSupplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade
Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha
More informationSupplementary Figure 1a
Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results
More informationSupplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
More informationNature Immunology: doi: /ni.3836
Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:
More informationSupplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota
Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources
More informationSupplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and
More informationDescription of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
More informationBIOLOGY 621 Identification of the Snorks
Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on
More informationSupplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease
Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,
More informationA smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging
More informationCross-talk between mineralocorticoid and angiotensin II signaling for cardiac
ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,
More informationSupporting Information
Supporting Information Malapeira et al. 10.1073/pnas.1217022110 SI Materials and Methods Plant Material and Growth Conditions. A. thaliana seedlings were stratified at 4 C in the dark for 3 d on Murashige
More informationA basic helix loop helix transcription factor controls cell growth
A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability
More informationSupplementary Information
Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim,
More informationSupplementary Figure 1
Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated
More informationCulture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)
A. B. C. D. E. PA JSRI JSRI 2 PA DSAM DSAM 2 DSAM 3 PA LNAP LNAP 2 LNAP 3 PAO Fcor Fcor 2 Fcor 3 PAO Wtho Wtho 2 Wtho 3 Wtho 4 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB
More informationwww.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:
More informationPhylogenetic analysis of human and chicken importins. Only five of six importins were studied because
Supplementary Figure S1 Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because importin-α6 was shown to be testis-specific. Human and chicken importin protein
More informationLoyer, et al. microrna-21 contributes to NASH Suppl 1/15
Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 SUPPLEMENTARY MATERIAL: Liver MicroRNA-21 is Overexpressed in Non Alcoholic Steatohepatitis and Contributes to the Disease in Experimental Models
More informationPATIENTS AND METHODS. Subjects
PATIENTS AND METHODS Subjects Twenty-nine morbidly obese subjects involved in a gastric surgery program were enrolled in the study between October 25 and March 21. Bariatric surgery was performed in patients
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena
More informationFormylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis
Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott
More informationSUPPLEMENTARY RESULTS
SUPPLEMENTARY RESULTS Supplementary Table 1. hfpr1- Flpln-CHO hfpr2-flpln-cho pec 50 E max (%) Log( /K A) Log( /K A) N pec 50 E max (%) Log( /K A) Log( /K A) n ERK1/2 phosphorylation fmlp 9.0±0.6 80±7
More informationSupplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
More informationLezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 10: Sintesi proteica Synthesis of proteins Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza
More informationSupplementary information
Supplementary information Unique polypharmacology nuclear receptor modulator blocks inflammatory signaling pathways Mi Ra Chang 1, Anthony Ciesla 1, Timothy S. Strutzenberg 1, Scott J. Novick 1, Yuanjun
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
More informationBaseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3
Next-Generation Sequencing Technology Reveals a Characteristic Pattern of Molecular Mutations in 72.8% of Chronic Myelomonocytic Leukemia (CMML) by Detecting Frequent Alterations in TET2, CBL, RAS, and
More informationBHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL
1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.
More informationCIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR
CIRCRESAHA/2004/098145/R1 - ONLINE 1 Expanded Materials and Methods Validation by Semi-quantitative Real-Time Reverse Transcription PCR Expression patterns of 13 genes (Online Table 2), selected with respect
More informationSupporting Information. Mutational analysis of a phenazine biosynthetic gene cluster in
Supporting Information for Mutational analysis of a phenazine biosynthetic gene cluster in Streptomyces anulatus 9663 Orwah Saleh 1, Katrin Flinspach 1, Lucia Westrich 1, Andreas Kulik 2, Bertolt Gust
More informationSupplemental Figures: Supplemental Figure 1
Supplemental Figures: Supplemental Figure 1 Suppl. Figure 1. BM-DC infection with H. pylori does not induce cytotoxicity and treatment of BM-DCs with H. pylori sonicate, but not heat-inactivated bacteria,
More informationSingle-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast
Supplemental Figures, Tables and Results Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Sami Hocine 1, Pascal Raymond 2, Daniel Zenklusen 2, Jeffrey A. Chao 1 &
More informationMutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients
Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Shuichi OTABE, Karine CLEMENT, Séverine DUBOIS, Frederic LEPRETRE, Veronique PELLOUX,
More informationBeta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015
Bioinformatics in Medical Product Development SMPD 287 Three Beta Thalassemia Sami Khuri Department of Computer Science San José State University Hemoglobin Outline Anatomy of a gene Hemoglobinopathies
More informationViral hepatitis, which affects half a billion people
GASTROENTEROLOGY 2006;130:435 452 BASIC LIVER, PANCREAS, AND BILIARY TRACT Natural Killer Cells Ameliorate Liver Fibrosis by Killing Activated Stellate Cells in NKG2D-Dependent and Tumor Necrosis Factor
More informationice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.
Cell cycle analysis For cell cycle analysis, single cell suspensions of E12.5 fetal liver cells were suspended in 4 ml ice-cold 7% ethanol with gentle vortexing, incubated at -2 C for 4 hours, and washed
More informationIntegration Solutions
Integration Solutions (1) a) With no active glycosyltransferase of either type, an ii individual would not be able to add any sugars to the O form of the lipopolysaccharide. Thus, the only lipopolysaccharide
More informationNucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10
J. gen. Virol. (1988), 69, 945-949. Printed in Great Britain 945 Key words: BTV/genome segment lo/nucleotide sequence Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 By
More informationSUPPLEMENTAL METHODS Cell culture RNA extraction and analysis Immunohistochemical analysis and laser capture microdissection (LCM)
SUPPLEMENTAL METHODS Cell culture Human peripheral blood mononuclear cells were isolated from healthy donors by Ficoll density gradient centrifugation. Monocyte differentiation to resting macrophages ()
More informationRelationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia
elationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia H.J. Ou 1, G. Huang 2, W. Liu 3, X.L. Ma 2, Y. Wei 4, T. Zhou 5 and Z.M. Pan 3 1 Department of Neurology, The
More informationTetR repressor-based bioreporters for the detection of doxycycline using Escherichia
Supplementary materials TetR repressor-based bioreporters for the detection of doxycycline using Escherichia coli and Acinetobacter oleivorans Hyerim Hong and Woojun Park * Department of Environmental
More informationUniversity of Groningen. Vasoregression in incipient diabetic retinopathy Pfister, Frederick
University of Groningen Vasoregression in incipient diabetic retinopathy Pfister, Frederick IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/473/eaai7696/dc1 Supplementary Materials for Astrocyte-shed extracellular vesicles regulate the peripheral leukocyte response to inflammatory brain lesions
More informationMutation analysis of a Chinese family with oculocutaneous albinism
/, 2016, Vol. 7, (No. 51), pp: 84981-84988 Mutation analysis of a Chinese family with oculocutaneous albinism Xiong Wang 1, Yaowu Zhu 1, Na Shen 1, Jing Peng 1, Chunyu Wang 1, Haiyi Liu 2, Yanjun Lu 1
More informationSUPPLEMENTARY INFORMATION
BASELINE ISCHAEMIA a b Phd2 +/- c d Collateral growth and maintenance SMC recruitment SMC proliferation Phd2 +/- NF- B off NF- B on NF- B on NF- B on Endothelial cell Smooth muscle cell Pro-arteriogenic
More informationIsolate Sexual Idiomorph Species
SUPLEMENTARY TABLE 1. Isolate identification, sexual idiomorph and species of each isolate used for MAT locus distribution in Paracoccidioides species. Isolate Sexual Idiomorph Species Pb01 MAT1-1 P. lutzii
More informationMechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis SUPPLEMENTARY INFORMATION
Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis Pooja Arora 1, Aneesh Goyal 2, Vivek T atarajan 1, Eerappa Rajakumara 2, Priyanka Verma 1, Radhika Gupta 3,
More informationmir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Supplementary Information
Title: mir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Authors: Juan Pablo Lopez 1, Raymond Lim 3, Cristiana Cruceanu 1, Liam Crapper 1,
More informationEnhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction
Original article http://dx.doi.org/10.3345/kjp.2012.55.11.424 Korean J Pediatr 2012;55(11):424-429 eissn 1738-1061 pissn 2092-7258 Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationGenome-wide identification of TCF7L2/TCF4 target mirnas reveals a role for mir-21 in Wnt-driven epithelial cancer
INTERNATIONAL JOURNAL OF ONCOLOGY 40: 519-526, 2012 Genome-wide identification of TCF7L2/TCF4 target mirnas reveals a role for mir-21 in Wnt-driven epithelial cancer FENGMING LAN 1-3*, XIAO YUE 1-3,5*,
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More information3) Table_S1: Clinical Characteristics of Breast Cancer Patients. 5) Table_S3: Primer sequences used for qt-pcr of ChIP samples
Supplemental Section: 1) Eight supplemental figures and legends 2) Supplemental Materials and Methods 3) Table_S1: Clinical Characteristics of Breast Cancer Patients 4) Table_S2: Oligonucleotide sequences
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationThe Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital
The Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital Jung-Woo Choi MD, PhD; Younghye Kim MD, PhD; Ju-Han Lee
More informationSupplementary Fig. 1 No relative growth advantage of Foxp3 negative cells.
Supplementary Fig. 1 Supplementary Figure S1: No relative growth advantage of Foxp3 negative cells. itreg were induced from WT (A) or FIR (B) CD4 + T cells. FIR itregs were then removed from the TCR signal
More informationAn epithelial circadian clock controls pulmonary inflammation and glucocorticoid action
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action Supplementary Figure : Expression levels of toll-like receptor 4 (Tlr4) in muse lung does not change throughout the
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10743 Supplementary Figures and Legends Supplementary Figure 1. CYP17A1 (red boxes) lies at the intersection of steroid hormone biosynthetic pathways. CYP17A1
More informationwithout LOI phenotype by breeding female wild-type C57BL/6J and male H19 +/.
Sakatani et al. 1 Supporting Online Material Materials and methods Mice and genotyping: H19 mutant mice with C57BL/6J background carrying a deletion in the structural H19 gene (3 kb) and 10 kb of 5 flanking
More informationCancer Genetics 204 (2011) 45e52
Cancer Genetics 204 (2011) 45e52 Exon scanning by reverse transcriptaseepolymerase chain reaction for detection of known and novel EML4eALK fusion variants in nonesmall cell lung cancer Heather R. Sanders
More informationDetection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany
HLA ISSN 2059-2302 BRIEF COMMUNICATION Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany C. J. Hernández-Frederick 1, N. Cereb 2,A.S.Giani 1, J.
More informationWhat do you think of when you here the word genome?
What do you think of when you here the word genome? What do you think of when you here the word genome? Personal Genomics Outline Review of pre-lab work Genomics and Medicine Case Overview & Assignment
More informationIsolation and Genetic Characterization of New Reassortant H3N1 Swine Influenza Virus from Pigs in the Midwestern United States
JOURNAL OF VIROLOGY, May 2006, p. 5092 5096 Vol. 80, No. 10 0022-538X/06/$08.00 0 doi:10.1128/jvi.80.10.5092 5096.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Isolation
More informationNucleotide diversity of the TNF gene region in an African village
(2001) 2, 343 348 2001 Nature Publishing Group All rights reserved 1466-4879/01 $15.00 www.nature.com/gene Nucleotide diversity of the TNF gene region in an African village A Richardson 1, F Sisay-Joof
More informationINTERLEUKIN-10 FACILITATES BOTH CHOLESTEROL UPTAKE AND EFFLUX IN MACROPHAGES
SUPPLEMENTAL DATA INTERLEUKIN-10 FACILITATES BOTH CHOLESTEROL UPTAKE AND EFFLUX IN MACROPHAGES Xinbing Han, Shiro Kitamoto, Qingyu Lian and William A. Boisvert Vascular Medicine Research Unit, Brigham
More informationSupplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature
Supplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature BA vs. preadipocytes. b, Number of GPCRs with 2-fold
More informationSupplementary Data. Clinical Setup. References. Program for Embryo Donation
Supplementary Data Clinical Setup Notwithstanding their value in stem cell research, the source of supernumerary human blastocysts for the derivation of new stem cell lines and the modalities of their
More informationSUPPLEMENTAL FIGURE 1
SUPPLEMENTL FIGURE 1 C Supplemental Figure 1. pproach for removal of snorns from Rpl13a gene. () Wild type Rpl13a exonintron structure is shown, with exo in black and intronic snorns in red rectangles.
More informationExpression of Selected Inflammatory Cytokine Genes in Bladder Biopsies
Borneo Journal of Resource Science and Technology (2013) 3(2): 15-20 Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies EDMUND UI-HANG SIM *1, NUR DIANA ANUAR 2, TENG-AIK ONG 3, GUAN-
More informationBeta Thalassemia Case Study Introduction to Bioinformatics
Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationAdvanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health
Write your name here Surname Other names Edexcel GCE Centre Number Candidate Number Biology Advanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health Thursday 8 January 2009 Morning Time: 1 hour
More information