SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 DOI: /ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4 and α-tubulin protein levels in Cpeb4 +/+, Cpeb4 +/- and Cpeb4 -/- liver extracts. Unprocessed scans of original blots are shown in Supplementary Fig.7g. b, CPEB4 immunohistochemistry in WT and Cpeb4 KO liver sections. Scale bar, 100 μm. c, Cpeb4 mrna expression, normalized to TBP transcript levels, in livers from WT (n=8) and Cpeb4 KO (n=8) mice. Two-sided Student's t test, ***P= d, Changes in body weight of WT (n=34) and Cpeb4 KO (n=32) mice fed standard diet. Two-way ANOVA, P= e, Fed and overnight-fasted plasma glucose levels of mice fed HFD. WT-Fed, n=8; WT- Fasted, n=16; Cpeb4 KO -Fed, n=8; Cpeb4 KO -Fasted, n=14 mice. Two-way ANOVA, *P= f, Changes in body weight of WT (n=40) and Cpeb4 KO (n=28) mice fed HFD. Two-way ANOVA, *P= g, Body weight of WT (n=16) and Cpeb4 KO (n=10) mice aged for 80 weeks. Two-sided Student's t test, *P= h-j, 24-hour time course of RER (h), EE (i) and locomotor activity (j) of mice fed standard diet; WT, n=12; Cpeb4 KO, n=12 mice. Two-way ANOVA. k, Food intake (g/day) of WT (n=8) and Cpeb4 KO (n=8) mice on HFD during 4 consecutive days. Two-way ANOVA, P= l, Water intake in a 24-h period of WT (n=12) and Cpeb4 KO (n=12) mice fed standard diet. Two-sided Student's t test, P= m, Plasma glucose levels of WT and Cpeb4 KO fed, 6-h, and 24-h-fasted mice. WT-Fed, n=20; WT-6hFasted, n=22; WT-24hFasted, n=22; Cpeb4 KO -Fed, n=20; Cpeb4 KO - 6hFasted, n=20 mice; Cpeb4 KO -24hFasted, n=20 mice. Two-way ANOVA, P= n-o, Fed and overnight fasted plasma insulin levels (n) and free fatty acid (FFA) plasma levels (o). Panel n: WT-Fed, n=16; WT-Fasted, n=18; Cpeb4 KO -Fed, n=18; Cpeb4 KO -Fasted, n=16 mice. Panel o: WT- Fed, n=16; WT-Fasted, n=18; Cpeb4 KO -Fed, n=18; Cpeb4 KO -Fasted, n=16 mice. Two-way ANOVA, P= (n), P= (o). p-q, Glucose levels (p) and insulin levels (q) during glucose tolerance test in WT and Cpeb4 KO mice. Panel p: WT, n=18; Cpeb4 KO, n=18 mice. Panel q: WT, n=12; Cpeb4 KO, n=12 mice. Two-way ANOVA, P= (p), P= (q). r, Glucagon tolerance test after 6h fasting in WT (n=18) and Cpeb4 KO (n=18) mice. Two-way ANOVA, P= s, Glucose produced by primary hepatocytes in culture after treatment for 4h with vehicle (dimethyl sulfoxide, DMSO), with a combination of 10 μm forskolin, 20 mm lactate, and 2 mm pyruvate (FSK) or with a combination of 300 μm dibutyryl-camp and 100 nm dexamethasone (camp); n=12 primary hepatocyte cell lines from independent animals. Two-way ANOVA, P= For c-s, data are mean±s.e.m. Experiments were replicated two (c-g,k-o,q), three (p,r) or four (h-j,s) times from biologically independent samples with similar results. 1

2 S U P P L E M E N TA R Y I N F O R M AT I O N Supplementary Figure 2 (associated to Figure 2). Cpeb4 deletion causes mitochondrial dysfunction and defective lipid metabolism in hepatocytes. a, Cpeb4 mrna expression in livers from WT (n=8) and Cpeb4LKO (n=8) mice. Two-sided Student's t test, P= b, Immunoblot displaying CPEB4 and α-tubulin protein levels in WT and Cpeb4LKO mice. Unprocessed scans of original blots are shown in Supplementary Fig.7h. c, Weight evolution of WT (n=22) and Cpeb4LKO (n=30) mice fed standard diet. Two-way ANOVA, P= d, Glucose tolerance test after overnight fasting in WT (n=16) and Cpeb4LKO (n=16) mice. Two-way ANOVA, P= e, Plasma alanine aminotransferase levels of WT (n=12) and Cpeb4LKO (n=12) mice fed standard diet. Two-sided Student's t test, P= f-g, Liver weight (f) and hepatic triglyceride content (g) of WT and Cpeb4LKO mice fed HFD. Panel f: WT, n=44; Cpeb4LKO, n=44 mice. Panel g: WT-CHOW, n=12; WT-HFD, n=18; Cpeb4LKO-CHOW, n=20; Cpeb4LKO-HFD, n=18 mice. Twoway ANOVA, **P= (f), ***P=0.017 (g). h, Photograph of the liver, and H&E and Oil Red O staining of liver sections from the same animals. Representative images of 20 independent experiments are shown. Scale bar, 100 μm. i, Growth curve of WT (n=44) and Cpeb4LKO (n=48) mice on HFD. Two-way ANOVA, P= j, Fasn and Scd1 gene expression analysis by qrt-pcr of livers from WT (n=16) or Cpeb4LKO (n=16) mice. Two-way ANOVA, P= k, Analysis of palmitate uptake in primary hepatocytes; n=18 biologically independent dishes per group. Two-sided Student's t test, P= l, Immunoblot for the indicated mitochondrial markers and loading controls in WT and Cpeb4KO liver extracts, n=3 biologically independent samples. Unprocessed scans of original blots are shown in Supplementary Fig.7i. m, mtdna quantification normalized to nuclear DNA content by qrt-pcr of livers from WT (n=16) and Cpeb4KO (n=16) mice. Two-sided Student's t test, P= For a, c-g, i-k and m, data are mean±s.e.m. Experiments were replicated two (a,c-e,g,j), three (k) or four (f,i) times from biologically independent samples with similar results. 2

3 S U P P L E M E N TA R Y I N F O R M AT I O N Supplementary Figure 3 (associated to Figure 4). CPEB4 depletion leads to defective adaptation to chronic ER-stress. a, Apoptosis analysis of WT and Cpeb4KO MEFs measured by flow cytometry as the percentage of annexin V-positive cells after treatment with H202 (100 μm) or ionizing radiation (IR) (5 Gy) for 24 h; n=4 biologically independent MEF cell lines. Two-way ANOVA, P= b, Left: TUNEL staining of liver sections of WT and Cpeb4LKO mice injected with 1 mg/kg TM and killed 48h later. Scale bar, 100 μm. Arrows indicate apoptotic cells. Right: Quantification of the number of apoptotic cells in livers from WT (n=20) and Cpeb4LKO (n=20) mice. Twosided Student's t test, *P= Data are mean±s.e.m. Experiments in a,b were replicated two times from biologically independent samples with similar results. 3

4 Supplementary Figure 4 (associated to Figures 5 and 6). CPEB4 synthesis and translation of CPE-regulated mrnas are upregulated by UPR. a, Atf4 mrna analysis in WT MEFs treated with 1 μm thapsigargin (TG) for the indicated times. b, qrt-pcr expression analysis of the different luciferase constructs in HepG2 cells treated with 0.1 μm TG for 6h; n=18 biologically independent dishes. Two-way ANOVA, P= c, Left: Immunoblot for the indicated proteins in WT or Perk KO MEFs treated with 1,5 μm TG and harvested at the indicated times. Right: Immunoblot quantification. Unprocessed scans of original blots are shown in Supplementary Fig.7j. d, Total translation of Txnip assessed by ribosome profiling in MEFs treated with 1 μm TG for the indicated times (Reid D.W. et al., 2014). e, Txnip 3'UTR sequence in various mammalian species. Conserved CPE-elements are highlighted. f, Left: Txnip mrna poly(a) tail length quantification by epat assay in WT and Cpeb4 KO MEFs treated with TG for 2h. Right: Quantification of the area under the curve (AU); n=8 biologically independent MEF cell lines. Two-way ANOVA, *P= Data are mean±s.e.m. in a,c,f and mean±s.d. in b. Experiments were replicated two (c,f) or three (b) times from biologically independent samples with similar results. 4

5 Supplementary Figure 5 (associated to Figure 7). uorfs and CPEs determine mrna activation kinetics, which is influenced by the circadian clock. a, Gene expression analysis by qrt-pcr of Bmal1 and Per2 in WT and Cpeb4 KO mouse livers at the indicated ZT. Two-way ANOVA, P=0.95. b, Cpeb4 mrna levels in livers of WT fed mice at the indicated ZTs. 5

6 P eif2α PERK eif2α ER STRESS AAAA General translation inhibition Early activated mrnas (uorfs) uorf uorf Protein AAAA uorf uorf CPE CPEB4 mrna CPEB4 CPE AAAA Late activated mrnas (CPEs) Protein CPE CPE AAAAAAAAA Supplementary Figure 6 Working model: Sequential waves of translational activation during ER-stress mediated by PERK/uORFs and CPEB4/CPEs. The UPR triggers general translation inhibition. However, mrnas harbouring uorfs in their 5 UTRs are translationally activated at early time points after ER-stress, including Cpeb4 mrna. When CPEB4 is produced, it activates the translation of CPE-containing mrnas at late time points generating a second wave of protein production. 6

7 Supplementary Figure 7 Unprocessed scans of originals blots. a, Western blot corresponding to Fig.3a. b, Western blot corresponding to Fig.3e. c, Western blot corresponding to Fig.5a. d, Western blot corresponding to Fig.6b. e, Western blot corresponding to Fig.7d. f, Western blot corresponding to Fig.7e. g, Western blot corresponding to Supplementary Fig.1a. h, Western blot corresponding to Supplementary Fig.2b. i, Western blot corresponding to Supplementary Fig.2l. j, Western blot corresponding to Supplementary Fig.4c. 7

8 Supplementary Table Legends Supplementary Table 1 RNA-immunoprecipitation analysis showing mrnas specifically associated with CPEB4 in hepatocytes. Supplementary Table 2 mrnas showing reduced localization to endoplasmic reticulum in Cpeb4 KO livers. Supplementary Table 3 Putative uorfs contained withing rodent Cpeb4 5'UTR. Supplementary Table 4 Primer sequences used for PCR. 8

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22

High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Supplementary Information High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Max Gulhane 1, Lydia Murray 1, Rohan Lourie 1, Hui Tong 1, Yong H. Sheng 1, Ran

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp, SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)

More information

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

More information

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice. Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed

More information

Nature Genetics: doi: /ng.3731

Nature Genetics: doi: /ng.3731 Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,

More information

Supplementary Information

Supplementary Information Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold

More information

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

GW(g)/BW(g) GW(g)/BW(g) Con Dex Con Dex. GW(g)/BW(g) Relative mrna levels. Atrogin-1 Murf-1. Atrogin-1 Murf-1. Soleus

GW(g)/BW(g) GW(g)/BW(g) Con Dex Con Dex. GW(g)/BW(g) Relative mrna levels. Atrogin-1 Murf-1. Atrogin-1 Murf-1. Soleus a b c GW(g) GW(g) GW(g) 0.20 0.15 0.10 0.05 0.00 0.20 0.15 0.10 0.05 Den * ** GW(g)/BW(g) Den Dex Dex GW(g)/BW(g) d 0.00 Fasting GW(g) e 0.15 Cancer Cachexia f GW(g) 0.10 0.05 0.00 Young ** Old g GW(g)/BW(g)

More information

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko

More information

supplementary information

supplementary information DOI: 1.138/ncb1 Control Atg7 / NAC 1 1 1 1 (mm) Control Atg7 / NAC 1 1 1 1 (mm) Lamin B Gstm1 Figure S1 Neither the translocation of into the nucleus nor the induction of antioxidant proteins in autophagydeficient

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study Insulin receptor alternative splicing is regulated by insulin signaling and modulates beta cell survival Pushkar Malakar,4, Lital Chartarifsky,4, Ayat Hija, Gil Leibowitz 3, Benjamin Glaser 3, Yuval Dor,

More information

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent

More information

Grade of steatosis. group Case No. Supplementary Figure 1:

Grade of steatosis. group Case No. Supplementary Figure 1: a Supplementary Figure 1: b group Case No Grade of steatosis 15m AL 2746 NN 1 15m AL 2746 BN 1 15m AL 2638 2LN 3 15m AL 2638 2RN 3 12m AL 2640 RN 0 12m AL 2640 BN 1 12m AL 2640 LN 2 12m AL 2635 NN 2 12m

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization

More information

DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization

More information

Supporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via

Supporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via Supporting Information Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via influencing the balance of mtor-ampk pathways upon endoplasmic reticulum stress Figure S1. EGCG induces

More information

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β

More information

Mitochondrial biogenesis and diabetes, functional of confirmation mtdna transcription factors. Chan Bae Park Ajou Univ. School of Medicine

Mitochondrial biogenesis and diabetes, functional of confirmation mtdna transcription factors. Chan Bae Park Ajou Univ. School of Medicine Mitochondrial biogenesis and diabetes, functional of confirmation mtdna transcription factors Chan Bae Park Ajou Univ. School of Medicine Mitochondria perform diverse functions (Courtesy of K. R. Porter,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,

More information

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

Hepatic ZIP14-mediated zinc transport is required for adaptation to endoplasmic reticulum stress. Significance

Hepatic ZIP14-mediated zinc transport is required for adaptation to endoplasmic reticulum stress. Significance Hepatic ZIP14-mediated zinc transport is required for adaptation to endoplasmic reticulum stress Min-Hyun Kim a, Tolunay B. Aydemir a, Jinhee Kim a, and Robert J. Cousins a,b,1 PNAS PLUS a Food Science

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

More information

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression) a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT

More information

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS

More information

The unfolded protein response is shaped by the NMD pathway

The unfolded protein response is shaped by the NMD pathway Manuscript EMBOR-2014-39696 The unfolded protein response is shaped by the NMD pathway Rachid Karam, Chih-Hong Lou, Heike Kroeger, Lulu Huang, Jonathan H. Lin and Miles F. Wilkinson Corresponding author:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Effect of a HFD on the Acox gene expression in the livers of WT and IL-6 -/- mice. Expression of Acox in the livers of WT and IL-6 -/- mice fed STD or HFD determined through

More information

Expanded View Figures

Expanded View Figures Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old

More information

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA

More information

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Fig. S1. Schematic diagram of minigenome segments. open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.

More information

Supplementary Figure 1 a

Supplementary Figure 1 a Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR

More information