Genetic markers for the production of US country hams

Transcription

1 J. Anim. Breed. Genet. ISSN ORIGINAL ARTICLE Genetic markers for the production of US country hams A.M. Ramos, K.L. Glenn, T.V. Serenius, K.J. Stalder & M.F. Rothschild Department of Animal Science and Center for Integrated Animal Genomics, Iowa State University, Ames, IA, USA Keywords country hams; genetic markers. Correspondence Max F. Rothschild, Department of Animal Science, Iowa State University, Ames, IA 50010, USA. Tel: (+1) ; Fax: (+1) ; Received: 27 March 2007; accepted: 10 October 2007 Summary The objective of this study was to determine the effect of candidate genes on processing quality traits of US country hams. A total of 321 fresh hams of unknown breed and sex were examined and data on quality and physical traits were collected. The hams were then processed following typical US commercial dry-curing procedures for ham and data on additional traits were collected from the cured hams. Several genes involved in biological processes affecting dry-cured ham production were selected. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) tests were designed for each of the genes where polymorphisms were discovered and association analyses between each marker and the traits collected were performed. Results showed that two genetic markers were significantly associated with cured weight and yield: (i) a gene from the cathepsin family (cathepsin F) and (ii) the stearoyl-coa desaturase (delta-9-desaturase) gene, involved in lipid metabolism. Moreover, markers that significantly affected colour traits and those having a significant impact on ph and lipid percentage were also identified. These markers could be used for screening and sorting of carcasses prior to ham processing and, eventually in pig improvement programmes designed to select animals possessing genotypes more suitable for the production of dry-cured hams. Introduction Dry curing of meat products, such as cured ham from pigs, was formerly a way of conserving meat for times of scarcity and because of the lack of refrigeration (Toldra & Flores 1998). This process of conserving still continues, albeit in a slightly modified form. Dry-cured hams are obtained after a curing period whose length varies according to the practices typical of the regions where they are produced. Other factors, such as pig breed, feed and length of the ripening, also contribute to the product s final quality (Toldra & Flores 1998). In the USA, dry-cured ham, commonly referred to as country ham, is produced mainly in the south-eastern states, like North Carolina, Tennessee, Kentucky and others. Country ham is produced in a manner similar to the dry-cure processing of pork traditionally in countries of the Mediterranean region (Italy, France, Spain and Portugal). Relative to the ham produced in the Mediterranean region, the majority of US dry-cured ham is characterized by shorter curing periods and the inclusion of a smoking step in its processing. The relatively high market value makes dry-cured ham a very attractive niche market. In 2005, approximately 3.4 million hams were processed by 20 member companies of the National Country Ham Association in the US. These dry-cured or country hams had an estimated retail value that exceeded 340 million dollars, while in 2006 the total production by members and non-members was estimated to be 248 Journal compilation ª 2008 Blackwell Verlag, Berlin J. Anim. Breed. Genet. 125 (2008)

2 A. M. Ramos et al. Genetic markers for US country hams approximately 6.5 million hams (Stalder et al. 2006). Fresh pork quality is extremely important for the production of dry-cured hams because low pork quality contributes to increased economic losses. Poor processing characteristics of low-quality fresh pork contribute to excessive purging and increased spoilage that in turn are translated into economic losses for the processor. It is possible to increase the processor s profit by improving the processing characteristics, mainly by increasing yield and decreasing spoilage (Stalder et al. 2005). Genetic improvement of the pig in order to improve traits related to dry-cured ham production is possible and can be achieved using quantitative and molecular genetic approaches. Numerous studies have demonstrated that there are several genes and chromosomal regions affecting fresh pork quality (Bidanel & Rothschild 2002). Candidate genes for specific dry-cured ham production traits can be selected among those expressed in skeletal muscle and/or involved in biological processes that contribute to the ham-curing process, such as proteolysis and lipolysis. Previously, a data set was collected from a smaller sample of dry-cured hams and used to investigate the effects of the PRKAG3 and CAST genes (Stalder et al. 2005) and also of three cathepsin genes (B, F and Z) (Ramos et al. 2005) on several fresh and dry-cured ham traits. Results demonstrated a number of promising associations of these markers with a variety of traits. The objective of this study was to further evaluate the effect of novel and previously identified genetic markers on fresh and drycured processing characteristics of US country hams. Materials and methods Animals and ham processing Hams were obtained from two pork harvest facilities that routinely supply fresh hams to Clifty Farm Country Hams (Paris, TN, USA). All hams were derived from commercially crossbred individuals, but information regarding the individual contribution of the breeds used in establishing the cross was not available. Because pigs were not tracked through the harvesting process and through the cutting of the carcass into primal cuts including the hams, it was not possible to determine the sex of the animals from which the hams were derived. In order to avoid sampling the same animal twice, all hams were sampled from the left side of the carcass only. In order to minimize variation because of initial ham weight, only hams between 8.5 and 10.5 kg were utilized in this study. Despite the large number of hams sampled, they were processed in 2 days, in order to minimize day of harvest effects. Fresh ham evaluation On each fresh ham, several physical and quality traits were recorded, including weight, circumference (measured using a flexible cloth measuring tape around the section of each ham presenting the greatest circumference), depth (measured at the thickest part of the ham), objective colour scores, subjective colour, marbling and firmness scores. The last three traits were evaluated using the US National Pork Producers Council guidelines (NPPC; Berg 2000). All these traits were evaluated on the semimembranosus muscle of each ham face, approximately 48 h after slaughter. Objective colour scores were measured using a Minolta Chroma Meter (Ramsey, NJ, USA) with a 50-mm aperture, using Standard Illuminant C light source and 0 viewing angle geometry. The Minolta Chroma Meter was calibrated against a white tile standard prior to use. The values recorded included Minolta and Hunter L, a and b scores and were only recorded in the first day of data collection because of machine malfunction on day 2. In addition, a sample of the semimembranosus was collected from each ham to obtain ph, lipid percentage and dry matter percentage. Approximately 75 g of the semimembranosus sample collected was homogenized using a standard food processor until it was finely ground. Prior to ph determination, the ph meter (model IQ150; IQ Scientific Instruments, Carlsbad, CA, USA) was standardized in solutions with a known ph of 4.0 and 7.0. The probe was rinsed in double-distilled, deionized water between samples. The probe was inserted into the ground ham sample and two ph values were obtained from each sample and averaged. Lipid percentage was determined using a modified lipid extraction procedure based on the method described by Folch et al. (1957). In order to calculate dry matter, a sample of ground pork (1 g) was incubated at 80 C and weighed several times until the sample reached constant weight and was considered dry. Dry matter was then expressed as a percentage of initial sample weight. Dry-cure processing All hams were processed following standard commercial curing procedures at Clifty Farm Country Hams, including application of a salt mixture, curing Journal compilation ª 2008 Blackwell Verlag, Berlin J. Anim. Breed. Genet. 125 (2008)

3 Genetic markers for US country hams A. M. Ramos et al. time, curing temperature and humidity. The curing mixture included salt, sodium nitrate, sugar and other spices, and was applied to all hams. Afterwards, the hams were refrigerated at approximately C for 5 days. Then, the hams were re-salted and refrigerated again for 44 days. Upon completion of the initial curing process, the hams were washed and dried in chambers for a period of 20 days. These chambers were maintained at 15 C and 58 60% relative humidity. The final step included smoking for 8 days at a temperature of 38 C. The general curing procedures adopted for country hams have been described previously (Stalder et al. 2006). Each ham was individually identified using a commercially available tagging system (Laser Ò 3 TM ; Koch Supplies, North Kansas City, MO, USA). Cured ham evaluation Upon completion of the curing process, all hams were weighed and yield was calculated as the weight of the cured ham divided by the weight of fresh ham. Slices (9 mm thick) from each ham were cut perpendicular to the femur using a band saw. Afterwards, the same objective color scores described above were evaluated on the semimembranosus muscle from a slice obtained from approximately the centre of each cured ham. The semimembranosus muscle was evaluated after the curing process, because the face of the ham was extremely dry because of curing and was not representative of the quality found in the high-value centre cuts. A sample of each slice was retained for further analytical determinations including moisture and salt content. First, the cured ham samples were finely ground using the procedures described above. Moisture was determined from a 50-g ground sample using the procedures described for evaluating fresh ham dry matter percentage. The salt content was calculated using 10-g samples analysed with a sodium ionselective electrode attached to a Model 225 ph-ise meter (Denver Instrument Company, Arvada, CO, USA) with a standard curve verified by the AOAC (1990) standard method. Molecular genetic marker evaluation The DNA was extracted from the muscle samples using a standard DNA extraction method. In order to account for genes that are known to have a major impact on pork quality, all samples were initially genotyped for the porcine stress syndrome gene (RYR1 ryanodine receptor 1 gene, usually indicated as the HAL 1843 TM mutation) and for the RN ) or Napole genotype using the procedures described by Fujii et al. (1991) and Milan et al. (2000), respectively. Additionally, the genotypes for three markers previously described in the literature, namely the protein kinase, AMP-activated, gamma-3 non-catalytic subunit (PRKAG3) Ile 199 Val mutation (Ciobanu et al. 2001), the calpastatin (CAST) Ser 638 Arg mutation (Ciobanu et al. 2004) and the Glu to Asp mutation previously detected in exon 9 of the porcine cathepsin F (CTSF) gene (Russo et al. 2004) were determined on all hams. In addition to these markers, new genetic markers were developed using single-nucleotide polymorphisms (SNPs) identified in a total of 12 genes, including the ankyrin repeat and SOCS box-containing 15 (ASB15), calpain 1, large subunit (CAPN1), cathepsin B (CTSB), cathepsin F (CTSF), cathepsin K (CTSK), cathepsin L (CTSL), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), muscle glycogen synthase 1 (GYS1), lipoprotein lipase (LPL), phytanoyl-coa hydroxylase (PHYH), protoporphyrinogen oxidase (PPOX) and stearoyl-coa desaturase (SCD) genes. Initially, primer sets were designed for each of these genes in order to amplify several polymerase chain reaction (PCR) fragments from each gene. After PCR optimization of these primer sets, pooled PCR products were sequenced for each gene using an ABI automated DNA sequencer (Applied Biosystems, Foster City, CA, USA). The pools included animals from each of the two processing plants from where the hams were provided and the sequence comparisons between these pools was used to identify SNPs. The sequences were analysed using Sequencher software version 3.0 (Gene Codes, Ann Arbor, MI, USA). After identification of the polymorphisms present in each gene, new primer sets were designed in order to design PCR-restriction fragment length polymorphism (RFLP) tests for those polymorphisms found within the recognition sites of restriction enzymes. The sequences of these primer sets for each gene are indicated in Table 1. These PCR-RFLP tests were used to genotype the whole data set. Amplifications were performed using 12.5 ng of porcine DNA, 1x PCR buffer, 2.5 mm of MgCl 2, mm each dntp, 0.3 mm of each primer and 0.35 U Taq polymerase (Promega, Madison, WI, USA). The PCR conditions included an initial step at 94 C for 3 min followed by 35 cycles of 94 C for 30 s, specific annealing temperature for each primer set (Table 1) for 30 s and 72 C for 30 s. The final 250 Journal compilation ª 2008 Blackwell Verlag, Berlin J. Anim. Breed. Genet. 125 (2008)

4 A. M. Ramos et al. Genetic markers for US country hams Table 1 Genes analysed, primers, PCR annealing temperature, position of SNPs, restriction enzymes used, PCR-RFLP fragment sizes and allele frequencies in a study of the association between genetic markers and fresh and dry-cured ham processing characteristics Marker Primer Primer sequence (5 3 ) Fragment size (bp) Annealing temp. ( C) SNP position Restriction enzyme Fragment sizes (bp) and allele freq. (%) ASB15 1 AS01F AS01R CAPN1 CN01F CN01R CTSB CTBF CTBR CTSB CTB02F CTB02R CTSF CTF01F CTF01R CTSF CTF01F CTF01R CTSK CTK02F CTK02R CTSL CTL01F CTL01R GAPDH GA01F GA01R GYS1 GY01F GY01R LPL LP01F LP01R PHYH PH01F PH01R PPOX PO01F PO01R SCD SC01F SC01R GAGTTTATTACAGTTCCTTG TATATTATTAGCAGATTTCAGTTTAGTACA CCAACTCCTCCAAAACCTATG CCTGGGATGGGAAAGACC GGAAGCCATCTCTGACCG TGGGGCACCTCTGGGAAAG AGAATGGCACCCCCTACTG CCACTCGTCCCTGTACCTGA ACACTGGCACAGCTCGGTA CCTGGTCCTTGACTTTGGTG ACACTGGCACAGCTCGGTA CCTGGTCCTTGACTTTGGTG TTGTTTCCATATTCAGACCAAGT ATCGCTATTGCAGTTTTCATCG AACAGGGAGGTTTCCACTTG CGCACACAGACACATACACAC CGAAAGAGGAGGGGACCTAA TGTCATACTTCTCATGGTTCACG TGAAGTCCAAGGGGATCAAG TGGTTTCCTTTTGAGTAGTTGC TGGTTTGGCCTGTGTAGAGA TTGGAGCTTCTGCATACTCG TGGCTGGCTTTAATCTTAGTCC TGGACACATCTCTCATCAGCA GCTTTGCTTAGTGGGCATTT ACACCAGTCCCTGTCTCCAA CCAGCTCTAGCCTTTAATACCC GCTTTAGGAAACAAAAGTTGGA Exon 9 Hpy8I 114 bp (allele 1) (55.9%) 86, 28 bp (allele 2) (44.1%) Intron 3 TaqI 529 bp (allele 1) (24.2%) 373, 156 bp (allele 2) (75.8%) Intron 6 HincII 282 bp (allele 1) (34.0%) 236, 46 bp (allele 2) (66.0%) Intron 10 NlaIII 178, 106 bp (allele 1) (51.9%) 121, 106, 57 bp (allele 2) (48.1%) Exon 6 BpmI 294, 20 bp (allele 1) (52.9%) 231, 63, 20 bp (allele 2) (47.1%) Intron 5 EarI 314 bp (allele 1) (8.7%) 174, 140 bp (allele 2) (91.3%) Intron 6 AciI 200 bp (allele 1) (59.1%) 134, 66 bp (allele 2) (40.9%) Intron 6 MseI 200, 31 bp (allele 1) (43.9%) 160, 40, 31 bp (allele 2) (56.1%) Intron 5 BseRI 186, 21 bp (allele 1) (17.4%) 119, 67, 21 bp (allele 2) (82.6%) Exon 5 HhaI 289 bp (allele 1) (81.1%) 220, 69 bp (allele 2) (18.9%) Intron 4 MspI 364 bp (allele 1) (41.6%) 275, 89 bp (allele 2) (58.4%) Intron 3 AciI 430, 106 bp (allele 1) (51.5%) 383, 106, 48 bp (allele 2) (48.5%) Exon 11 HphI 252, 58 bp (allele 1) (57.8v) 150, 102, 58 bp (allele 2) (42.2%) Intron 1 BsrI 434 bp (allele 1) (30.2%) 282, 152 bp (allele 2) (69.8%) 1 The genes analysed were ankyrin repeat and SOCS box-containing 15 (ASB15), calpain 1, large subunit (CAPN1), cathepsin B (CTSB), cathepsin F (CTSF), cathepsin K (CTSK), cathepsin L (CTSL), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), muscle glycogen synthase 1 (GYS1), lipoprotein lipase (LPL), phytanoyl-coa hydroxylase (PHYH), protoporphyrinogen oxidase (PPOX) and stearoyl-coa desaturase (SCD). Journal compilation ª 2008 Blackwell Verlag, Berlin J. Anim. Breed. Genet. 125 (2008)

5 Genetic markers for US country hams A. M. Ramos et al. extension step consisted of 3 min at 72 C. Digestions were performed using the restriction enzyme for each PCR-RFLP test (Table 1) following the recommendations of the manufacturer. The locations of the SNPs within the genes, as well as the fragment sizes for each allele, are also presented in Table 1. Statistical analyses The PROC GLM procedure of SAS (1996) was used to analyse the data with a model that included ham source, day of sampling and marker genotype as fixed effects. The model used for the analysis of cured weight was different because initial ham weight was included as a linear covariate. For the objective colour scores determined on the fresh hams, the model included only ham source and marker genotype because these traits were collected only on the first day of sampling. In order to account for multiple testing, least-squares mean values for all marker trait combinations were compared using PROC GLM and Tukey Kramer tests. The samples were convenient samples, like those processing pork plants commonly receive and hence, information on other effects, such as breed, sex or sire, was not available for the data set analysed. Previous studies indicated little or no sex effects on meat quality traits (Barton-Gade 1987; Cisneros et al. 1996). Determination of sex of the animals was not attempted by DNA typing because that would not probably occur under commercial conditions at the processing plant. Samples from animals that were carriers or homozygous for the unfavourable allele at the RYR1 and PRKAG3 loci were removed from the data set to remove major genes known to impact pork quality. Significant differences were declared when the marker genotype effect was a significant source of variation in the analysis of variance and the p-value for the difference between the least squares mean values for each marker genotype was less than 0.05 using the more stringent Tukey Kramer test, to reject the null hypothesis that all mean values were equal. The Tukey Kramer test was used because all pairwise comparisons were of interest and also because it is a slightly more conservative test for unequal sample sizes. Results The initial data set included 321 hams. However, 22 animals that were carriers or homozygous for the RYR1 and/or PRKAG3 unfavourable allele were removed from the data set. A total of 14 new genetic markers were developed using the SNPs discovered in 12 different genes. Of the 14 SNPs identified, only four were located in exons, in the ASB15, CTSF, GYS1 and PPOX genes. Of these, three SNPs resulted in amino acid changes at the protein level, namely an asparagine to serine change in CTSF exon 6, an arginine to cysteine change in GYS1 exon 5 and an aspartic acid to tyrosine change in PPOX exon 11. The exonic mutation located on ASB15 exon 9 did not change the amino acid sequence of the protein. Significant associations were detected for several marker trait combinations. A total of 51 significant (p < 0.05) marker trait combinations were detected of the possible 425 combinations (17 markers 25 traits), before correction for multiple comparison of mean values. This number decreased to 30 significant associations after correction for multiple comparison of mean values using the Tukey Kramer test. Results from the analyses performed showed significant associations between three markers (CTSF EarI, CTSF RsaI and SCD BsrI) with cured weight and yield (Table 2). CTSF EarI genotype 22 presented significantly higher cured weight and yield values when compared with genotype 12 (p < 0.01). For this marker, no animals carrying genotype 11 were detected. In addition, suggestive associations (p < 0.1) with these traits were also detected for CTSF RsaI, a marker previously described by Russo et al. (2004). For this marker, genotype 22 was associated with higher cured weight and yield. The SCD BsrI marker showed the strongest association with Table 2 Dry-cured ham weight and yield least squares mean values ( standard errors) by genetic marker genotype from random group of hams Gene marker n 1 Ham trait Cured weight (kg) Yield (%) CTSF EarI p < p < e e f f CTSF RsaI p < 0.07 p < a a,b a,b a b b SCD BsrI p < p < e e e e f f 1 Number of individuals per genotype. 2 p-value for the gene effect; for each marker and trait, mean values within the same column with different superscripts differ: a,b p < 0.1; e,f p < 0.01; significant differences between mean values were corrected for multiple comparisons using the Tukey Kramer test. 252 Journal compilation ª 2008 Blackwell Verlag, Berlin J. Anim. Breed. Genet. 125 (2008)

6 A. M. Ramos et al. Genetic markers for US country hams cured weight and yield (p < 0.001). Genotype 22 for this marker was associated with increases in these traits, with the yield difference between genotypes 11 and 22 estimated to be 2.33%. Several subjective and objective colour traits were measured on the fresh and cured hams, and there were numerous markers significantly associated with these traits (Tables 3 and 4). The GYS1 HhaI marker was associated with all the colour traits measured in the fresh hams, although the associations with the cured Minolta and Hunter L scores only approached significance. Furthermore, the direction of the effects of this marker s genotypes varied for the three colour traits measured on the fresh hams (colour and fresh Minolta and Hunter L scores). Another marker associated with colour was PRKAG3 BsaHI. Genotype 12 for this marker was associated with lower values (indicating darker meat colour) for the Minolta and Hunter L scores measured in the fresh hams. However, the same was not observed for the same scores when measured on cured hams. The SCD BsrI marker, significantly associated with cured weight and Table 3 Subjective and objective meat colour least squares mean values (standard errors) by marker genotype from random group of hams Gene marker n 1 Ham trait Colour Cured Minolta L Cured Hunter L GYS1 p < p < 0.13 p < 0.10 HhaI c d c PRKAG3 p < 0.06 p < 0.06 BsaHI SCD p < 0.02 p < 0.03 p < 0.03 BsrI c,d c,d c,d c c c d d d 1 Number of individuals per genotype. 2 p-value for the gene effect; for each marker and trait, mean values within the same column with different superscripts differ: a,b p < 0.1; c,d p < 0.05; e,f p < 0.01; significant differences between mean values were corrected for multiple comparisons using the Tukey Kramer test. Subjective colour was evaluated using the US National Pork Producers Council guidelines (NPPC; Berg 2000); objective colour measurements in the cured hams were collected using a Minolta Chroma Meter (Ramsey, NJ, USA) with a 50-mm aperture, using Standard Illuminant C light source and 0 viewing angle geometry. Table 4 Fresh ham objective meat colour trait least squares mean values ( standard errors) by marker genotype from random group of hams Gene marker n 1 yield, was also significantly associated with colour traits, namely subjective colour scores and cured Minolta and Hunter L scores. Based on the results of the present study, the desirable genotype for yield at this locus was also the genotype associated with darker meat. Two additional traits of interest for the pork-processing industries are lipid percentage and ph. Several markers affecting these two traits were identified in this study (Table 5), including three cathepsin markers. Significant associations were detected for a total of four markers, including CTSB HincII, CTSB NlaIII, GAPDH BseRI and SCD BsrI, and lipid percentage, with differences between genotypes being approximately 0.3%. Concerning the SCD BsrI marker, the genotype associated with higher lipid percentage (genotype 22) was also the favourable genotype for cured weight and yield. The two CTSB markers also displayed a suggestive association with ph, even though no significant differences between genotypes were detected. Significant associations with ph were identified for another cathepsin marker, CTSL MseI, and also for CAPN1 TaqI. For the latter marker, a clear difference between the homozygous genotypes was observed. Associations with other traits, such as marbling, firmness and salt percentage were also detected (results not shown). Discussion Ham trait Fresh Minolta L Fresh Hunter L GYS1 HhaI p < p < c c d d c,d c,d PRKAG3 BsaHI p < 0.02 p < c,d c,d c c d d 1 Number of individuals per genotype. 2 p-value for the gene effect; for each marker and trait, mean values within the same column with different superscripts differ: a,b p < 0.1; c,d p < 0.05; e,f p < 0.01; significant differences between mean values were corrected for multiple comparisons using the Tukey Kramer test. The objective of the current study was to evaluate the effect of genetic markers on fresh and dry-cured ham-processing characteristics of US country hams. Journal compilation ª 2008 Blackwell Verlag, Berlin J. Anim. Breed. Genet. 125 (2008)

7 Genetic markers for US country hams A. M. Ramos et al. Table 5 Lipid percentage and ph least squares mean values ( standard errors) by marker genotype from random group of fresh hams CTSB HincII (p < 0.04) CTSB NlaIII (p < 0.07) GAPDH BseRI (p < 0.005) SCD BsrI (p < 0.009) Trait n Lipid, % a a,b b c c,d d e,f e f e,f e f CTSB HincII (p < 0.10) CTSB NlaIII (p < 0.10) CTSL MseI (p < 0.05) CAPN1 TaqI (p < 0.02) Trait n ph a a,b b c d c,d a c b,d For each marker and trait, mean values within the same row with different superscripts differ: a,b p < 0.1; c,d p < 0.05; e,f p < 0.01; significant differences between mean values were corrected for multiple comparisons using the Tukey Kramer test. The traits discussed can be grouped into (i) weight and yield traits, (ii) colour traits, and (iii) lipid percentage and ph. Weight and yield traits Cured weight and yield are arguably the two most important traits from the processor s perspective, as improvements in any of these traits will immediately translate into increased weight and presumably profit, as payment is on a weight basis. The two genes that affected these traits were the CTSF and SCD genes. Cathepsins are lysosomal enzymes involved in the proteolysis that is observed during the dry-curing process, whose activity is preserved throughout the curing process (Parreno et al. 1994). Hence, some genes from the cathepsin family are good candidates to explain variation in traits related to dry-cured ham production. The influence of two cathepsin genes on these traits was initially studied in Italian pigs, with results indicating significant associations for the CTSB and CTSF genes (Russo et al. 2002, 2003). Additional markers were then analysed at the CTSB (CTSB HincII) and CTSZ (cathepsin Z) genes (Ramos et al. 2005) using a smaller data set collected previously at the same processing plant where the present study took place. The CTSF RsaI marker described by Russo et al. (2003) was also included. Results from the study by Ramos et al. (2005) showed that the markers in these three cathepsin genes affected cured weight, while suggestive associations with yield were also detected for CTSB and CTSZ. The latter marker was also genotyped in the data set used in this study, but it was not segregating, reason why it was impossible to perform association analyses. Two new SNPs in the CTSF gene were identified in the present study, carried out using a larger data set. Results show that not only were two of the CTSF markers again significantly associated with cured weight and yield, but also that the direction of the effects for the CTSF RsaI marker was the same (genotype 22 was associated with increased yield in both studies). This confirmed the results obtained previously and provides strong evidence that the CTSF gene is an excellent candidate gene for country ham production. This marker can be used to screen and select the carcasses more suitable for country ham production and possibly in selection schemes employed by pig breeders which are designed to improve cured weight and yield. In this study, a new marker was developed for the CTSB gene (CTSB NlaIII). However, the two CTSB markers analysed did not show an association with 254 Journal compilation ª 2008 Blackwell Verlag, Berlin J. Anim. Breed. Genet. 125 (2008)

8 A. M. Ramos et al. Genetic markers for US country hams cured weight and yield, which is not in agreement with the earlier results obtained by Ramos et al. (2005). There are several reasons that can potentially explain these differences (breeds analysed, sample size, etc.), but the experimental design of both studies did not allow us to clearly identify the reasons why inconsistencies exist for the CTSB gene effect on cured weight and yield. This gene should be further evaluated, by sequencing different regions in order to identify additional polymorphisms that could either confirm or discard this gene as a candidate to explain variation in cured weight and yield of drycured hams. In addition to proteolysis, lipid metabolism also plays an important role in the production of drycured hams. Lipids play a central role in a variety of pork quality traits. During processing they are subjected to degradation by lipolysis and oxidation (Gandemer 1999). Therefore, genes involved in the metabolism of lipids can also be considered good candidates to explain variation in dry-cured ham production traits. This study identified one gene associated with cured weight and yield, namely the SCD gene. The SCD gene codes for the enzyme responsible for the conversion of saturated fatty acids into mono-unsaturated fatty acids in mammalian adipocytes (Taniguchi et al. 2004). The SCD BsrI marker presented the strongest associations (p < ) with cured weight and yield. This marker impacted these two traits in a clearly additive way, with genotype 22 being the preferred genotype. The difference observed between genotypes 11 and 22 for this marker was relatively large, especially for yield, where a 2.33% difference was identified. These yield differences may be worth over $1 dollar per ham and illustrate the potential benefit of using molecular markers for the improvement of dry-cured ham traits, especially when the number of hams produced annually and their relatively high market value is considered. Colour traits Another important trait associated with pork quality is meat colour. Several color traits were evaluated in the present study, using subjective and objective colour measurements in both the fresh and cured hams. Results again showed several genes significantly associated with meat colour (Tables 3 and 4). In particular, the GYS1 HhaI marker was significantly associated with subjective colour and cured Minolta and Hunter L scores. However, the direction of the genotype effects on the colour traits measured in the fresh hams was inconsistent. Because of a machine malfunction, the number of animals with data for fresh Minolta and Hunter L scores was smaller. Nonetheless, the GYS HhaI genotype 11 was always associated with lower values (indicating darker meat) of the Minolta and Hunter L scores measured in both the fresh and cured hams. The PRKAG3 gene marker identified by Ciobanu et al. (2001) also presented similar results, even though it did not significantly impact subjective colour. Interestingly, the marker showing the largest influence on cured weight and yield (SCD BsrI) was also significantly associated with subjective colour and cured Minolta and Hunter L scores, with the best genotype for yield being consistently associated with meat that is more red in colour. This emphasizes the importance of using high-quality fresh pork in the production of dry-cured hams. Lipid percentage and ph Several genetic markers for a variety of fresh pork quality traits, such as ph and lipid percentage were also identified (Table 4). These markers, while important for the production of dry-cured hams, can also be used in the improvement of fresh pork quality because they were measured on the hams before curing. Associations with lipid percentage and ph were detected for the two CTSB markers analysed in this study, with results demonstrating that the genotype associated with higher lipid percentage was also associated with lower (poorer) ultimate ph values. Moreover, the SCD BsrI genotype 22, associated with higher cured weight and yield, was also significantly associated with higher lipid percentage. Previous studies have reported an influence of the SCD gene on beef fatty acid composition (Yang et al. 1999; Taniguchi et al. 2004), which supports the role played by this gene in lipid metabolism. Results from the present study suggest that lipid percentage is an important trait to consider in the production of drycured hams, even though the biological mechanisms that explain this influence are still unclear. It should be noted that a limitation of this project is that the samples were convenient samples, those that arrived at the processing plant and were of unknown breed, sire or sex. This is typical of such hams that are processed in a commercial environment. It is possible, that spurious marker trait associations could result without this information, but as the samples were from two different harvesting facilities across 2 days, we expect this not to be the case. Future studies should consider trying to manage Journal compilation ª 2008 Blackwell Verlag, Berlin J. Anim. Breed. Genet. 125 (2008)

9 Genetic markers for US country hams A. M. Ramos et al. such samples and obtain this information to the degree possible in order to implement a more complete analysis model. However, the results from the present study are probably more representative of those that would be expected under commercial conditions and be most useful to US ham-processing facilities, as in general such information (breed, sire, sex, etc.) is not known when hams arrive to be processed. Conclusions In this study, a total of 14 new genetic markers were developed using the SNPs identified in 12 candidate genes for fresh and dry-cured quality traits of US country hams. Some of these markers were significantly associated with two important traits for the dry-cured ham industry, namely cured weight and yield. The differences observed between genotypes at two markers (CTSF EarI and SCD BsrI) were large and can potentially have a significant impact on profit if used for carcass screening or in selection programmes to improve cured weight and yield. In the future, it would be interesting to investigate these associations in different pig populations. The best CTSF EarI and SCD BsrI genotype for yield was consistently the best genotype for other fresh and cured pork quality traits. Significant associations with colour (measured in the fresh and cured hams) and other fresh pork quality traits were also identified. Even though some of these markers did not affect cured weight or yield they can potentially be used in the improvement of fresh pork quality traits. Pigs with desirable qualities for dry-cured ham production could be bred and serve as sire lines, for example, for improved meat quality. Another possible application of the molecular marker information developed from this study would be for sorting carcasses based on genotypes from animals that display the preferred characteristics for the production of fresh or dry-cured pork products. Acknowledgements Financial support for Antonio Marcos Ramos was provided by FCT Fellowship BD/6877/2001. This work was supported financially in part by Sygen International and the Iowa Agriculture and Home Economics Experimental Station, State of Iowa and Hatch funds. The authors wish to thank Clifty Farm Country Hams for their contribution to the project. Technical assistance from Mr Benny Mote and Ms Nguyet Nguyen in the development of the ASB15 and CTSB HincII markers, respectively, was greatly appreciated. The authors also thank Dr Steven Lonergan for his technical assistance. References AOAC (1990) Official methods of analysis (15th edn). Association of Official Analytical Chemists, Arlington, VA. Barton-Gade P.A. (1987) Meat and fat quality in boars, castrates and gilts. Livest. Prod. Sci., 16, Berg E.P. (ed.) (2000) Pork Composition and Quality Assessment Procedures. National Pork Producers Council (NPPC), Des Moines, IA. Bidanel J.P., Rothschild M.F. (2002) Current status of quantitative trait locus mapping in pigs. Pig News Info, 23, Ciobanu D.C., Bastiaansen J., Malek M., Helm J., Woollard J., Plastow G.S., Rothschild M.F. (2001) Evidence for new alleles in the protein kinase AMP-activated, subunit gene associated with low glycogen content in pig skeletal muscle and improved meat quality. Genetics, 159, Ciobanu D.C., Bastiaansen J.W.M., Lonergan S.M., Thomsen H., Dekkers J.C.M., Plastow G.S., Rothschild M.F. (2004) New alleles in calpastatin gene are associated with meat quality traits in pigs. J. Anim. Sci., 82, Cisneros F., Ellis M., McKeith F.K., McCaw J., Fernando R.L. (1996) Influence of slaughter weight on growth and carcass characteristics, commercial cuttingand curing yields, and meat quality of barrows and gilts from two genotypes. J. Anim. Sci., 74, Folch J., Lees M., Stanley G.H.S. (1957) A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem., 226, Fujii J., Otsu K., Zorzato F., de Leon S., Khanna V.K., Weiler J.E., O Brien P.J., MacLennan D.H. (1991) Identification of a mutation in porcine ryanodine receptor associated with malignant hyperthermia. Science, 253, Gandemer G. (1999) Lipids and meat quality: lipolysis, oxidation, maillard reaction and flavour. Sciences des Aliments, 19, Milan D., Jeon J.T., Looft C., Amarger V., Robic A., Thelander M., Rogel-Gaillard C., Paul S., Iannuccelli N., Rask L., Ronne H., Lundström K., Reinsch N., Gellin J., Kalm E., Le Roy P., Chardon P., Andersson L. (2000) A mutation in PRKAG3 associated with excess glycogen content in pig skeletal muscle. Science, 288, Parreno M., Cusso R., Gil M., Sarraga C. (1994) Development of cathepsin B, L and H activities and cystatinlike activity during two different manufacturing 256 Journal compilation ª 2008 Blackwell Verlag, Berlin J. Anim. Breed. Genet. 125 (2008)

10 A. M. Ramos et al. Genetic markers for US country hams processes for Spanish dry-cured ham. Food Chem., 49, Ramos A.M., Stalder K., Nguyen N.T., Rothschild M.F. (2005) Effect of three cathepsin genes on processing quality traits of fresh and dry-cured hams. Proc. Midwest Regional Meet. Am. Soc. Anim. Sci., Des Moines, IA, USA, pp March Russo V., Fontanesi L., Davoli R., Nanni Costa L., Cagnazzo M., Buttazzoni L., Virgili R., Yerle M. (2002) Investigation of candidate genes for meat quality in dry-cured ham production: the porcine cathepsin B (CTSB) and cystatin B (CSTB) genes. Anim. Genet., 33, Russo V., Davoli R., Nanni Costa L., Fontanesi L., Baiocco C., Buttazzoni L., Galli S., Virgili R. (2003) Association of the CTSB, CTSF and CSTB genes with growth, carcass and meat quality traits in heavy pigs. Ital. J. Anim. Sci., 2 (Suppl. 1), Russo V., Fontanesi L., Davoli R., Galli S. (2004) Linkage mapping of the porcine cathepsin F (CTSF) gene close to the QTL regions for meat and fat deposition traits on pig chromosome 2. Anim. Genet., 35, SAS (1996). SAS User s Guide: Statistics. Version 6.12 Edition. SAS Inst., Inc., Cary, NC. Stalder K.J., Rothschild M.F., Lonergan S.M. (2005) Associations between two gene markers and indicator traits affecting fresh and dry-cured ham processing quality. Meat Sci., 69, Stalder K.J., Berry N.L., Hanson D.J., Mikel W. (2006) Ripened hams in the U.S. In: F. Toldra, W.K. Nip, J. Sebranek, L.H. Stahnke, E.T.F. Silveira, I. Astiasaran, R. Talon, Y.H. Hui (eds) Handbook of Fermented Meat and Poultry. Blackwell Publishing, Oxford, UK, pp Taniguchi M., Utsugi T., Oyama K., Mannen H., Kobayashi M., Tanabe Y., Ogino A., Tsuji S. (2004) Genotype of stearoyl-coa desaturase is associated with fatty acid composition in Japanese Black cattle. Mamm. Genome, 14, Toldra F., Flores M. (1998) The role of muscle proteases and lipases in flavor development during the processing of dry-cured ham. Crit. Rev. Food Sci. Nutr., 38, Yang A., Larsen T.W., Smith S.B., Tume R.K. (1999) D9 desaturase activity in bovine subcutaneous adipose tissue of different fatty acid composition. Lipids, 34, Journal compilation ª 2008 Blackwell Verlag, Berlin J. Anim. Breed. Genet. 125 (2008)