Supplemental Data. Wang et al. (2013). Plant Cell /tpc

Size: px
Start display at page:

Download "Supplemental Data. Wang et al. (2013). Plant Cell /tpc"

Transcription

1 Supplemental Data. Wang et al. (2013). Plant Cell /tpc Supplemental Figure 1. 3-MA Treatment Reduces the Growth of Seedlings. Two-week-old Nicotiana benthamiana seedlings germinated on MS plates containing or not containing 5 mm 3-MA.

2 Supplemental Figure 2. Reduced Expression Levels of ATG Genes in the Silenced Plants. We used the tobacco rattle virus (TRV)-based vectors to silence ATG genes in Nicotiana benthamiana. RT-PCR analyses of ATG transcripts in the leaves of the silenced plants were performed using the gene-specific primers listed in Supplemental Table 2. EF1A was used as an internal control.

3 Supplemental Figure 3. Autophagosomes Are Rarely Observed in ATG6-Silenced Plants Imaged by Laser-Scanning Confocal Microscopy.

4 (A) Visualization of autophagosomes during the night by MDC staining. Leaves were harvested from ATG6-silenced plants exposed to darkness for 0 h, 4 h, or 8 h. Structures that incorporated MDC are green, whereas chloroplasts are red. Scale bars = 10 μm. (B) Visualization of autophagosomes during the night using the autophagy marker, CFP-ATG8f. Leaves were harvested from ATG6-silenced plants exposed to darkness for 0 h, 4 h, or 8 h. The CFP-ATG8f fusion protein appears cyan and chloroplasts appear red. Scale bars = 10 μm.

5 Supplemental Figure 4. Characterization of Starch Granules and SSGLs. (A) Average number of the visible starch granules per chloroplast. Leaves exposed to darkness for 0 h, 2 h, 4 h or 8 h were harvested for the TEM (Transmission Electron Microscope) analysis. More than a hundred chloroplasts in about ten mesophyll cells were used for the quantification of visible starch granule numbers and calculation of average number of visible starch granules per chloroplast. Values represent means±se. (B) Distribution of starch granule diameter at the end of the day. The diameter of

6 starch granules accumulated in chloroplasts was measured by using the TEM images. Sixty-five data points (triangles) were collected and presented. The black solid line represents the mean of the data. (C) Distribution of SSGL diameter observed outside of the chloroplast. The diameter of SSGLs was measured using TEM images of leaves exposed to darkness for 2 h and 4 h. Fifty-five data points (diamonds) were collected and presented. The black solid line represents the mean of the data.

7 Supplemental Figure 5. The Starch-Excess Phenotype in ATG6-Silenced Plants Is Due to the Reduced Starch Degradation During the Night. (A) Iodine staining of leaves harvested at the end of the day showed that ATG6-silenced leaves accumulate more starch than the non-silenced ones. At least two replicate leaf samples were used for the staining. (B) and (C) Destarch assay revealed that starch overaccumulation in ATG6-silenced leaves is caused by reduced degradation rather than enhanced synthesis. After

8 exposure to darkness for 60 h, ATG6-silenced and non-silenced plants were returned to a regular 16-h light/8-h dark cycle (time point 0 h). The leaf starch content was measured during the next two days at different time points. (B) Leaf starch contents of ATG6-silenced (red circles) and non-silenced plants (black squares). Values represent means±se from at least two replicate leaf samples. White and black bars on the bottom indicate days and nights, respectively. (C) Percentage of starch degraded in ATG6-silenced (red column) and non-silenced (black column) plants during each night as a percentage of the starch synthesized during the day. The values are determined according to the starch content measured at each time point in (B).

9

10 Supplemental Figure 6. Autophagosome Formation Is Reduced in Other ATG-Silenced Plants Examined by Laser-Scanning Confocal Microscopy. We monitored the autophagic activity in leaves of ATG-silenced and non-silenced plants using the autophagy marker, CFP-ATG8f. Enhanced autophagosome formation was usually detected in the leaves of non-silenced plants exposed to darkness for 4 h (VIGS-Vector), while few autophagosomes were observed in the ATG-silenced plants. The CFP-ATG8f fusion protein appears cyan and chloroplasts appear red. Scale bars = 10 μm.

11 Supplemental Figure 7. Ultrastructural Analysis of Silver Proteinate-Stained SSGLs (A) Control treatments for demonstration of starch components in SSGLs with PA-TCH-SP method. No silver grains were deposited on the starch granules and SSGLs (arrows) in the control sections (stained with TCH-SP or PA-SP or SP) and therefore they appeared electron-translucent, similar with the appearance of starch components in the unstained sections. However, intensive staining of the starch granules and SSGLs was observed in the sections treated with PA-TCH-SP. The results clearly demonstrated the SSGLs were starch components. The blue, cyan, red arrows indicate the unstained SSGLs in the vacuole, cytoplasm and autophagosome-like structures, respectively. The yellow arrow indicates the silver-stained SSGL in the vacuole. Osmiophilic granules (magenta arrowheads) were often observed in the chloroplasts. They appeared electron-dense in the non-oxidized sections (Unstained, TCH-SP, SP) and electron-lucent in the oxidized sections (PA-SP,

12 PA-TCH-SP) as the result of removal of the tissue-bound osmium from the sections by PA oxidation. The red asterisk refers to an isolation membrane (the autophagosome precursor). (B) Three types of silver proteinate-stained SSGLs in the vacuole. The red, yellow, and blue arrows refer to SSGLs engulfed by a single-membrane vesicle, SSGLs located directly in the vacuole, and SSLGs that had almost completely degraded, respectively. Areas enclosed by the magenta dashed line indicate the representative diffuse silver depositions which are supposed to be stained glucans released from the SSGLs. S, starch; V, vacuole; Cp, chloroplast; M, mitochondrion; CW, cell wall. Scale bars = 500 nm.

13

14 Supplemental Figure 8. Developmental Phenotypes and Leaf Starch Content in Wild-Type Arabidopsis and atg Mutantst. (A) Two-week-old atg2, atg5, and atg9 seedlings germinated on rich medium showed no significant difference in growth compared with wild-type Columbia seedlings. Scale bars = 1mm. (B) Quantification of starch content in the atg mutant seedlings germinated on rich medium at the end of the night. Approximately 25 seedlings were harvested and regarded as one sample for the starch quantification test. Values are means ± SE from four replicate samples. DW, dry weight. (C) The six-week-old soil-grown atg2, atg5 mutants showed reduced growth and early senescence while atg9 showed no significant difference compared with wild-type Columbia. Scale bars = 1cm. (D) Quantification of leaf starch content in the soil-grown atg mutants at the end of the night. Leaf samples were harvested from the six-week-old Arabidopsis plants grown under a 16-h light/8-h dark cycle Values are means±se from two more replicate samples. FW, fresh weight.

15 Supplemental Figure 9. Ultrastructure of Fragmented Starch Granules in Leaves Exposed to Darkness. Two fragmented starch granules (indicated by blue squares) in the silver proteinate-stained sections are shown in (A) and (B), respectively. The arrowheads refer to the Small starch granule-like structures (SSGLs) segmented from the main body of the starch granule. S, starch; V, vacuole. Scale bars = 500 nm.

16 Supplemental Table 1. List of Primers Used in This Study Purpose Gene name Primer name Primer sequence(5 to 3 ) ATG2 ATG2-F GCGTAAGGACAGCCTCAATC RT-PCR ATG2-R CTGAAACTAATGGCATGGTC for confirming ATG3 ATG3-F TACTGTCGCAGAAGATTCAC gene silencing ATG3-R CTTTCTTTAGGTTTCCCATG ATG5 ATG5-F AAGCTCATACGCATTCAGGG ATG5-R GCTTCGGACCTTTGCTACCT ATG6 ATG6-F CCTTCTTCTTCATACAATGGCTCA ATG6-R AGACGGTTGCAGAAAGTGGC ATG7 ATG7-F TTGCTCCTATTGCATCAGCC ATG7-R ATTATCCCAGTCCAGCGTGT PI3K PI3K-F TTAGCAACTGGGCACGATGA PI3K-R CGGTGGAAAGGGCTTAGGAT VTI12 VTI12-F CAAGTGACAGAATCAGGGAG VTI12-R AAAGTAAACCCGTAGAGCAT EF1A EF1A-F CCCCTTCGTCTTCCACTTCA EF1A-R GCTTGGTCGGCATCATCTTA Real-time RT-PCR ATG1c ATG1c-F TGGAAAGTCCCTCATCTGCACCTG ATG1c-R GCCTGCCTACCTCAACCTTCTCAT ATG2 ATG2-F GCAATTGGGCTTGGAGTGCATTTG ATG2-R CCTGTCGGGCATCTCTAGGTTGAT ATG4 ATG4-F GGCGAAGCTGACTGGATACCTGTT ATG4-R ATCATCCTGCACGCCGACAATGTA ATG6 ATG6-F ACCTGCGTAAAGGAGTTTGCTGAC ATG6-R AGAGCTTTGGTCCAACTTTCCTGC ATG7 ATG7-F CCAGCAGTGGAAGCAGAAGGTCTT ATG7-R GCCACCGACTTTCCCGTGTATCA ATG9 ATG9-F TCCGGTGGATTTGCTGCTGTTCT ATG9-R ACATCGCTCCCTGTGGGTCAAG PI3K PI3K-F GCTGTGCTGGTTACTCCGTCATC PI3K-R ACTGACTTTCCGCTCCACCCATA ACTIN ACTIN-F CCCAGAGAGGAAATACAGTG SEX1 ATG6 ACTIN-R SEX1-F-for silencing test SEX1-R-for silencing test ATG6-F-for silencing test ATG6-R-for silencing test CAATAGACGGACCAGATTCG GTTATGCCGGTGCTGGCCTCTAT TTCCATCCCTCACTACACCCTCGA CCTCTGTCAGAACTGCCACAATCC TCCCTGGTCCCTGATTTCTTTGCT

17 Overlapping PCR amplification of CFP-ATG8f Overlapping PCR amplification of GBSSI-YFP CFP CFP-F CgACgACAAgACCgTgACCATGGTGAG CAAGGGCGAGGAGCTGT CFP-R CTTGTACAGCTCGTCCATGCCGAGA ATG8f ATG8f-F ATGGACGAGCTGTACAAGATGGCAA AGAGTTCATTCAAGCAAG ATG8f-R gaggagaagagccgtttacaccaagttg AGGTCGCCAAAT GBSSI GBSSI-F CgACgACAAgACCgTgACCATGGCAAG CATCACAGCTTCACACT GBSSI-R AGGAGTGGCCACATTTTCCTTGGCA YFP YFP-F GAAAATGTGGCCACTCCTATGGTGAG CAAGGGCGAGGAGCTGT YFP-R gaggagaagagccgttcacttgtacagct CGTCCATG

Supplemental Data. Beck et al. (2010). Plant Cell /tpc

Supplemental Data. Beck et al. (2010). Plant Cell /tpc Supplemental Figure 1. Phenotypic comparison of the rosette leaves of four-week-old mpk4 and Col-0 plants. A mpk4 vs Col-0 plants grown in soil. Note the extreme dwarfism of the mpk4 plants (white arrows)

More information

Supporting Information

Supporting Information Supporting Information Harries et al. 1.173/pnas.9923916 A Fig. S1. Disruption of microfilaments within epidermal cells after treatment with 5 M Lat. Images of N. benthamiana cells are from plants expressing

More information

Supplementary Figures

Supplementary Figures Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion

More information

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without

More information

Supplemental Data. Deinlein et al. Plant Cell. (2012) /tpc

Supplemental Data. Deinlein et al. Plant Cell. (2012) /tpc µm Zn 2+ 15 µm Zn 2+ Growth (% of control) empty vector NS1 NS2 NS3 NS4 S. pombe zhfδ Supplemental Figure 1. Functional characterization of. halleri NS genes in Zn 2+ hypersensitive S. pombe Δzhf mutant

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2294 Figure S1 Localization and function of cell wall polysaccharides in root hair cells. (a) Spinning-disk confocal sections of seven day-old A. thaliana seedlings stained with 0.1% S4B

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

Open Flower. Juvenile leaf Flowerbud. Carpel 35 NA NA NA NA 61 NA 95 NA NA 15 NA 41 3 NA

Open Flower. Juvenile leaf Flowerbud. Carpel 35 NA NA NA NA 61 NA 95 NA NA 15 NA 41 3 NA PaxDB Root Juvenile leaf Flowerbud Open Flower Carpel Mature Pollen Silique Seed Sec3a Sec3b Sec5a Sec5b Sec6 Sec8 Sec10a/b Sec15a Sec15b Exo84a Exo84b Exo84c Exo70A1 Exo70A2 Exo70A3 49 47 8 75 104 79

More information

Supporting Information

Supporting Information Supporting Information Lee et al. 10.1073/pnas.0910950106 Fig. S1. Fe (A), Zn (B), Cu (C), and Mn (D) concentrations in flag leaves from WT, osnas3-1, and OsNAS3-antisense (AN-2) plants. Each measurement

More information

Expression constructs

Expression constructs Gene expressed in bebe3 ZmBEa Expression constructs 35S ZmBEa Pnos:Hygromycin r 35S Pnos:Hygromycin r 35S ctp YFP Pnos:Hygromycin r B -1 Chl YFP- Merge Supplemental Figure S1: Constructs Used for the Expression

More information

Supplemental Information. Spatial Auxin Signaling. Controls Leaf Flattening in Arabidopsis

Supplemental Information. Spatial Auxin Signaling. Controls Leaf Flattening in Arabidopsis Current Biology, Volume 27 Supplemental Information Spatial Auxin Signaling Controls Leaf Flattening in Arabidopsis Chunmei Guan, Binbin Wu, Ting Yu, Qingqing Wang, Naden T. Krogan, Xigang Liu, and Yuling

More information

Figure S1 Expression of AHL gene family members in diploid (Ler Col) and triploid (Ler

Figure S1 Expression of AHL gene family members in diploid (Ler Col) and triploid (Ler Supplemental material Supplemental figure legends Figure S Expression of AHL gene family members in diploid (Ler ) and triploid (Ler osd) seeds. AHLs from clade B are labelled with (I), and AHLs from clade

More information

Supplementary Figures

Supplementary Figures Supplementary Figures 9 10 11 Supplementary Figure 1. Old plants are more resistant to insect herbivores than young plants. (a) Image of young (1-day-old, 1D) and old (-day-old, D) plants of Arabidopsis

More information

Supplemental Data. Candat et al. Plant Cell (2014) /tpc Cytosol. Nucleus. Mitochondria. Plastid. Peroxisome. Endomembrane system

Supplemental Data. Candat et al. Plant Cell (2014) /tpc Cytosol. Nucleus. Mitochondria. Plastid. Peroxisome. Endomembrane system Cytosol Nucleus 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 PSORT MultiLoc YLoc SubLoc BaCelLo WoLF PSORT

More information

Aim 19: Cellular Respiration

Aim 19: Cellular Respiration 1. During the process of cellular respiration, energy is released from A) carbon dioxide B) oxygen atoms C) water molecules D) chemical bonds 2. The energy used to obtain, transfer, and transport materials

More information

Supporting Information

Supporting Information Supporting Information Fig. S1. Overexpression of Rpr causes progenitor cell death. (A) TUNEL assay of control intestines. No progenitor cell death could be observed, except that some ECs are undergoing

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7

More information

Supplemental Data. Müller-Xing et al. (2014). Plant Cell /tpc

Supplemental Data. Müller-Xing et al. (2014). Plant Cell /tpc Supplemental Figure 1. Phenotypes of iclf (clf-28 swn-7 CLF pro :CLF-GR) plants. A, Late rescue of iclf plants by renewed DEX treatment; senescent inflorescence with elongated siliques (arrow; 90 DAG,

More information

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T

More information

Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells.

Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells. Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells. a. Schematic of the V-ATPase proton pump macro-complex structure. The V1 complex is composed of

More information

Supplemental Figure S1.

Supplemental Figure S1. 53 kda- WT TPS29.2 (ethanol) TPS29.2 (water) Supplemental Figure S1. Inducible expression of E. coli otsa (TPS) in Arabidopsis. Immunoblot of leaf proteins (20 µg per lane) extracted from: (i) WT Col-0,

More information

Supplemental Data. Hao et al. (2014). Plant Cell /tpc

Supplemental Data. Hao et al. (2014). Plant Cell /tpc Supplemental Figure 1. Confocal Images and VA-TIRFM Analysis of GFP-RbohD in Arabidopsis Seedlings. (A) RbohD expression in whole Arabidopsis seedlings. RbohD was expressed in the leaves, hypocotyl, and

More information

Thursday, October 16 th

Thursday, October 16 th Thursday, October 16 th Good morning. Those of you needing to take the Enzymes and Energy Quiz will start very soon. Students who took the quiz Wednesday: Please QUIETLY work on the chapter 6 reading guide.

More information

Disruption of Microtubules in Plants Suppresses Macroautophagy and Triggers Starch Excess- Associated Chloroplast Autophagy

Disruption of Microtubules in Plants Suppresses Macroautophagy and Triggers Starch Excess- Associated Chloroplast Autophagy Autophagy ISSN: 1554-8627 (Print) 1554-8635 (Online) Journal homepage: http://www.tandfonline.com/loi/kaup20 Disruption of Microtubules in Plants Suppresses Macroautophagy and Triggers Starch Excess- Associated

More information

Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure.

Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. Animal cells have a lysosome (related to vacuole) and centrioles (function

More information

Cell wall components:

Cell wall components: Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. The Cell Wall The primary cell wall is capable of rapid expansion during

More information

Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis

Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato

More information

s -1 (A) and (B) 2 s 1 in WT, riq1, and the riq1 mutant complemented by

s -1 (A) and (B) 2 s 1 in WT, riq1, and the riq1 mutant complemented by A 250-2 s -1 B 250-2 s -1 Supplemental Figure 1. The NPQ Phenotype in riq Mutants Was Complemented by Introduction of RIQ Genes. (A) and (B) 2 s 1 in, riq1, and the riq1 mutant complemented by the RIQ1

More information

Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation. Sarah J. MacDonald Assistant Professor Missouri Valley College

Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation. Sarah J. MacDonald Assistant Professor Missouri Valley College Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation Sarah J. MacDonald Assistant Professor Missouri Valley College Phytoremediation of Organic Compounds Phytodegradation: Plants

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Chen et al., http://www.jcb.org/cgi/content/full/jcb.201210119/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Lack of fast reversibility of UVR8 dissociation. (A) HEK293T

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Supplemental Data. Hiruma et al. Plant Cell. (2010) /tpc Col-0. pen2-1

Supplemental Data. Hiruma et al. Plant Cell. (2010) /tpc Col-0. pen2-1 A Ch B Col-0 Cg pen2-1 Supplemental Figure 1. Trypan Blue Staining of Leaves Inoculated with Adapted and Nonadapted Colletotrichum Species.(A) Conidial suspensions of C. higginsianum MAFF305635 (Ch) were

More information

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding

More information

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using

More information

Table I: PHT1 transporter family comparison at the amino acid level. BLAST program was used to obtain percentage of similarity and identity (in bold).

Table I: PHT1 transporter family comparison at the amino acid level. BLAST program was used to obtain percentage of similarity and identity (in bold). Supplemental Tables Table I: PHT1 transporter family comparison at the amino acid level. BLAST program was used to obtain percentage of similarity and identity (in bold). PHT1;1 PHT1;2 PHT1;3 PHT1;4 PHT1;5

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

Supplemental Data. Wu et al. (2010). Plant Cell /tpc

Supplemental Data. Wu et al. (2010). Plant Cell /tpc Supplemental Figure 1. FIM5 is preferentially expressed in stamen and mature pollen. The expression data of FIM5 was extracted from Arabidopsis efp browser (http://www.bar.utoronto.ca/efp/development/),

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary

More information

J. Cell Sci. 129: doi: /jcs : Supplementary information

J. Cell Sci. 129: doi: /jcs : Supplementary information Movie 1. AgLDL is contained in small sub-regions of the lysosomal synapse that are acidic. J774 cells were incubated with agldl dual labeled with a ph sensitive and a ph insensitive fluorophore for 1 hr.

More information

The Rab GTPase RabA4d Regulates Pollen Tube Tip Growth in Arabidopsis thaliana W

The Rab GTPase RabA4d Regulates Pollen Tube Tip Growth in Arabidopsis thaliana W The Plant Cell, Vol. 21: 526 544, February 2009, www.plantcell.org ã 2009 American Society of Plant Biologists The Rab GTPase RabA4d Regulates Pollen Tube Tip Growth in Arabidopsis thaliana W Amy L. Szumlanski

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures

SUPPLEMENTARY INFORMATION. Supplementary Figures SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure 1: Characterization of CerTN-L15 expressed in Arabidopsis roots. a. Ratiometric images of CerTN-L15 in roots under osmotic stress Ratiometric

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has

More information

Part 1 Multiple Choice Shade the correct answer on the SCANTRON sheet provided.

Part 1 Multiple Choice Shade the correct answer on the SCANTRON sheet provided. Part 1 Multiple Choice Shade the correct answer on the SCANTRON sheet provided. 1. The type of electron microscope that gives 2 dimensional images. a) Scanning b) Condensing c) Transmission d) Multidimensional

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice. Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.

More information

University of Groningen

University of Groningen University of Groningen Mechanisms of Hemagglutinin Targeted Influenza Virus Neutralization Brandenburg, Boerries; Koudstaal, Wouter; Goudsmit, Jaap; Klaren, Vincent; Tang, Chan; Bujny, Miriam V.; Korse,

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis

More information

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes

More information

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary

More information

Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei.

Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei. Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei. (B) The standard curve for lysine concentrations versus OD600 values

More information

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547 Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living

More information

Supplemental Information. Figures. Figure S1

Supplemental Information. Figures. Figure S1 Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the

More information

TITLE: Fast-Track Development of Potato Clones with Pure Amylopectin Starch Used in the Paper, Textile and Food Industries by Using Induced Mutation.

TITLE: Fast-Track Development of Potato Clones with Pure Amylopectin Starch Used in the Paper, Textile and Food Industries by Using Induced Mutation. AGRICULTURAL RESEARCH FOUNDATION FINAL REPORT FUNDING CYCLE 2014 2016 TITLE: Fast-Track Development of Potato Clones with Pure Amylopectin Starch Used in the Paper, Textile and Food Industries by Using

More information

CELL ORGANIZATION. Unit 19 LEARNING OBJECTIVES

CELL ORGANIZATION. Unit 19 LEARNING OBJECTIVES Unit 19 CELL ORGANIZATION LEARNING OBJECTIVES 1. Gain an appreciation for the small size of cells and the structures contained within the cell. 2. Learn about some of the ways one can study the parts of

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial

More information

Temperature-Sensitive Mutants Isolated from Hamster and

Temperature-Sensitive Mutants Isolated from Hamster and JOURNAL OF VIROLOGY, Nov. 1975, p. 1332-1336 Copyright i 1975 American Society for Microbiology Vol. 16, No. 5 Printed in U.S.A. Temperature-Sensitive Mutants Isolated from Hamster and Canine Cell Lines

More information

Influenza virus exploits tunneling nanotubes for cell-to-cell spread

Influenza virus exploits tunneling nanotubes for cell-to-cell spread Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,

More information

Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR

Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR and LRRK2 WD40 GST fusion proteins (5 µg) were loaded

More information

Lysosomes. Gr: lysis solution, soma body. Membrane bounded vesicles. Usually round ovoid or irregular electron dense bodies m.

Lysosomes. Gr: lysis solution, soma body. Membrane bounded vesicles. Usually round ovoid or irregular electron dense bodies m. Lysosomes Gr: lysis solution, soma body Membrane bounded vesicles Usually round ovoid or irregular electron dense bodies 0.05 0.5 m. Lysosomes No. varies from a few to several hundred per cell, in different

More information

Supplemental Information. Autophagy in Oncogenic K-Ras. Promotes Basal Extrusion. of Epithelial Cells by Degrading S1P. Current Biology, Volume 24

Supplemental Information. Autophagy in Oncogenic K-Ras. Promotes Basal Extrusion. of Epithelial Cells by Degrading S1P. Current Biology, Volume 24 Current Biology, Volume 24 Supplemental Information Autophagy in Oncogenic K-Ras Promotes Basal Extrusion of Epithelial Cells by Degrading S1P Gloria Slattum, Yapeng Gu, Roger Sabbadini, and Jody Rosenblatt

More information

The N-end rule pathway regulates pathogen responses. in plants

The N-end rule pathway regulates pathogen responses. in plants SUPPLEMENTARY INFORMATION The N-end rule pathway regulates pathogen responses in plants Rémi de Marchi 1,2, Maud Sorel 1, Brian Mooney 1, Isabelle Fudal 3, Kevin Goslin 1, Kamila Kwaśniewska 4, Patrick

More information

Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend

Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin

More information

Supplemental Materials Molecular Biology of the Cell

Supplemental Materials Molecular Biology of the Cell Supplemental Materials Molecular Biology of the Cell Garcia-Alvarez et al. Supplementary Figure Legends Figure S1.Expression and RNAi-mediated silencing of STIM1 in hippocampal neurons (DIV, days in vitro).

More information

Laboratory diagnosis of parasitic diseases. (Amoebiasis)

Laboratory diagnosis of parasitic diseases. (Amoebiasis) Laboratory diagnosis of parasitic diseases (Amoebiasis) Sarah Alharbi Clinical Laboratory department Collage of Applied Medical Sciences King Saud University This document contains materials modified or

More information

CELL STRUCTURE AND CELL ORGANISATION

CELL STRUCTURE AND CELL ORGANISATION CELL STRUCTURE AND CELL ORGANISATION CHAPTER 2 https://wickedbiology.wordpress.com Cellular components of animal & plant cells https://wickedbiology.wordpress.com Plant Cells Cell wall Plasma membrane

More information

McWilliams et al., http :// /cgi /content /full /jcb /DC1

McWilliams et al., http ://  /cgi /content /full /jcb /DC1 Supplemental material JCB McWilliams et al., http ://www.jcb.org /cgi /content /full /jcb.201603039 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. In vitro characterization of mito-qc. (A and B) Analysis

More information

1. Arrows A, B, and C in the diagram below represent the processes necessary to make the energy stored in food available for muscle activity.

1. Arrows A, B, and C in the diagram below represent the processes necessary to make the energy stored in food available for muscle activity. 1. Arrows A, B, and C in the diagram below represent the processes necessary to make the energy stored in food available for muscle activity. The correct sequence of processes represented by A, B, and

More information

Supporting Information

Supporting Information Supporting Information Dauvillée et al. 10.1073/pnas.0907424106 Fig. S1. Iodine screening of the C. cohnii mutant bank. Each single colony was grown on rich-medium agar plates then vaporized with iodine.

More information

Plant Cell, Development & Ultrastructure

Plant Cell, Development & Ultrastructure PCDU Lecture Plant Cell, Development & Ultrastructure Plant Cell Biology Labs Download at: http://goo.gl/111tha Microtubules 13 Protofilamente 25nm Plant MT Cytoskeleton Animal MT cytoskeleton Preprophase

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Global TeNT expression effectively impairs synaptic transmission. Injection of 100 pg tent mrna leads to a reduction of vesicle mediated synaptic transmission in the spinal cord

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure

More information

JCB. Supplemental material. Gu et al.,

JCB. Supplemental material. Gu et al., Supplemental material Gu et al., http://www.jcb.org/cgi/content/full/jcb.201010075/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. S1P directly induces actin assembly. Actin assembly at the

More information

Supplemental Figures:

Supplemental Figures: Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)

More information

Expanded View Figures

Expanded View Figures PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3

More information

OCR (A) Biology GCSE. Topic 1: Cell Level Systems

OCR (A) Biology GCSE. Topic 1: Cell Level Systems OCR (A) Biology GCSE Topic 1: Cell Level Systems Notes (Content in bold is for higher tier only) Cell structures Microscopes (1.1a and c) Light (optical) microscopes The specimen is placed onto a slide,

More information

CAMBRIDGE INTERNATIONAL EXAMINATIONS General Certificate of Education Advanced Level

CAMBRIDGE INTERNATIONAL EXAMINATIONS General Certificate of Education Advanced Level Centre Number Candidate Number Name CAMBRIDGE INTERNATIONAL EXAMINATIONS General Certificate of Education Advanced Level BIOLOGY 9700/04 Paper 4 Structured Questions A2 Core Candidates answer on the Question

More information

A Tour of the Cell. Chapter 6. Biology. Edited by Shawn Lester. Inner Life of Cell. Eighth Edition Neil Campbell and Jane Reece

A Tour of the Cell. Chapter 6. Biology. Edited by Shawn Lester. Inner Life of Cell. Eighth Edition Neil Campbell and Jane Reece Chapter 6 A Tour of the Cell Inner Life of Cell Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin

More information

General Biology. The Fundamental Unit of Life The Cell. All organisms are made of cells The cell is the simplest collection of matter that can live

General Biology. The Fundamental Unit of Life The Cell. All organisms are made of cells The cell is the simplest collection of matter that can live General Biology Course No: BNG2003 Credits: 3.00 3. A Tour of the Cell Prof. Dr. Klaus Heese The Fundamental Unit of Life The Cell All organisms are made of cells The cell is the simplest collection of

More information

A Tour of the Cell Chapter 4. Outline. Early contributors to Understanding Cells. Cell Theory. Cell Size s Matt Schleiden & Ted Schann

A Tour of the Cell Chapter 4. Outline. Early contributors to Understanding Cells. Cell Theory. Cell Size s Matt Schleiden & Ted Schann A Tour of the Cell Chapter 4 Outline History of the science behind cells Cell theory & its importance Why are cells small? Microscopes Cell structure and function Prokaryotic cells Eukaryotic cells Early

More information

Cell Processes Review

Cell Processes Review 1. Most green algae are able to obtain carbon dioxide from the environment and use it to synthesize organic compounds. This activity is an example of 1) hydrolysis 2) saprophytism 3) cellular respiration

More information

Production of Exosomes in a Hollow Fiber Bioreactor

Production of Exosomes in a Hollow Fiber Bioreactor Production of Exosomes in a Hollow Fiber Bioreactor John J S Cadwell, President and CEO, FiberCell Systems Inc INTRODUCTION Exosomes are small lipid membrane vesicles (80-120 nm) of endocytic origin generated

More information

C) amount of carbon dioxide absorbed by the animal B) rate of respiration of the animal

C) amount of carbon dioxide absorbed by the animal B) rate of respiration of the animal Name: 1) A model of a section of a cell membrane is represented below. 4034-1 - Page 1 Which type of molecule is indicated by the arrow? A) carbohydrate B) protein C) lipid D) nucleotide 2) The movement

More information

Light triggers PILS-dependent reduction in nuclear auxin signalling for growth transition

Light triggers PILS-dependent reduction in nuclear auxin signalling for growth transition In the format provided y the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 217.15 Light triggers PILS-dependent reduction in nuclear auxin signalling for growth transition Chloé

More information

Supplementary Figure 1. Gene expression analysis of GSNOR1 and NIA2 in genotypes with altered NO signalling. Relative expression of GSNOR1 in leaves

Supplementary Figure 1. Gene expression analysis of GSNOR1 and NIA2 in genotypes with altered NO signalling. Relative expression of GSNOR1 in leaves Supplementary Figure 1. Gene expression analysis of GSNOR1 and NIA2 in genotypes with altered NO signalling. Relative expression of GSNOR1 in leaves (a) and roots (b) and NIA2 in leaves (c) and roots (d)

More information

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.

More information

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Fig. S1. Schematic diagram of minigenome segments. open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.

More information

Cell Structure. Present in animal cell. Present in plant cell. Organelle. Function. strength, resist pressure created when water enters

Cell Structure. Present in animal cell. Present in plant cell. Organelle. Function. strength, resist pressure created when water enters Cell Structure Though eukaryotic cells contain many organelles, it is important to know which are in plant cells, which are in animal cells and what their functions are. Organelle Present in plant cell

More information

Pinwheels and Crystalline Structures Induced by Atropa Mild Mosaic Virus, a Plant Virus with Particles 925 nm. Long

Pinwheels and Crystalline Structures Induced by Atropa Mild Mosaic Virus, a Plant Virus with Particles 925 nm. Long J. gen. Virol. (I970, xo, 71-78 Printed in Great BritMn 7I Pinwheels and Crystalline Structures Induced by Atropa Mild Mosaic Virus, a Plant Virus with Particles 925 nm. Long By B. D. HARRISON AND I. M.

More information

3 Movement in and out of cells

3 Movement in and out of cells For more awesome GSE and level resources, visit us at www.savemyexams.co.uk/ Movement in and out of cells Question Paper Level IGSE Subject iology Exam oard ambridge International Examinations Unit 3 Movement

More information

Session 2. TiLV isolation and Koch s Postulates

Session 2. TiLV isolation and Koch s Postulates Session 2 Win Surachetpong DVM, PhD, CertAqV, DTBVP Kathy Tang-Nelson PhD TiLV isolation and Koch s Postulates Learning objectives Describe how viruses are isolated Apply the appropriate method to the

More information

Low Demand Questions QUESTIONSHEET 1 The diagrams show some organs in the human body.

Low Demand Questions QUESTIONSHEET 1 The diagrams show some organs in the human body. Low Demand Questions QUESTIONSHEET 1 The diagrams show some organs in the human body. (a) Name the organs labelled A, B, C, D and E. A.... [1] B.... [1] C.... [1] D.... [1] E.... [1] (b) Which of the organs

More information

10/13/11. Cell Theory. Cell Structure

10/13/11. Cell Theory. Cell Structure Cell Structure Grade 12 Biology Cell Theory All organisms are composed of one or more cells. Cells are the smallest living units of all living organisms. Cells arise only by division of a previously existing

More information

A mutant in Arabidopsis Lacking a Chloroplast Specific Lipid. Lewis Kurschner and Karen Thulasi Masters in Botany

A mutant in Arabidopsis Lacking a Chloroplast Specific Lipid. Lewis Kurschner and Karen Thulasi Masters in Botany A mutant in Arabidopsis Lacking a Chloroplast Specific Lipid Lewis Kurschner and Karen Thulasi Masters in Botany Fatty acid nomenclature Fatty acyl composition Chain length Degree of unsaturation and position

More information

3. Which cell has the greater ratio of surface area to volume?

3. Which cell has the greater ratio of surface area to volume? Chapter 4 Worksheet A Tour of the Cell Exercise 1 Metric System Review/Size and Scale of Our World (4.1) Use the information in the two modules and the chart in Module 4.2 to complete the following table

More information

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs. Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used

More information

Nature Immunology: doi: /ni eee Supplementary Figure 1

Nature Immunology: doi: /ni eee Supplementary Figure 1 eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.

More information

The Microscopic World of Cells. The Microscopic World of Cells. The Microscopic World of Cells 9/21/2012

The Microscopic World of Cells. The Microscopic World of Cells. The Microscopic World of Cells 9/21/2012 Organisms are either: Single-celled, such as most prokaryotes and protists or Multicelled, such as plants, animals, and most fungi How do we study cells? Light microscopes can be used to explore the structures

More information

A Tour of the Cell. Chapter 6. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

A Tour of the Cell. Chapter 6. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 6 A Tour of the Cell PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS International General Certificate of Secondary Education

UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS International General Certificate of Secondary Education UNIVERSITY OF CAMBRIDGE INTERNATIONAL EXAMINATIONS International General Certificate of Secondary Education *9254401758* BIOLOGY 0610/61 Paper 6 Alternative to Practical May/June 2011 1 hour Candidates

More information