Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Size: px
Start display at page:

Download "Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value"

Transcription

1 Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml) Urine (ng/ml) (pg/mg) (pg/mg) (pg/mg) (pg/mg) Epinephrine.7 ±. ±. 7±.. ±.7 ±.7 ±7 Norepinephrine 7 ±..7±..±. 7 ±..±..±. Dopamine ± 7..±..±.7 7 ±..±..±. Data are expressed as means ± s.e.m. n =. P <. versus Tph +/+ as determined using a Student s t test. A Welch s t test was used for the ibat epinephrine analyses. Supplementary Table. Tissue weights of HFD fed C7Bl mice treated with vehicle or LP for weeks. Tissue LP P value Heart 7 ±. ±.. Spleen ±. 7 ±.. Retroperitoneal Fat Pad ±. ±.. Inguinal Fat Pad ±. 7 ±. Epididymal Fat Pad 7 ± 7 ±. Tissue weights are in milligrams. Data are expressed as means ± s.e.m. n = vehicle and n = LP treated. P value was determined using a Student s t test, except for heart and spleen weight, which required a Welch s t test. Nature Medicine: doi:./nm.7

2 a b c d Time on chow diet (weeks) Tph +/+ Tph / Body fat (%) Tph +/+ Tph / Fed blood glucose (mm) Tph +/+ Tph / Time on chow diet (weeks) Tph +/+ Tph / GTT AUC (mm min),, Tph +/+ Tph / e 7 Tph +/+ Tph / ITT AUC (mm min), Tph +/+ Tph / Supplementary Figure. Body mass, adiposity and glucose and insulin tolerance in chow fed (low fat control diet) Tph +/+ and Tph / mice. (a) Body mass (n = Tph +/+ and Tph / ) and (b) adiposity (n = Tph +/+ and Tph / ) in Tph +/+ and Tph / mice fed a control chow diet. (c) Blood glucose concentrations over time, (d) glucose tolerance and AUC and (e) insulin tolerance and AUC of Tph +/+ and Tph / mice fed a chow diet (n = Tph +/+ and Tph / mice). Data are expressed as means ± s.e.m. P <. relative to Tph +/+ mice as determined by a Student s t test. Nature Medicine: doi:./nm.7

3 a Plasma serotonin (ng ml - ) e b f c ewat weight (% body mass) d Fed blood glucose (mm) g GTT AUC (mm min),,, P =. ITT AUC (mm min) Basal VO (ml kg - hr - ),,, h i j Activity (x-axis beam breaks),,,, Light Dark Food intake (g day - ) P =. Fold-change in VO (CL-,/saline) Change in IS surface temperature (CL - basal, C) - P =. Saline CL-, Supplementary Figure. Replacement of serotonin in Tph / mice increases adiposity, reduces glucose tolerance and insulin sensitivity and suppresses basal metabolic rate and UCP mediated thermogenesis. (a) Plasma serotonin in HFD fed Tph / mice implanted with subcutaneous day slow release placebo or serotonin (. mg) producing pellet (n = ). (b) Body mass, (c) ewat mass, (d) fed blood glucose over time, (e) glucose tolerance and (f) insulin sensitivity in HFD fed Tph / mice implanted with a subcutaneous placebo or serotonin pellet (n = ). (g) Basal oxygen consumption, (h) cage activity and (i) food intake in HFD fed Tph / mice implanted with subcutaneous placebo or serotonin producing pellet (n = ). (j) Change in oxygen uptake (left) and dorsal interscapular surface temperature (right) of HFD fed Tph / mice implanted with subcutaneous placebo or serotonin pellets following acute injection with saline or the β adrenergic activator CL, (n =, representative thermal images at far right). Data are expressed as means ± s.e.m. P <. relative to placebo pellet mice as determined by a Student s t test. Nature Medicine: doi:./nm.7

4 a Basal Iso phsls HSL Veh -HT -HIAA -HTP Mel L-Trp Veh -HT -HIAA -HTP Mel L-Trp phsls/total HSL (fold Veh basal) Supplementary Figure. precursors and end products do not inhibit PKA signaling in BAT cells. (a) HSL phosphorylation (S) in differentiated brown adipocytes treated with and without isoproterenol following treatment with serotonin related metabolites (n = experiments). Data are expressed as means ± s.e.m. P <. versus corresponding vehicle condition as determined using a Student s t test. HT, hydroxytryptamine; HIAA, hydroxyindoleacetic acid; HTP, hydroxytryptophan; Mel, melatonin; L try, L tryptophan. Nature Medicine: doi:./nm.7

5 a b c d e Start of Daily Injections LP LP GTT AUC (mm min),,7, Tissue weight (g) LP ewat f Liver Body fat (%) Minutes Basal VO (ml kg - hr - ) ITT AUC,,,, P =. Supplementary Figure. Reversal of obesity and dysglycemia with chemical inhibition of Tph. (a) Body mass over time, (b) ewat pad and liver weights, (c) % body fat, and (d) basal oxygen consumption (during an absence of cage movement) in C7Bl mice fed a HFD for wks before being treated with vehicle or LP for wks (n = and LP treated). (e) Glucose tolerance and (f) insulin sensitivity of C7Bl mice fed a HFD for weeks before being treated with vehicle or LP for weeks (n = and LP treated). Data are expressed as means ± s.e.m. P <. versus vehicle as determined using a Student s t test. Nature Medicine: doi:./nm.7

6 a Heart rate (beats min - ) d mrna (relative to Tph +/+ ) Baseline Injections Recovery..... P =.7 Vegfa LP Tph +/+ Tph / Cd 7 7 b Blood pressure (mm Hg) Baseline Injections Recovery 7 7 Systolic Diastolic c Mean arterial pressure (mm Hg) Baseline Injections Recovery 7 7 Supplementary Figure. Chemical inhibition of Tph does not alter heart rate or blood pressure and Tph ablation does not influence angiogenic gene markers. (a) Heart rate, (b) systolic and diastolic blood pressure and (c) mean arterial pressure averaged over hours in HFD fed mice injected with vehicle or LP (n = ). Treatment was preceded by a day baseline period and followed by a day recovery period where no injections were performed. (d) Vegfa and Cd mrna expression in ibat tissue from HFD fed Tph +/+ and Tph / mice (n =.) Data are expressed as means ± s.e.m. Data were not significantly different as determined using a Student s t test. Nature Medicine: doi:./nm.7

7 a b c d WAT FDG uptake (SUV) Tph +/+ Tph / WAT FDG uptake (SUV) LP mrna relative Tph +/+ Tph +/+ Tph / ewat Pgca Ppara Cidea Pdk Ucp mrna relative Tph +/ Pgca Ppara Cidea Pdk Ucp Supplementary Figure. Beige adipose tissue markers in HFD fed LP or vehicle treated mice. FDG uptake into WAT of HFD fed (a) Tph +/+ and Tph / mice (n = ) and (b) vehicle and LP treated C7Bl mice (n = per treatment). Gene expression of brown adipose markers in (c) ewat and (d) iwat depots of HFD fed Tph +/+ and Tph / mice (n = Tph +/+ and Tph / ). (e) Ucp mrna expression from HFD fed mice treated with vehicle or LP (n = for vehicle and LP) and in (f) control and isoproterenol stimulated differentiated inguinal stromal vascular cells (n = per treatment). -HT, -hydroxytryptamine. Data are expressed as means ± s.e.m. P <. versus corresponding Tph +/+, vehicle or control condition as determined using a Student s t test. P =. iwat Tph +/+ Tph / e Relative Ucp mrna iwat LP f mrna (relative to Basal Ctl) Basal Ucp Ctl -HT Iso Nature Medicine: doi:./nm.7

8 a c mrna relative to Ucp +/+ Ucp +/+ Ucp +/+ Tph inhibitor Ucp / Ucp / Tph inhibitor LP. Cd #... Ucp +/+ Ucp /... F/ # Delta body mass (g) Tph inhibitor... Ucp +/+ Ucp / Tnfa... Ucp +/+ Ucp / Ucp +/+ Ucp / Ucp +/+ Ucp / b... Mcp d Serum IL- (pg ml - ) Delta body mass (g) Tph inhibitor Ucp +/+ Ucp / Tph inhibitor Ucp +/+ Ucp / Serum Tnf-α (pg ml - ) Ucp +/+ Ucp / Supplementary Figure 7. Body mass over time in HFD fed Ucp +/+ and Ucp / mice treated with a chemical Tph inhibitor. Weekly body weights (left) and the increase in body mass after weeks of HFD (right) in (a) cohort and (b) cohort of Ucp +/+ and Ucp / mice injected with vehicle or LP. Cohort : n = for Ucp +/+ vehicle and LP, n = for Ucp / vehicle and n = for Ucp / LP; cohort : (n = for all groups). (c) Inflammatory gene expression in ewat of Ucp +/+ and Ucp / mice injected with vehicle or LP (n = for Ucp +/+ vehicle and LP, n = 7 for Ucp / vehicle and n = for Ucp / LP). (d) Serum IL and Tnf α of Ucp +/+ and Ucp / mice injected with vehicle or LP (n = for Ucp +/+ vehicle, n = 7 for Ucp +/+ LP, n = for Ucp / vehicle and n = for Ucp / LP). Data are expressed as means ± s.e.m. P <. compared to vehicle, P <. as a main effect of LP treatment and # P <. relative to Ucp +/+ as determined using a way ANOVA. Nature Medicine: doi:./nm.7

Regulation of adipose tissue remodeling by peripheral serotonin

Regulation of adipose tissue remodeling by peripheral serotonin Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International

More information

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171 SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Supporting Information

Supporting Information Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs

More information

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression) a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network

Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Transduction of adipocytes after intra-ewat administration of AAV vectors. A: Immunostaining against GFP (green) in sections of ewat two weeks after the intra-ewat administration

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is

More information

Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production

Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production activates a duodenal Ampk-dependent pathway to lower hepatic glucose Frank A. Duca, Clémence D. Côté, Brittany A. Rasmussen, Melika Zadeh-Tahmasebi, Guy A. Rutter, Beatrice M. Filippi & Tony K.T. Lam Supplementary

More information

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1 Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2

More information

a b c Physical appearance of mice Lean mass Adipocyte size d e f

a b c Physical appearance of mice Lean mass Adipocyte size d e f LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte

More information

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli

BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli Symposium Co-Chairs: Bruce M. Spiegelman (Harvard/Dana Farber) and Sven Enerbäck (U.Gothenburg) April 17-23, 2015 Snowbird Resort,

More information

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8 Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory

More information

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,

More information

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative

More information

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly, 1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of

More information

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body

More information

Adipocyte-specific deletion of Ip6k1 reduces diet-induced obesity by enhancing AMPKmediated

Adipocyte-specific deletion of Ip6k1 reduces diet-induced obesity by enhancing AMPKmediated Adipocyte-specific deletion of Ip6k1 reduces diet-induced obesity by enhancing AMPKmediated thermogenesis Qingzhang Zhu,, James C. Barrow, Anutosh Chakraborty J Clin Invest. 2016;126(11):4273-4288. https://doi.org/10.1172/jci85510.

More information

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation

More information

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,

More information

Fasted Insulin Coincidence of Macrophage Infiltration into White Adipose Tissue and Onset of Hyperinsulinemia During Diet- Induced Obesity

Fasted Insulin Coincidence of Macrophage Infiltration into White Adipose Tissue and Onset of Hyperinsulinemia During Diet- Induced Obesity Fasted Insulin Coincidence of Macrophage Infiltration into White Adipose Tissue and Onset of Hyperinsulinemia During Diet- Induced Obesity F4/80 MCP-1 (After: Xu et al, 2003 JCI vol.112) F4/80+ Cells are

More information

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets

FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets Research article Related Commentary, page 2693 FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets Naonobu Nishino, 1 Yoshikazu

More information

Supplementary Information Titles

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Article Title: Corresponding Author: Authors: An inhibitor of the protein kinases /ε improves obesity- related metabolic dysfunctions Alan Saltiel

More information

Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue

Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue Manuscript EMBO-2015-40819 Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue Wuping Sun, Kunitoshi Uchida, Yoshiro Suzuki, Yiming Zhou, Minji Kim, Yasunori Takayama, Nobuyuki Takahashi,

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice

Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice Am J Physiol Regul Integr Comp Physiol 284: R87 R100, 2003; 10.1152/ajpregu.00431.2002. Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice HEATHER

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight

More information

Reviewer #1 (Remarks to the Author)

Reviewer #1 (Remarks to the Author) Reviewer #1 (Remarks to the Author) The authors provide an interesting data set concerning the effects of an ATGL inhibitor on energy balance and indices of insulin action in mice fed a high fat diet.

More information

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD) SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of

More information

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold

More information

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal

More information

Effect of BI-1 on insulin resistance through regulation of CYP2E1

Effect of BI-1 on insulin resistance through regulation of CYP2E1 Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2

More information

Control 7 d cold 7 d CL

Control 7 d cold 7 d CL Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

In The Name Of God. In The Name Of. EMRI Modeling Group

In The Name Of God. In The Name Of. EMRI Modeling Group In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement

More information

Interplay between FGF21 and insulin action in the liver regulates metabolism

Interplay between FGF21 and insulin action in the liver regulates metabolism Research article Interplay between FGF21 and insulin action in the liver regulates metabolism Brice Emanuelli, 1 Sara G. Vienberg, 1 Graham Smyth, 1 Christine Cheng, 2 Kristin I. Stanford, 1 Manimozhiyan

More information

Supplementary Figure 1 a

Supplementary Figure 1 a Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1] ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology

More information

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC Published in "" which should be cited to refer to this work. mrna extraction and RT-PCR Total RNA from 5 15 mg of crushed white adipose tissue was isolated using the technique described by Chomczynski

More information

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Tissue factor-par2 signaling promotes diet-induced obesity and adipose Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

SHU, L; Hoo, RLC; WU, X; PAN, Y; LEE, PC; CHEONG, LY; Bornstein, SR; Rong, X; Gua, J; Xu, A. Citation Nature Communications, 2017, v. 8, p.

SHU, L; Hoo, RLC; WU, X; PAN, Y; LEE, PC; CHEONG, LY; Bornstein, SR; Rong, X; Gua, J; Xu, A. Citation Nature Communications, 2017, v. 8, p. Title mediates adaptive thermogenesis by promoting intracellular activation of thyroid hormones in brown adipocytes Author(s) SHU, L; Hoo, RLC; WU, X; PAN, Y; LEE, PC; CHEONG, LY; Bornstein, SR; Rong,

More information

FADD is a key regulator of lipid metabolism

FADD is a key regulator of lipid metabolism Research Article FADD is a key regulator of lipid metabolism Hongqin Zhuang 1, Xueshi Wang 1, Daolong Zha 1, Ziyi Gan 1, Fangfang Cai 1, Pan Du 1, Yunwen Yang 1, Bingya Yang 1, Xiangyu Zhang 1, Chun Yao

More information

Oestrogen signalling in white adipose progenitor cells inhibits differentiation into brown adipose and smooth muscle cells

Oestrogen signalling in white adipose progenitor cells inhibits differentiation into brown adipose and smooth muscle cells Received Feb 4 Accepted 8 Sep 4 Published Oct 4 DOI:.8/ncomms696 Oestrogen signalling in white adipose progenitor cells inhibits differentiation into brown adipose and smooth muscle cells Kfir Lapid,,

More information

Identification and characterization of a supraclavicular brown adipose tissue in mice

Identification and characterization of a supraclavicular brown adipose tissue in mice Identification and characterization of a supraclavicular brown adipose tissue in mice Qianxing Mo,, Kristin I. Stanford, Miao-Hsueh Chen JCI Insight. 2017;2(11):e93166.. Research Article Development Endocrinology

More information

Berberine activates thermogenesis in white and brown adipose tissue

Berberine activates thermogenesis in white and brown adipose tissue ARTILE Received 5 Aug Accepted 6 Oct Published 5 Nov DOI:.8/ncomms69 Berberine activates thermogenesis in white and brown adipose tissue Zhiguo Zhang,, Huizhi Zhang,, Bo Li,, Xiangjian Meng,, Jiqiu Wang,

More information

Acquisition of brown fat characteristics by white adipose

Acquisition of brown fat characteristics by white adipose ENERGY BALANCE-OBESITY A Role for Phosphodiesterase 3B in Acquisition of Brown Fat Characteristics by White Adipose Tissue in Male Mice Emilia Guirguis, Steven Hockman, Youn Wook Chung, Faiyaz Ahmad, Oksana

More information

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1

More information

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very

More information

Intestine-selective farnesoid X receptor inhibition improves obesity-related metabolic dysfunction

Intestine-selective farnesoid X receptor inhibition improves obesity-related metabolic dysfunction Intestine-selective farnesoid X receptor inhibition improves obesity-related metabolic dysfunction Jiang, C., Xie, C., Lv, Y., Li, J., Krausz, K. W., Shi, J.,... & Gonzalez, F. J. (215). Intestine-selective

More information

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first? 7/31/29 My Anna will love it! Who needs a test drive? Or a Warranty? It looked great in the lot! Do mean to say that you never actually test drove the car? G.Y. Prince Used Cars 1 am Los Angelos, CA Mullholland

More information

Nature Medicine: doi: /nm.3891

Nature Medicine: doi: /nm.3891 Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,

More information

Thrombin promotes diet-induced obesity through fibrin-driven inflammation

Thrombin promotes diet-induced obesity through fibrin-driven inflammation Thrombin promotes diet-induced obesity through fibrin-driven inflammation Anna K. Kopec, 1 Sara R. Abrahams, 2 Sherry Thornton, 3 Joseph S. Palumbo, 4 Eric S. Mullins, 4 Senad Divanovic, 5 Hartmut Weiler,

More information

Food Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Food Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Food Intake Regulation & the Clock Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Circadian disruption affect multiple organ systems: The diagram provides examples of how circadian disruption

More information

Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice

Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice Shen Yon Toh 1,2,3., Jingyi Gong 2., Guoli Du 2., John

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION -. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17

More information

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D. The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

UCP1-independent signaling involving SERCA2bmediated calcium cycling regulates beige fat thermogenesis and systemic glucose homeostasis

UCP1-independent signaling involving SERCA2bmediated calcium cycling regulates beige fat thermogenesis and systemic glucose homeostasis ARTICLES UCP-independent signaling involving SERCA2bmediated calcium cycling regulates beige fat thermogenesis and systemic glucose homeostasis 27 Nature America, Inc., part of Springer Nature. All rights

More information

Supplementary Figure S1

Supplementary Figure S1 Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao

More information

FGF21 gene therapy as treatment for obesity and insulin resistance

FGF21 gene therapy as treatment for obesity and insulin resistance Published online: July 9, 218 Research Article FGF21 gene therapy as treatment for obesity and insulin resistance Veronica Jimenez 1,2,3,, Claudia Jambrina 1,2,3,, Estefania Casana 1,2,3, Victor Sacristan

More information

Endothelial PDGF-CC regulates angiogenesisdependent thermogenesis in beige fat

Endothelial PDGF-CC regulates angiogenesisdependent thermogenesis in beige fat ARTIE Received Apr 6 Accepted 6 Jun 6 Published 5 Aug 6 DOI:.8/ncomms5 OPEN Endothelial PDGF-CC regulates angiogenesisdependent thermogenesis in beige fat Takahiro Seki, Kayoko Hosaka, Sharon Lim, Carina

More information

Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis

Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis Article Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis Kiana Mahdaviani 1,2, Ilan Y Benador 1,2, Shi Su 1, Raffi A Gharakhanian 1, Linsey Stiles 1,2, Kyle

More information

University of California, San Diego La Jolla CA 92093

University of California, San Diego La Jolla CA 92093 AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Circulating Levels of Soluble Dipeptidyl Peptidase-4 Are Dissociated from Inflammation and Induced by Enzymatic DPP4 Inhibition

Circulating Levels of Soluble Dipeptidyl Peptidase-4 Are Dissociated from Inflammation and Induced by Enzymatic DPP4 Inhibition Article Circulating Levels of Soluble Dipeptidyl Peptidase- Are Dissociated from Inflammation and Induced by Enzymatic DPP Inhibition Graphical Abstract Authors Elodie M. Varin, Erin E. Mulvihill, Jacqueline

More information

SUPPLEMENTARY,INFORMATIONS,,,, mtorc1,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD,!! Sébastien!M.!

SUPPLEMENTARY,INFORMATIONS,,,, mtorc1,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD,!! Sébastien!M.! SUPPLEMENTARY,INFORMATIONS,,,, mtorc,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD, SébastienM.Labbé,,MathildeMouchiroud,,AlexandreCaron,,BlandineSecco,, Elizaveta

More information

Adipocyte liver kinase b1 suppresses beige adipocyte renaissance through class IIa histone deacetylase 4

Adipocyte liver kinase b1 suppresses beige adipocyte renaissance through class IIa histone deacetylase 4 Page 1 of 83 Adipocyte liver kinase b1 suppresses beige adipocyte renaissance through class IIa histone deacetylase 4 Yangmeng Wang 1,2#, Esther Paulo 1#, Dongmei Wu 1,3, Yixuan Wu 1, Wendong Huang 2,

More information

AMPK Activation by Metformin Suppresses Abnormal Extracellular Matrix Remodeling in Adipose Tissue and Ameliorates Insulin Resistance in Obesity

AMPK Activation by Metformin Suppresses Abnormal Extracellular Matrix Remodeling in Adipose Tissue and Ameliorates Insulin Resistance in Obesity Diabetes Volume 65, August 2016 2295 Ting Luo, 1,2 Allison Nocon, 1 Jessica Fry, 1 Alex Sherban, 1 Xianliang Rui, 1 Bingbing Jiang, 1 X. Julia Xu, 1 Jingyan Han, 1 Yun Yan, 3 Qin Yang, 4 Qifu Li, 2 and

More information

A stringent validation of mouse adipose tissue identity markers

A stringent validation of mouse adipose tissue identity markers Am J Physiol Endocrinol Metab 38: E185 E115, 215. First published April 21, 215; doi:1.1152/ajpendo.23.215. A stringent validation of mouse adipose tissue identity markers Jasper M. A. de Jong, 1 Ola Larsson,

More information

Cardiac natriuretic peptides act via p38 MAPK to induce the brown fat thermogenic program in mouse and human adipocytes

Cardiac natriuretic peptides act via p38 MAPK to induce the brown fat thermogenic program in mouse and human adipocytes Research article Related Commentary, page 804 Cardiac natriuretic peptides act via p38 MAPK to induce the brown fat thermogenic program in mouse and human adipocytes Marica Bordicchia, 1,2 Dianxin Liu,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates

More information

Thermoneutrality decreases thermogenic program and promotes adiposity in high-fat diet-fed mice

Thermoneutrality decreases thermogenic program and promotes adiposity in high-fat diet-fed mice ORIGINAL RESEARCH Physiological Reports ISSN 251-817X ity decreases thermogenic program and promotes adiposity in high-fat diet-fed mice Xin Cui, Ngoc Ly T. Nguyen, Eleen Zarebidaki, Qiang Cao, Fenfen

More information

3-Thia Fatty Acids A New Generation of Functional Lipids?

3-Thia Fatty Acids A New Generation of Functional Lipids? Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must

More information

Supplementary Figures

Supplementary Figures Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,

More information

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte

More information

Impaired Thermogenesis and Adipose Tissue Development in Mice with Fat-Specific Disruption of Insulin and IGF-1 Signalling

Impaired Thermogenesis and Adipose Tissue Development in Mice with Fat-Specific Disruption of Insulin and IGF-1 Signalling Impaired Thermogenesis and Adipose Tissue Development in Mice with Fat-Specific Disruption of Insulin and IGF-1 Signalling The Harvard community has made this article openly available. Please share how

More information