Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
|
|
|
- Prudence Crawford
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with leptin (leptin; 100nM) at 2.5 mm glucose in the absence (left) or presence (right) of the GABA A receptor antagonist picrotoxin (100 M) without glutamatergic influences. Leptin reduced POMC neuronal activity in the absence of the GABA A receptor antagonist, whereas POMC neurons responded to leptin with a depolarization in the presence of the GABA A receptor antagonist. Vm=-48 mv and -55 mv respectively. Scale bar: 20 mv, 2 min. B and C) Graphs showing change in membrane potential ( V) from individual POMC neurons before and after treatment with leptin (100 nm) at 2.5 mm glucose (B; left panel, with the glutamate receptor antagonist, n = 38 neurons; right panel, with the glutamate and GABA A receptor antagonists, n = 13 neurons) and 5 mm glucose (C; left panel, with the glutamate receptor antagonist, n = 28 neurons; right panel, with the glutamate and GABA A receptor antagonists, n = 11 neurons). **p < 0.01 vs. control (paired t-test). All data are shown as mean ± SEM.
2 Supplementary Figure 2) Modulation of mipscs by glutamate and MTII A) Representative recording samples showing mipscs recorded from POMC neurons after treatment with glutamate (100 M). HP = -70mV. Right panel: Summary of the effect of glutamate on mipsc frequency in the presence of CNQX (10 M) and DL-APV (50 M) to block ligand-gated glutamate receptors. Glutamate significantly increased mipsc frequency (139.2 ± 15.4 % of control, n = 10 neurons). Scale bar: 100 pa, 10 s. B) Representative recording samples showing mipscs recorded from POMC neurons after treatment with melanotan II (MTII; 100nM). HP = -70mV. Right panel: Summary of the effect of MTII on mipsc frequency. There was a marked increase in the mean frequency of mipscs in POMC neurons (185.8 ± 21.8% of control, n = 8 neurons). *p < 0.05, **p < 0.05 vs. control (paired t-test). All data are shown as mean ± SEM. Scale bar: 100 pa, 10 s. C: control.
3 Supplementary Figure 3) Modulation by their own neurotransmitter and peptides of spontaneous GABAergic transmission onto POMC neurons A) Images of fluorescence microscopy showing the expression of channelrhodopsin on POMC neurons (green) in the ARC of POMC-Cre::ChR2-YFP mice. Scale bar: 50 m. B) Representative recording samples showing sipscs recorded from POMC neurons before, during and after light stimulation. Blue light stimulation (blue line; 470 nm; 10 Hz for 1 s,10 ms pulses, 3 s interval,5 times) significantly increased sipsc frequency. C) Pooled data of normalized sipsc frequency from 8 POMC neurons from POMC-Cre::ChR2-YFP mice. The mean change in normalized sipsc frequency was 148.6±11.2 % of control (n = 8 neurons). D) Summary of effect of light stimulation on sipsc frequency. C: control, P: photostimulation. *p < 0.05, **p < 0.01 vs. control (paired t-test). All data are shown as mean ± SEM.
4 Supplementary Figure 4) Expression of ps6 and pstat3 in a subset of POMC neurons in the ARC following i.p. injection of leptin A) Images of fluorescence microscopy showing the expression of glutamatergic POMC neurons in the ARC. Glutamatergic neurons were located adjacent to and/or within the median eminence. Scale bar: 50 m. B) Images of fluorescence microscopy showing the expression of ps6 (Red) in the hypothalamus following i.p. injection of saline or leptin (1 mg/ kg). ps6-positive cells in animals injected with leptin were observed in the ARC and the VMH of the hypothalamus, suggesting that ps6 staining would be a useful marker for leptin-mediated Jak2- PI3K signaling pathway. Scale bar: 100 m. C) Expression of ps6 (Red) in a subset of POMC- GFP neurons (Green) in the ARC. White arrows represent the neurons co-expressing GFP and ps6. Scale bar: 50 m. D) Expression of pstat3 (Red) in POMC neurons (Green) following i.p. injection of leptin. Leptin elevated pstat3 expression in POMC neurons. High-fat feeding reduced the expression of pstat3 in POMC neurons. White arrows represent the neurons coexpressing GFP and pstat3 (n = 5 animals, respectively). ***p < (unpaired t-test). All data are shown as mean ± SEM. S: saline, L: leptin. Scale bar: 50 m.
5 Supplementary Figure 5) The K ATP channel blocker does not affect leptin s action on mipscs A) Sample traces showing leptin s stimulatory (left) and inhibitory effects on mipscs. mipscs were recorded in the presence of tolbutamide (200 M) at 2.5 mm glucose. Scale bar: 100 pa, 10 s. B) Graph showing normalized frequency of mipscs from 13 POMC neurons before and after treatment with leptin in the presence of tolbutamide (n = 13 neurons). In contrast to the effect of the AMPK inhibitor that blunts glucose-sensing by POMC neurons, tolbutamide did not alter leptin s action on mipscs (p > 0.05, paired t-test). All data are shown as mean ± SEM. C: control, L: leptin
6 Supplementary Figure 6) Dantrolene, an intracellular calcium release inhibitor, blocks leptin s effect A) Representative sample traces showing mipscs recorded from POMC neurons before and after application of leptin in the presence of dantrolene (10 M). B) Summary of the effects of leptin on mipscs in the presence of dantrolene at 2.5 and 5 mm glucose. Leptin failed to modulate GABA release in the presence of dantrolene (2.5 mm glucose: 96.5 ± 3.7 % of control, n = 4 neurons; 5 mm glucose: ± 4.6 % of control, n = 7 neurons, p > 0.05, paired t-test). All data are represented as mean ± SEM. C: control.
7 Supplementary Figure 7) The JAK2 kinase inhibitor blocks leptin s effect A) Representative recording samples showing mipscs recorded from POMC neurons in the presence of the JAK2 kinase inhibitor AG490 alone (50 μm) and AG490 plus leptin (100 nm,). HP = -70mV. Scale bar: 100 pa, 20 s. B) Pooled data showing mipsc frequency before and after treatment with leptin in the presence of AG490. Leptin no longer modulated miniature GABAergic transmission under these experimental conditions (after leptin: 98.7 ± 6.5%, n = 6 neurons, p > 0.05, paired t-test). All data are represented as mean ± SEM. C: control, L: leptin
8 Supplementary Figure 8) Alteration in AMPK 2 mrna expression in POMC neurons following exposure to high-fat feeding A representative gel illustrating the expression of AMPK 2 mrnas (90 bp; 18S rrna, 121 bp) in POMC neurons from animals fed a NCD (upper panel) and a HFD (bottom panel). The fraction of AMPK 2-expressing POMC neurons was strongly decreased in animals fed a HFD compared with the control (1-15: fifteen different POMC neurons). M: size marker (100 bp), P: positive control.
9 [Glucose] 2.5 mm GluR antagonist GluR+GABA A R antagonist GluR antagonist [Glucose] 5 mm GluR+GABA A R antagonist Depolarization (n) 15/38 10/13 9/28 7/11 ( V) 2.8±0.4*** 3.7±0.5*** 1.9±0.4** 4.0±0.8** Hyperpolarization (n) 15/38 0/13 15/28 0/11 ( V) -1.8±0.2*** -2.8±0.4*** Supplementary Table 1) Summary of leptin s effect on the membrane potential with or without the GABA A receptor inhibitor In the absence of the GABA A receptor antagonist, a subset of POMC neurons responded to leptin with a hyperpolarization at 2.5 and 5 mm glucose. However, leptin's inhibitory effect on POMC neuron activity was completely abolished by the GABA A receptor antagonist. **P < 0.01, ***p < vs. control (paired t-test); All data are represented as mean ± SEM.
Supplementary Figure 1
Supplementary Figure 1 Arcuate ChIEF-tdTomato neurons expressed TH These micrographs show that TH-Cre-ChIEF-tdTomato (magenta), expressed by AAV in a TH-Cre mouse, were immunostained with TH (green) in
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Normal AMPAR-mediated fepsp input-output curve in CA3-Psen cdko mice. Input-output curves, which are plotted initial slopes of the evoked fepsp as function of the amplitude of the
Short- and long-lasting consequences of in vivo nicotine treatment
Short- and long-lasting consequences of in vivo nicotine treatment on hippocampal excitability Rachel E. Penton, Michael W. Quick, Robin A. J. Lester Supplementary Figure 1. Histogram showing the maximal
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Bidirectional optogenetic modulation of the tonic activity of CEA PKCδ + neurons in vitro. a, Top, Cell-attached voltage recording illustrating the blue light-induced increase in
High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons
High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons Tim Klöckener 1,2,3, Simon Hess 2,4, Bengt F. Belgardt 1,2,3, Lars Paeger 2,4, Linda A. W. Verhagen
Astrocyte signaling controls spike timing-dependent depression at neocortical synapses
Supplementary Information Astrocyte signaling controls spike timing-dependent depression at neocortical synapses Rogier Min and Thomas Nevian Department of Physiology, University of Berne, Bern, Switzerland
Cellular Neurobiology / BIPN 140
SECOND MIDTERM EXAMINATION Fall, 2015 GENERAL INSTRUCTIONS 1. Please write your name on ALL 6 pages. 2. Please answer each question IN THE SPACE ALLOTTED. 1) /10 pts 2) /10 pts 3) /15 pts 4) /15 pts 5)
Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.
Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from
Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke
SUPPLEMENTARY INFORMATION doi:10.1038/nature09511 Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke Pre Post 7-days Systolic Diastolic BPM Systolic Diastolic BPM Systolic
Dep. Control Time (min)
aa Control Dep. RP 1s 1 mv 2s 1 mv b % potentiation of IPSP 2 15 1 5 Dep. * 1 2 3 4 Time (min) Supplementary Figure 1. Rebound potentiation of IPSPs in PCs. a, IPSPs recorded with a K + gluconate pipette
Supplementary Figure 1. Basic properties of compound EPSPs at
Supplementary Figure 1. Basic properties of compound EPSPs at hippocampal CA3 CA3 cell synapses. (a) EPSPs were evoked by extracellular stimulation of the recurrent collaterals and pharmacologically isolated
Unique functional properties of somatostatin-expressing GABAergic neurons in mouse barrel cortex
Supplementary Information Unique functional properties of somatostatin-expressing GABAergic neurons in mouse barrel cortex Luc Gentet, Yves Kremer, Hiroki Taniguchi, Josh Huang, Jochen Staiger and Carl
-51mV 30s 3mV. n=14 n=4 p=0.4. Depolarization (mv) 3
Supplementary Figure 1 a optoβ 2 -AR b ChR2-51mV 30s 3mV -50mV 30s 3mV c 4 n=14 n=4 p=0.4 Depolarization (mv) 3 2 1 0 Both optogenetic actuators, optoβ 2 AR and ChR2, were effective in stimulating astrocytes
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for
CELLULAR NEUROPHYSIOLOGY
CELLULAR NEUROPHYSIOLOGY CONSTANCE HAMMOND 4. SYNAPTIC TRANSMISSION II: GLUTAMATERGIC TRANSMISSION Video 4-1: Observations and glutamate receptor channels Synaptic transmission II 1 Constance Hammond Observation
Supplementary Figure 1
Supplementary Figure 1 Localization of virus injections. (a) Schematic showing the approximate center of AAV-DIO-ChR2-YFP injection sites in the NAc of Dyn-cre mice (n=8 mice, 16 injections; caudate/putamen,
Nature Neuroscience: doi: /nn Supplementary Figure 1. ACx plasticity is required for fear conditioning.
Supplementary Figure 1 ACx plasticity is required for fear conditioning. (a) Freezing time of conditioned and control mice before CS presentation and during CS presentation in a new context. Student s
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,
Ivy/Neurogliaform Interneurons Coordinate Activity in the Neurogenic Niche
Ivy/Neurogliaform Interneurons Coordinate Activity in the Neurogenic Niche Sean J. Markwardt, Cristina V. Dieni, Jacques I. Wadiche & Linda Overstreet-Wadiche Supplementary Methods. Animals We used hemizygous
Chapter 6 subtitles postsynaptic integration
CELLULAR NEUROPHYSIOLOGY CONSTANCE HAMMOND Chapter 6 subtitles postsynaptic integration INTRODUCTION (1:56) This sixth and final chapter deals with the summation of presynaptic currents. Glutamate and
Supplementary Figure 1. GABA depolarizes the majority of immature neurons in the
Supplementary Figure 1. GABA depolarizes the majority of immature neurons in the upper cortical layers at P3 4 in vivo. (a b) Cell-attached current-clamp recordings illustrate responses to puff-applied
Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons
Supplementary Figure 1 Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons a-c. Quantification of CEl c-fos expression in mice intraperitoneal injected with anorexigenic drugs (a),
Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission
Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission Jesica Raingo, Mikhail Khvotchev, Pei Liu, Frederic Darios, Ying C. Li, Denise
SUPPLEMENTARY INFORMATION. Supplementary Figure 1
SUPPLEMENTARY INFORMATION Supplementary Figure 1 The supralinear events evoked in CA3 pyramidal cells fulfill the criteria for NMDA spikes, exhibiting a threshold, sensitivity to NMDAR blockade, and all-or-none
Ophthalmology, Radiation Oncology,
Supporting Online Material Journal: Nature Neuroscience Article Title: Corresponding Author: All Authors: Affiliations: Tanycytes of the Hypothalamic Median Eminence Form a Diet- Responsive Neurogenic
Synaptic Plasticity and Memory
Synaptic Plasticity and Memory Properties and synaptic mechanisms underlying the induction of long-term potentiation (LTP) The role of calcium/calmodulin-dependent kinase II (CamKII) in the induction,
How Nicotinic Signaling Shapes Neural Networks
How Nicotinic Signaling Shapes Neural Networks Darwin K. Berg Division of Biological Sciences University of California, San Diego Nicotinic Cholinergic Signaling Uses the transmitter ACh to activate cation-selective
Supplementary figure 1: LII/III GIN-cells show morphological characteristics of MC
1 2 1 3 Supplementary figure 1: LII/III GIN-cells show morphological characteristics of MC 4 5 6 7 (a) Reconstructions of LII/III GIN-cells with somato-dendritic compartments in orange and axonal arborizations
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Relative expression of K IR2.1 transcript to enos was reduced 29-fold in capillaries from knockout animals. Relative expression of K IR2.1 transcript to enos was reduced 29-fold
Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons
Neuron, Volume 96 Supplemental Information Ca V 2.2 Gates Calcium-Independent but Voltage-Dependent Secretion in Mammalian Sensory Neurons Zuying Chai, Changhe Wang, Rong Huang, Yuan Wang, Xiaoyu Zhang,
File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References
File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References File name: Supplementary Data 1 Description: Summary datasheets showing the spatial
1) Drop off in the Bi 150 box outside Baxter 331 or to the head TA (jcolas).
Bi/CNS/NB 150 Problem Set 3 Due: Tuesday, Oct. 27, at 4:30 pm Instructions: 1) Drop off in the Bi 150 box outside Baxter 331 or e-mail to the head TA (jcolas). 2) Submit with this cover page. 3) Use a
CELLULAR NEUROPHYSIOLOGY
CELLULAR NEUROPHYSIOLOGY CONSTANCE HAMMOND 5. SYNAPTIC TRANSMISSION II: GABAERGIC TRANSMISSION Video 5-1: GABA A receptor-mediated current and potential changes GABAergic synaptic transmission 1 Constance
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images
Supporting Information
ATP from synaptic terminals and astrocytes regulates NMDA receptors and synaptic plasticity through PSD- 95 multi- protein complex U.Lalo, O.Palygin, A.Verkhratsky, S.G.N. Grant and Y. Pankratov Supporting
Supplementary Figure 1: Kv7 currents in neonatal CA1 neurons measured with the classic M- current voltage-clamp protocol.
Supplementary Figures 1-11 Supplementary Figure 1: Kv7 currents in neonatal CA1 neurons measured with the classic M- current voltage-clamp protocol. (a), Voltage-clamp recordings from CA1 pyramidal neurons
Enhancement of synaptic transmission by cyclic AMP modulation of presynaptic I h channels. Vahri Beaumont and Robert S. Zucker
Enhancement of synaptic transmission by cyclic AMP modulation of presynaptic I h channels Vahri Beaumont and Robert S. Zucker Background I h channels discovered in 1976 (Noma A. and Irisawa H.) Voltage-gated
Supplementary legends
Supplementary legends Supplemental figure S1. Apelin-TAMRA is functional and induces apelin receptor internalization. HEK-293T cells transiently expressing YFP tagged APJ were incubated for 1 hour with:
Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.
Supplementary Figure 1 SybII and Ceb are sorted to distinct vesicle populations in astrocytes. (a) Exemplary images for cultured astrocytes co-immunolabeled with SybII and Ceb antibodies. SybII accumulates
Sample Lab Report 1 from 1. Measuring and Manipulating Passive Membrane Properties
Sample Lab Report 1 from http://www.bio365l.net 1 Abstract Measuring and Manipulating Passive Membrane Properties Biological membranes exhibit the properties of capacitance and resistance, which allow
Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms
Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06310 SUPPLEMENTARY INFORMATION www.nature.com/nature 1 www.nature.com/nature 2 www.nature.com/nature 3 Supplementary Figure S1 Spontaneous duration of wake, SWS and REM sleep (expressed
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Chapter 5 subtitles GABAergic synaptic transmission
CELLULAR NEUROPHYSIOLOGY CONSTANCE HAMMOND Chapter 5 subtitles GABAergic synaptic transmission INTRODUCTION (2:57) In this fifth chapter, you will learn how the binding of the GABA neurotransmitter to
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
Bi156 lecture 2, 1/6/12. Eating and weight regulation
Bi156 lecture 2, 1/6/12 Eating and weight regulation Introduction: weight regulation in an affluent society In our society much effort and money is expended on regulation of weight. Failure to maintain
TRPA1 channels regulate astrocyte resting calcium. and inhibitory synapse efficacy through GAT-3
TRPA1 channels regulate astrocyte resting calcium and inhibitory synapse efficacy through GAT-3 * 1 Eiji Shigetomi, * 1 Xiaoping Tong 3 Kelvin Y. Kwan, 3 David P. Corey & 1,2 Baljit S. Khakh Ψ 1 Departments
Nature Neuroscience: doi: /nn Supplementary Figure 1. Confirmation that optogenetic inhibition of dopaminergic neurons affects choice
Supplementary Figure 1 Confirmation that optogenetic inhibition of dopaminergic neurons affects choice (a) Sample behavioral trace as in Figure 1d, but with NpHR stimulation trials depicted as green blocks
Supplementary Figure 1
Supplementary Figure 1 Miniature microdrive, spike sorting and sleep stage detection. a, A movable recording probe with 8-tetrodes (32-channels). It weighs ~1g. b, A mouse implanted with 8 tetrodes in
1) Drop off in the Bi 150 box outside Baxter 331 or to the head TA (jcolas).
Bi/CNS/NB 150 Problem Set 3 Due: Tuesday, Oct. 27, at 4:30 pm Instructions: 1) Drop off in the Bi 150 box outside Baxter 331 or e-mail to the head TA (jcolas). 2) Submit with this cover page. 3) Use a
! acts via the autonomic nervous system. ! maintaining body weight within tight limits. ! ventromedial (VMN) ! arcuate (ARC) ! neuropeptide Y (NPY)
Brain Regulates energy homeostatis Glucose Sensing in the Brain Seminar 2012 Gareth Price! acts in response to circulating signals of nutrient states! acts via the autonomic nervous system Ensures a balance
Light-evoked hyperpolarization and silencing of neurons by conjugated polymers
Light-evoked hyperpolarization and silencing of neurons by conjugated polymers Paul Feyen 1,, Elisabetta Colombo 1,2,, Duco Endeman 1, Mattia Nova 1, Lucia Laudato 2, Nicola Martino 2,3, Maria Rosa Antognazza
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has
Hypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis
Hypothalamic TLR triggers sickness behavior via a microglia-neuronal axis Sungho Jin, *, Jae Geun Kim,, *, Jeong Woo Park, Marco Koch,, Tamas L. Horvath and Byung Ju Lee Department of Biological Sciences,
An acetylcholine-activated microcircuit drives temporal dynamics of cortical activity
An acetylcholine-activated microcircuit drives temporal dynamics of cortical activity Naiyan Chen, Hiroki Sugihara, & Mriganka Sur Nature America, nc. All rights reserved. Cholinergic modulation of cortex
Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
1.0. FSL NMDAR-fEPSP 0.8. amplitude (mv) Intensity (µa) 2.0 SD FSL Time (ms)
a 2.5 1. AMPAR-fEPSP slope (mv/ms) 2. 1. NMDAR-fEPSP amplitude (mv).8.6.4.5.2. 2 4 6 8. 1 2 3 4 5 Intensity (µa) Intensity (µa) b 2. PPF Ratio (fepsp2/fepsp1) 1..5. 5 1 2 5 Time (ms) Supplementary Figure
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
A genetically targeted optical sensor to monitor calcium signals in astrocyte processes
A genetically targeted optical sensor to monitor calcium signals in astrocyte processes 1 Eiji Shigetomi, 1 Sebastian Kracun, 2 Michael V. Sofroniew & 1,2 *Baljit S. Khakh Ψ 1 Departments of Physiology
Hormonal gain control of a medial preoptic area social reward circuit
CORRECTION NOTICE Nat. Neurosci. 20, 449 458 (2017) Hormonal gain control of a medial preoptic area social reward circuit Jenna A McHenry, James M Otis, Mark A Rossi, J Elliott Robinson, Oksana Kosyk,
Supporting Online Material for
www.sciencemag.org/cgi/content/full/312/5779/1533/dc1 Supporting Online Material for Long-Term Potentiation of Neuron-Glia Synapses Mediated by Ca 2+ - Permeable AMPA Receptors Woo-Ping Ge, Xiu-Juan Yang,
a Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
Social transmission and buffering of synaptic changes after stress
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-017-0044-6 In the format provided by the authors and unedited. Social transmission and buffering of synaptic changes after stress Toni-Lee
Supplementary Figure S1 (a) (b)
Supplementary Figure S1: IC87114 does not affect basal Ca 2+ level nor nicotineinduced Ca 2+ influx. (a) Bovine chromaffin cells were loaded with Fluo-4AM (1 μm) in buffer A containing 0.02% of pluronic
SUPPLEMENTARY INFORMATION
doi: 1.138/nature6416 Supplementary Notes Spine Ca 2+ signals produced by glutamate uncaging We imaged uncaging-evoked [Ca 2+ ] transients in neurons loaded with a green Ca 2+ - sensitive indicator (G;
Supporting Online Material for
www.sciencemag.org/cgi/content/full/317/5841/183/dc1 Supporting Online Material for Astrocytes Potentiate Transmitter Release at Single Hippocampal Synapses Gertrudis Perea and Alfonso Araque* *To whom
Nature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.
Supplementary Figure 1 Id2 and Id3 define polyclonal T H 1 and T FH cell subsets. Id2 YFP/+ (a) or Id3 GFP/+ (b) mice were analyzed 7 days after LCMV infection. T H 1 (SLAM + CXCR5 or CXCR5 PD-1 ), T FH
Leptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph
Leptin Intro/Signaling ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview Intro to Leptin Definition & Sources Physiology Bound vs. Free Receptors Signaling JAK/STAT MAPK PI3K ACC Experimental findings
Supplementary Information
Supplementary Information D-Serine regulates cerebellar LTD and motor coordination through the 2 glutamate receptor Wataru Kakegawa, Yurika Miyoshi, Kenji Hamase, Shinji Matsuda, Keiko Matsuda, Kazuhisa
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
A Reinforcing Circuit Action of Extrasynaptic GABA A Receptor Modulators on Cerebellar Granule Cell Inhibition
A Reinforcing Circuit Action of Extrasynaptic GABA A Receptor Modulators on Cerebellar Granule Cell Inhibition Vijayalakshmi Santhakumar 1,2 *, Pratap Meera 1., Movses H. Karakossian 1., Thomas S. Otis
Supplemental Information. Dorsal Raphe Dual Serotonin-Glutamate Neurons. Drive Reward by Establishing Excitatory Synapses
Cell Reports, Volume 26 Supplemental Information Dorsal Raphe Dual Serotonin-Glutamate Neurons Drive Reward by Establishing Excitatory Synapses on VTA Mesoaccumbens Dopamine Neurons Hui-Ling Wang, Shiliang
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus
Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus a: Expression of Vimentin, GFAP, Sox2 and Nestin in anterior, central and posterior hypothalamus. In the anterior
Astrocytes gate Hebbian synaptic plasticity in the striatum
Received 13 Dec 215 Accepted 4 Nov 216 Published 2 Dec 216 Astrocytes gate Hebbian synaptic plasticity in the striatum Silvana Valtcheva 1,2 & Laurent Venance 1,2 DOI: 1.138/ncomms13845 OPEN Astrocytes,
BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
Ligand-Gated Ion Channels
Ligand-Gated Ion Channels The Other Machines That Make It Possible... Topics I Introduction & Electrochemical Gradients Passive Membrane Properties Action Potentials Voltage-Gated Ion Channels Topics II
Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists
Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists of: (i) the YPet domain (an enhanced YFP); (ii) the
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Human cerebral cortex development from pluripotent stem cells to functional excitatory synapses Yichen Shi 1,2, Peter Kirwan 1,2, James Smith 1,2, Hugh P.C. Robinson 3 and Frederick
Synaptic plasticityhippocampus. Neur 8790 Topics in Neuroscience: Neuroplasticity. Outline. Synaptic plasticity hypothesis
Synaptic plasticityhippocampus Neur 8790 Topics in Neuroscience: Neuroplasticity Outline Synaptic plasticity hypothesis Long term potentiation in the hippocampus How it s measured What it looks like Mechanisms
Nature Neuroscience: doi: /nn.4335
Supplementary Figure 1 Cholinergic neurons projecting to the VTA are concentrated in the caudal mesopontine region. (a) Schematic showing the sites of retrograde tracer injections in the VTA: cholera toxin
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin
CONTEXT. LTP (long term potentiation) definition. LTP as a interesting mechanism for learning and memory
CONTEXT LTP (long term potentiation) definition LTP as a interesting mechanism for learning and memory LTP is due primarily to a pre or post- synaptic modification? (Increased Glut release or increased
Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC
Supplementary information Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC Pathway in Pancreatic -Cells Authors: Hodaka Yamada 1,*, Masashi Yoshida 1,*, Kiyonori Ito 1, Katsuya
BIPN100 F15 Human Physiology 1 Lecture 3. Synaptic Transmission p. 1
BIPN100 F15 Human Physiology 1 Lecture 3. Synaptic Transmission p. 1 Terms you should know: synapse, neuromuscular junction (NMJ), pre-synaptic, post-synaptic, synaptic cleft, acetylcholine (ACh), acetylcholine
The mammalian cochlea possesses two classes of afferent neurons and two classes of efferent neurons.
1 2 The mammalian cochlea possesses two classes of afferent neurons and two classes of efferent neurons. Type I afferents contact single inner hair cells to provide acoustic analysis as we know it. Type
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses
Fig. S1. Immunohistochemical detection of iglur2 protein in single islet cells. A: α cells identified using glucagon-specific antibody express the iglur2 subtype of AMPA receptor. 24 out of 26 identified
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
3.E.2 Continued. This is the essential knowledge statement from the curriculum framework. Detect---process--- response
Nervous System: Part III What Happens at a Synapse? 3.E. Continued Animals have nervous systems that detect external and internal signals, transmit and integrate information, and produce responses. This
Comparative effects of heterologous TRPV1 and TRPM8 expression in rat hippocampal neurons
Washington University School of Medicine Digital Commons@Becker Open Access Publications 2009 Comparative effects of heterologous TRPV1 and TRPM8 expression in rat hippocampal neurons Devon C. Crawford
Supplementary Figure 1. ACE robotic platform. A. Overview of the rig setup showing major hardware components of ACE (Automatic single Cell
2 Supplementary Figure 1. ACE robotic platform. A. Overview of the rig setup showing major hardware components of ACE (Automatic single Cell Experimenter) including the MultiClamp 700B, Digidata 1440A,
Insulin-Leptin Interactions
Insulin-Leptin Interactions Ahmed S., Al-Azzam N., Cao B. Karshaleva B., Sriram S., Vu K. If you understand a system, you can predict it. Agenda - Energy homeostasis Overview of leptin and insulin Signaling
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
Synaptic Integration
Synaptic Integration 3 rd January, 2017 Touqeer Ahmed PhD Atta-ur-Rahman School of Applied Biosciences National University of Sciences and Technology Excitatory Synaptic Actions Excitatory Synaptic Action
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,