Supplementary Figures
|
|
- Alexina Shields
- 5 years ago
- Views:
Transcription
1 Supplementary Figures a b c d PDI activity in % ERp72 activity in % ERp activity in % e ΔRFU min ERp7 activity in % 1 1 Supplementary Figure 1. Selectivity of the bepristat-mediated augmentation of dieosin-gssg reductase activity. (a) The effect of 3 µm bepristats on di-eosin-gssg cleavage was evaluated for full-length PDI (n=3) and augmentation was quantified. In contrast, bepristats did not augment activity of (b) ERp (n=3), (c) ERp7 (n=3), (d) ERp72 (n=3) in the same assay. (e) When no enzyme was added, bepristats failed to augment the cleavage of di-eosin-gssg by DTT (n=4). Lack of activity of the bepristats when used with other thiol isomerases demonstrates the selectively of their augmenting effect on PDI catalytic activity. Data are mean + SEM from three independent experiments. One-way ANOVA with Dunnett s post test: p < ; p < 1;, non significant.
2 Veh NEM Q3R Bp1a Bp2a PAC Bacitr Veh NEM Q3R Bp1a Bp2a PAC Bacitr Veh NEM Q3R Bp1a Bp2a PAC Bacitr Veh NEM Q3R Bp1a Bp2a PAC Bacitr Veh NEM Q3R Bp1a Bp2a PAC Bacitr Supplementary Figure 2. Original images of representative immunoblot of MPB-binding (n=3-6) of PDI (a), ERp (b), ERp7 (c), TRX (d) and BSA (e) as shown in figure 2C. Results using vehicle (Veh), N-ethylamine (NEM), quercetin-3-rutinoside (Q3R), bepristat 1a (Bp1a), bepristat 2a (Bp2a), PACMA-31 (PAC), and bacitracin (Bacitr) are shown. 2
3 a b c d Fold difference PDI NEM Q-3-R PACMA-31 Bacitracin 1. e Fold difference ERp NEM Q-3-R PACMA-31 Bacitracin 1. Fold difference ERp NEM Q-3-R PACMA-31 Bacitracin Fold difference TRX 1.. Fold difference BSA 1.. NEM Q-3-R PACMA-31 Bacitracin NEM Q-3-R PACMA-31 Bacitracin Supplementary Figure 3. Bacitracin and PACMA-31 non-selectively bind to free sulfhydryls on thiol isomerases. (a) PDI, (b) ERp, (c) ERp7, (d) thioredoxin, or (e) BSA were incubated with vehicle, 3 µm NEM, 1 µm quercetin-3-rutinoside, 1 µm bepristat 1a, 1 µm bepristat 2a, 1 µm PACMA-31 or 1 µm bacitracin prior to exposure to MPB. Samples were then analyzed by SDS-PAGE and MPB was detected by Cy-labeled streptavidin. Fluorescence corresponding to MPB binding was quantified using ImageQuant 4 analysis software. Values represent mean fluorescence + SEM (n = 3-6). One-way ANOVA with Bonferroni s post test: p < 1, NEM vs bepristat 1a, NEM vs bepristat 2a; p <, PACMA-31 vs bepristat 1a, PACMA-31 vs bepristat 2a; p <, bacitracin vs bepristat 1a, bacitracin vs bepristat 2a;,non significant. 3
4 MFI Bep1b Bep2a Supplementary Figure 4. Bepristats do not affect P-selectin expression. P-selectin expression in response to 2 µm of the PAR-1 activating peptide, SFLLRN, was monitored by flow cytometry following exposure of platelets to vehicle control (black) or 4 µm bepristat 1b (red) or bepristat 2a (blue). Values represent mean + SEM from three independent experients. One-way ANOVA was performed, showing no significant difference between the three conditions (p =.84). 4
5 a" b" c" OD 6 nm.1 OD 6 nm.1 OD 6 nm Time (sec) Time (sec) Time (sec) 3 µm 3 µm Diluted to 3 µm DTT 6 µm 6 µm Diluted to 6 µm DTT 3 µm 3 µm Diluted to 3 µm DTT Supplementary Figure. Reversibility of bepristats. Reversibility of inhibition of reductase activity of recombinant PDI by either (a) bepristat 1a, (b) bepristat 2a, or (c) PACMA-31 was evaluated by 1-fold dilution of a mixture of 3 µm bepristat 1a, 6 µm bepristat 2a or 3 µm PACMA-31 and monitoring in the insulin turbidimetric assay. Values represent mean data + SEM.
6 kda$ 7# # 3# # Supplementary Figure 6. PDI fragments. SDS-PAGE analysis of PDI and PDI fragments used in these studies..3 OD 6 nm OD 6 nm.2.1 Time (min) 1 T 6
7 8 6 b'x b'x I272A RFU Wavelength in nm Supplementary Figure 7. ANS fluorescence is blocked in the I272A mutant. ANS was incubated with either vehicle alone, wild-type b'x domain, or a b'x domain mutant in which isoleucine 272 was mutated to alanine. The I272A mutation inhibited ANS fluorescence. 7
8 b" Proteinase)K) ProteinaseK 3m 2m 3)min) 2)min) a Bepristat1a Bepristat2a 1m 1)min) m )min) 1m 2m 1)min) 2)min) ) Bepristat) Bepristat2a 38 2A) b xa abb d" Bepristat 1b Bepristat) Bepristat1a 1A) PDI kda 3 Bepristat1a 1. Bepristat2a C397-C4.6.4 PDI c" Fluorescence 1-3 b xa A) d" PDI 1-4 b xa d" [GSH] /[GSSG], M 1-1 [GSH] /[GSSG], M a a' m )min) 1m 2m 1)min) 2)min) kda 4 38 Bepristat 4 2b a C397-C4 1-4 f" 1 a' C397-C Supplementary Figure 8. Original images of f" representative silver stained gels of abb x.4 Bepristat following proteinase K digestion (n=3 for2b all conditions) in the presence of vehicle (a), Bepristat 1a bepristat 1a (b) or bepristat 2a (c). C397-C4 C397-C4.8 Wavelength(nm) Wavelength(nm) e" 1 kda Bepristat 1b 1 1 Fluorescence 2A).4 1 Bepristat) Bepristat2a.2 7 ) 1A) 1m 2m 1)min) 2)min) Proteinase)K) ProteinaseK 1m 2)min) 3m 2m 3)min) 1)min) Bepristat) Bepristat1a.6 abb C397-C4.8 m )min).6 C397-C4.8 cb" Bepristat1a 1. Bepristat2a Bepristat 1b f" Bepristat ) Bepristat2a.6.6 Proteinase)K) ProteinaseK 3m 2m 3)min) 2)min) a" e" C397-C4 1A).8 Wavelength(nm) Wavelength(nm) c" 1 Bepristat) Bepristat1a abb m 1)min) ) C397-C bb" a" Wavelength(nm) Wavelength(nm) a a' 8
9 a b Supplementary Figure 9. Differential cysteine alkylation and mass spectrometry of PDI. (a) Reduced disulfide bond cysteines in PDI were alkylated with 12 C-IPA and the oxidized cysteine thiols with 13 C-IPA following reduction with DTT. One or both of the reduced disulfide bond cysteines can be labeled with either alkylator. The ratio of 12 C- IPA to 13 C-IPA alkylation represents the proportion of the disulfide bonds in the population that are in the reduced state. (b) Tandem mass spectrum of the WT PDI CGHCKALAPEY peptide containing the Cys3 and Cys6 catalytic dithiol/disulfide. The top panel is an example of the 12 C-IPA-alkylated peptide and the bottom panel the 13 C- IPA-alkylated peptide. Both Cys3 and Cys6 are alkylated in these examples. The accurate mass spectrum of the peptide is shown in the inset (observed [M+2H]2+ = m/z and expected [M+2H]2+ = m/z; observed [M+2H]3+ = m/z and expected [M+2H]2+ = m/z). 9
10 PDI Active-site disulfide E o', mv No Addition a (Cys3-Cys6) -26 ± 37 a' (Cys397-Cys4) -26 ± 36 + bepristat 1a a (Cys3-Cys6) -29 ± 6 a' (Cys397-Cys4) -21 ± 72 + bepristat 2b a (Cys3-Cys6) -21 ± 48 a' (Cys397-Cys4) -2 ± 8 SupplementaryTable 1. Redox potential of PDI in the presence of bepristats.the calculated equilibrium constants based on results shown in Fig. were used to determine the standard redox potentials from equation 2 in Methods. 1
11 Supplementary Methods P-Selectin expression P-selectin expression, a marker of platelet activation, was monitored by flow cytometry. Washed human platelets (2. x 1 8 platelets / ml), prepared as described above, were incubated with 4 µm of bepristat 1b, 4 µm of bepristat 2a, or vehicle control. After exposure to 2 µm of SFLLRN, µl of PE-conjugated CD62P (BD Biosciences) was added to µl of the platelet sample. Fluorescence and forward scatter measurements were performed using a Gallios Flow Cytometer (Beckman Coulter). The data was analyzed using Kaluza software and Graphpad Prism.. 12
- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationKit for assay of thioredoxin
FkTRX-02-V2 Kit for assay of thioredoxin The thioredoxin system is the major protein disulfide reductase in cells and comprises thioredoxin, thioredoxin reductase and NADPH (1). Thioredoxin systems are
More informationFig. S1. High K+ increases intracellular calcium level.
Fig. S1. High K + increases intracellular calcium level. (A) Neuronal activation measured by calcium imaging using Fura-2. Intracellular calcium levels were continuously monitored by the fura-2 florescence
More informationSUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION EXPERIMENTAL PROCEDURES Tryptic digestion protection experiments - PCSK9 with Ab-3D5 (1:1 molar ratio) in 50 mm Tris, ph 8.0, 150 mm NaCl was incubated overnight at 4 o C. The
More informationCharacterization of Disulfide Linkages in Proteins by 193 nm Ultraviolet Photodissociation (UVPD) Mass Spectrometry. Supporting Information
Characterization of Disulfide Linkages in Proteins by 193 nm Ultraviolet Photodissociation (UVPD) Mass Spectrometry M. Montana Quick, Christopher M. Crittenden, Jake A. Rosenberg, and Jennifer S. Brodbelt
More informationEx vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2*
Ex vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2* 1 Department of Laboratory Medicine - Laboratory of Hematology, Radboud University
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationSupplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/2/1/e1500678/dc1 Supplementary Materials for Chemical synthesis of erythropoietin glycoforms for insights into the relationship between glycosylation pattern and
More informationSupplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;
More informationSUPPLEMENTARY DATA. Materials and Methods
SUPPLEMENTARY DATA Materials and Methods HPLC-UV of phospholipid classes and HETE isomer determination. Fractionation of platelet lipid classes was undertaken on a Spherisorb S5W 150 x 4.6 mm column (Waters
More informationSupplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) The inhibitory effects of new antibodies (Mab17 and Mab18). They were investigated in in vitro fertilization
More informationGladstone Institutes, University of California (UCSF), San Francisco, USA
Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of
More informationSupplemental Figure 1. CD69 antigen-response curves of CAR engrafted Jurkat T cells. Supplemental Figure 2.
Supplemental Figure 1. CD69 antigen-response curves of CAR engrafted Jurkat T cells. To evaluate the antigen sensitivity of mutant CARs transduced Jurkat T cells were stimulated with varying concentrations
More informationPearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
More informationSupplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
More informationFigure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
More informationNature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA.
Supplementary Figure 1 Fluorescent titration of probe CPDSA. Fluorescent titration of probe CPDSA (10 um) upon addition of GSH in HEPES (10 mm, ph = 7.4) containing 10% DMSO. Each spectrum was recorded
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationab Homocysteine Assay Kit (Fluorometric) 1
Version 1 Last updated 25 May 2018 ab208559 Homocysteine Assay Kit (Fluorometric) For the measurement of homocysteine in mammalian plasma and serum. This product is for research use only and is not intended
More informationKidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
More informationFile name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. Schematic of Ras biochemical coupled assay.
More informationTable S1. Sequence of human and mouse primers used for RT-qPCR measurements.
Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor
More informationPreparation and Characterization of Cysteine Adducts of Deoxynivalenol
Preparation and Characterization of Cysteine Adducts of Deoxynivalenol Ana Stanic, Silvio Uhlig, Anita Solhaug, Frode Rise, Alistair L. Wilkins, Christopher O. Miles S1 Figure S1. 1 H spectrum of 1 (DON)
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationTime after injection (hours) ns ns
Platelet life span (% iotinylated platelets) 1 8 6 4 2 4 24 48 72 96 Time after injection (hours) 6 4 2 IgG GPIα GPIβ GPII GPVI Receptor expression (GeoMean, fluorescence inteity) Supplementary figure
More informationProtein disulfide isomerase acts as an injury response signal that enhances fibrin generation via tissue factor activation
Research article Protein disulfide isomerase acts as an injury response signal that enhances fibrin generation via tissue factor activation Christoph Reinhardt, 1 Marie-Luise von Brühl, 2 Davit Manukyan,
More informationTRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationThis student paper was written as an assignment in the graduate course
77:222 Spring 2001 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2001) offered
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationTrypsin Mass Spectrometry Grade
058PR-03 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Trypsin Mass Spectrometry Grade A Chemically Modified, TPCK treated, Affinity Purified
More informationSupplementary Figure 1. DTPA does not interfere with the activity of catalase. Dependency of CAT activity on DTPA concentration at 25 C.
Supplementary Figure 1. DTPA does not interfere with the activity of catalase. Dependency of CAT activity on DTPA concentration at 25 C. CAT (40 nm) was pre-incubated for 120 min with DTPA (0-10 mm) before
More informationEMBO. Low reduction potential of Ero1a regulatory disulphides ensures tight control of substrate oxidation EMBO. open
The EMBO Journal (2008) 27, 2988 2997 & 2008 European Molecular Biology Organization Some Rights Reserved 0261-4189/08 www.embojournal.org Low reduction potential of Ero1a regulatory disulphides ensures
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
More informationConcentration Estimation from Flow Cytometry Exosome Data Protocol
Concentration Estimation from Flow Cytometry Exosome Data Protocol 1. STANDARD CURVE Create a standard curve for the target exosome by plotting the mean fluorescence (y axis) against the protein concentration
More informationLipoprotein Lipase Activity Assay Kit (Fluorometric)
Lipoprotein Lipase Activity Assay Kit (Fluorometric) Catalog Number KA4538 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in
Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL
More informationSupplementary Figure 1. Characterization of Vn. (a) UV-Vis spectrum showing a band at ~420 nm corresponding to the band gap of nano-v 2
Supplementary Figure 1. Characterization of Vn. (a) UV-Vis spectrum showing a band at ~420 nm corresponding to the band gap of nano-v 2 O 5.(b) Electron dispersive X-ray (EDX) spectra of Vn showing the
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/3/2/e1602038/dc1 Supplementary Materials for Mitochondrial metabolic regulation by GRP78 Manoj Prasad, Kevin J. Pawlak, William E. Burak, Elizabeth E. Perry, Brendan
More informationSensoLyte 520 Cathepsin K Assay Kit *Fluorimetric*
SensoLyte 520 Cathepsin K Assay Kit *Fluorimetric* Catalog # 72171 Kit Size 100 Assays (96-well plate) Optimized Performance: This kit is optimized to detect Cathepsin K activity. Enhanced Value: Ample
More informationSupplementary Information
Supplementary Information Targeted Disruption of the EZH2/EED Complex Inhibits EZH2- dependent Cancer Woojin Kim 1,2,3, Gregory H. Bird 2,3,4, Tobias Neff 5, Guoji Guo 1,2,3, Marc A. Kerenyi 1,2,3, Loren
More informationTrypsin Digestion Mix
G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name 239PR Trypsin Digestion Mix Provides optimal buffered conditions for in gel trypsin digestion
More informationCrystallization-grade After D After V3 cocktail. Time (s) Time (s) Time (s) Time (s) Time (s) Time (s)
Ligand Type Name 6 Crystallization-grade After 447-52D After V3 cocktail Receptor CD4 Resonance Units 5 1 5 1 5 1 Broadly neutralizing antibodies 2G12 VRC26.9 Resonance Units Resonance Units 3 1 15 1 5
More informationSupplementary Table e-1. Flow cytometry reagents and staining combinations
Supplementary data Supplementary Table e-1. Flow cytometry reagents and staining combinations Reagents Antibody Fluorochrome Clone Source conjugation CD3 FITC UCHT1 BD Biosciences CD3 PerCP-Cy5.5 SK7 Biolegend
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Surface thiol groups and reduction of activated T cells. (a) Activated CD8 + T-cells have high expression levels of free thiol groups on cell surface proteins.
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationBiodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery
Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing
More informationSensoLyte 520 HIV-1 Protease Assay Kit *Fluorimetric*
SensoLyte 520 HIV-1 Protease Assay Kit *Fluorimetric* Catalog # 71147 Kit Size 100 assays (96-well) or 500 assays (384-well) Convenient Format: Complete kit including all the assay components. Optimized
More informationVaTx1 VaTx2 VaTx3. VaTx min Retention Time (min) Retention Time (min)
a Absorbance (mau) 5 2 5 3 4 5 6 7 8 9 6 2 3 4 5 6 VaTx2 High Ca 2+ Low Ca 2+ b 38.2 min Absorbance (mau) 3 2 3 4 5 3 2 VaTx2 39.3 min 3 4 5 3 2 4. min 3 4 5 Supplementary Figure. Toxin Purification For
More informationGLUTATHIONE TRANSFERASES. Ralf Morgenstern Institute of Environmental Medicine Karolinska Institutet
GLUTATHIONE TRANSFERASES Ralf Morgenstern Institute of Environmental Medicine Karolinska Institutet GSTs How many enzymes Structures THREE SUPERFAMILIES SOLUBLE GLUTATHIONE-TRANSFERASES (25 kda, dimers)
More informationSupplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
More informationThermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein
Supplementary Methods Thermal shift assays Thermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein unfolding was examined by monitoring the fluorescence of ANS (1-anilinonaphthalene-8-
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More informationUV Tracer TM Maleimide NHS ester
UV Tracer TM Maleimide HS ester Product o.: 1020 Product ame: UV-Tracer TM Maleimide-HS ester Chemical Structure: Chemical Composition: C 41 H 67 5 18 Molecular Weight: 1014.08 Appearance: Storage: Yellow
More informationPharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
More informationELECTRONIC SUPPORTING INFORMATION
ELECTRONIC SUPPORTING INFORMATION Calculation of the number of integrated peptide amphiphiles and encapsulated material per liposome The number of both membrane integrated liposome and encapsulated material
More informationNature Immunology: doi: /ni.3631
Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above
More informationW I S S E N T E C H N I K L E I D E N S C H A F T MOL.911. Cell Engineering. u
1 W I S S E N T E C H N I K L E I D E N S C H A F T MOL.911 Cell Engineering u www.tugraz.at MOL.911 Molecular Biotechnology I 2 Cell Engineering General strategies: Knock out of specific genes - Gene
More informationAgilent Protein In-Gel Tryptic Digestion Kit
Agilent 5188-2749 Protein In-Gel Tryptic Digestion Kit Agilent Protein In-Gel Tryptic Digestion Kit Instructions Kit Contents The Protein In-Gel Tryptic Digestion Kit includes sufficient reagents for approximately
More informationTyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis
Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato
More informationSupplementary Material
Supplementary Material HLA-DM Captures Partially Empty HLA-DR Molecules for Catalyzed Peptide Removal Anne-Kathrin Anders, Melissa J. Call, Monika-Sarah E. D. Schulze, Kevin D. Fowler, David A. Schuert,
More informationSupporting Information. Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in. Mouse Rod Cells
Supporting Information Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in Mouse Rod Cells David Salom,, Benlian Wang,, Zhiqian Dong, Wenyu Sun, Pius Padayatti, Steven
More informationSupplemental Figures Supplemental Figure 1:
Supplemental Figures Supplemental Figure 1: Representative FACS data showing Concurrent Brain cell type Acquisition using either Percoll PLUS (top row) or myelin removal beads (bottom two rows). Debris
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationSuperior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)
Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor
More informationLipid Droplets Fluorescence Assay Kit
Lipid Droplets Fluorescence Assay Kit Item No. 500001 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/NCHEM.2419 Diversification of Self-Replicating Molecules Jan W. Sadownik, Elio Mattia, Piotr Nowak, Sijbren Otto* University of Groningen, Center for Systems Chemistry, Stratingh Institute
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1175194/dc1 Supporting Online Material for A Vital Role for Interleukin-21 in the Control of a Chronic Viral Infection John S. Yi, Ming Du, Allan J. Zajac* *To whom
More informationIn vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay
In vitro bactericidal assay Mouse bone marrow was isolated from the femur and the tibia. Cells were suspended in phosphate buffered saline containing.5% BSA and 2 mm EDTA and filtered through a cell strainer.
More informationa b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
More informationSupplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
More informationROS Activity Assay Kit
ROS Activity Assay Kit Catalog Number KA3841 200 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
More informationTHIOL REDOX SYSTEMS SOPHIA CEDER, LUU THANH THUY, STEPHENIE BAILEY, TIMOTHY NICODEMUS & ELLIN-KRISTINA HILLERT
THIOL REDOX SYSTEMS SOPHIA CEDER, LUU THANH THUY, STEPHENIE BAILEY, TIMOTHY NICODEMUS & ELLIN-KRISTINA HILLERT THIOL REDOX SYSTEMS Thioredoxin system Glutaredoxin system Redundant, but not identical THIOREDOXIN
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More informationSupplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e
More informationSupplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
More informationThis student paper was written as an assignment in the graduate course
77:222 pring 2001 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, pring 2001) offered
More informationEndothelial cell aging
Endothelial cell aging Molekulare Präventivmedizin Molecular preventive medicine Judith (Jojo) Haendeler, PhD Leibniz Institut fuer Umweltmedizinische Forschung (IUF) Molecular Cell & Aging Research atherosclerosis
More informationThe Different Folding Behavior of Insulin and Insulin-like Growth Factor 1 Is Mainly Controlled by Their B-Chain/Domain
1556 Biochemistry 2002, 41, 1556-1567 The Different Folding Behavior of Insulin and Insulin-like Growth Factor 1 Is Mainly Controlled by Their B-Chain/Domain Zhan-Yun Guo, Lu Shen, and You-Min Feng* State
More informationAssay Report. Histone Deacetylase (HDAC) Inhibitor Assays Enzymatic Study of Compounds from Client
Assay Report Histone Deacetylase (HDAC) Inhibitor Assays Enzymatic Study of Compounds from Client Page 1 of 27 Client_HDAC _Year Month Day 1 Client_HDAC_Year Month Year HDAC Inhibitor Assays Study Sponsor:
More informationCuvette Assay for GSH/GSSG (Reduced/Oxidized Glutathione) For Research Use Only INTRODUCTION
Cuvette Assay for GSH/GSSG (Reduced/Oxidized Glutathione) For Research Use Only INTRODUCTION Cuvette Assay for GSH/GSSG Product Number: GT35 Store according to individual components FOR RESEARCH USE ONLY
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationNature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
More informationSupporting Information
Supporting Information Bauer et al. 10.1073/pnas.1610421113 SI Materials and Methods Immunofluorescence experiments were performed as described (8). Briefly, NUGC-3 cells were treated with 25 μm PK11007
More informationThis student paper was written as an assignment in the graduate course
77:222 Spring 2003 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2003) offered
More informationTransient Ribosomal Attenuation Coordinates Protein Synthesis and Co-translational Folding
SUPPLEMENTARY INFORMATION: Transient Ribosomal Attenuation Coordinates Protein Synthesis and Co-translational Folding Gong Zhang 1,2, Magdalena Hubalewska 1 & Zoya Ignatova 1,2 1 Department of Cellular
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
More informationThis student paper was written as an assignment in the graduate course
77:222 Spring 2005 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2005) offered
More informationTable S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells
Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations
More informationKit for assays of mammalian Trx
FkTRX-04 Kit for assays of mammalian Trx The thioredoxin system is the major protein disulfide reductase in cells and comprises thioredoxin, thioredoxin reductase and NADPH (1). Thioredoxin systems are
More informationDetailed step-by-step operating procedures for NK cell and CTL degranulation assays
Supplemental methods Detailed step-by-step operating procedures for NK cell and CTL degranulation assays Materials PBMC isolated from patients, relatives and healthy donors as control K562 cells (ATCC,
More information20S Proteasome Activity Assay Kit
20S Proteasome Activity Assay Kit For 100 Assays Cat. No. APT280 FOR RESEARCH USE ONLY NOT FOR USE IN DIAGNOSTIC PROCEDURES USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0) 23
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationProteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival
Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,
More informationA. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
More information