Introduction to LOH and Allele Specific Copy Number User Forum

Size: px
Start display at page:

Download "Introduction to LOH and Allele Specific Copy Number User Forum"

Transcription

1 Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber

2 Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2. Merging LOH with copy number Why? Tips 3. Allele Specific Copy Number Paired vs Unpaired? Detecting Imbalance Visualization 4. Q & A

3 Data Sets used 20 paired tumor/normal samples Kindly provided by Ian Campbell, Peter MacCallum Cancer Centre Run on the Affymetrix Human SNP 6.0 Arrays 20 HapMap samples run on Illumina 1M

4 Why study alleles? Interest in copy number is based on the idea that the deletion or duplication of DNA can promote tumorigenesis Deletion of tumor suppressor genes Duplication of oncogenes Fundamentally deletion or duplication is not the important issue, its loss or amplification of functionality or mutation. If everyone was homozygous everywhere, CGH would be all we need. In the heterozygous case if one allele is deleted, or amplified, it can alter the expression of the functional or mutant phenotype.

5 Focus on heterozygosity In areas of heterozygosity we are not interested in merely CGH changes, instead we want to see how the alleles are changing There are two tools Partek lays at our disposal: LOH- Loss of Heterozygosity ASCN- Allele Specific Copy Number Fundamentally the difference is that LOH is a state. Either you are or you aren t. ASCN will be used to find magnitude and to help simplify images.

6 Data types and import To analyze for LOH Partek will require genotype calls Partek does not have a genotyping algorithm Import from CHP files or create them from within Partek for Affymetrix data Import from beadstudio project using Partek exporter for Illumina data To analyze for ASCN Partek will also require allele intensities Import CEL files into Partek for Affymetrix data Import from beadstudio project using Partek exporter for Illumina data

7 Loss of Heterozygosity What is it? Looking across many continuous markers, find genomic regions that contain stretches of SNP markers called heterozygous (AB) in the normal samples, but called homozygous (AA or BB) in the cancer samples. How is it determined? Partek uses the HMM algorithm to find these regions. Blood Tumor Normal Het LOH Homozygous: Heterozygous: LOH:

8 Why/When is a baseline needed? If you do not have paired data, then the baseline file is used to determine the expected rate of heterozygosity for each SNP This use case is not accurately described as Loss of Heterozygosity, rather it is the detection of runs of homozygosity (ROH), specifically unexpected ones But you have a baseline, right? There are baselines available download drawn from the Hapmap2. If you don t have a random mix of these populations, then the baseline won t give a good estimate of expected frequency! 0% heterozygous 50% heterozygous European Population Japanese with cancer ROH, but is it LOH? Japanese Population Common haplotype block False positive

9 LOH Paired is preferred when possible For baselines, use a normal population similar to your samples Better expected genotype frequencies Avoiding LOH due to common haplotype blocks within populations

10 LOH Set Up Dialog - Paired HMM parameters are difficult to tweak. Partek suggests taking the default parameters. A quick primer Max probability: Chance that if a probe is LOH, the next will be as well Genomic Decay: How quickly does the effect of one SNP s LOH on neighboring SNPs status decay Genotype error: Chance that the genotype call is made incorrectly

11 LOH Set Up Dialog - Unpaired Nearly the same except: Input baseline Default frequency If there is no baseline at all, or all the baseline samples were NCs this is used as default het frequency for the SNPs

12 LOH creates a segment table One row per sample per LOH region.

13 Paired LOH question Q: I ran paired LOH, and yet, in some of my LOH regions, the het rate is quite large, even when I set genotype error to 0! A: When looking for paired LOH, we look only at the SNPs that are heterozygous in the normal tissue. In long regions of normal homozygosity, LOH may be detected using just the few heterozygous SNPs. The many homozygous SNPs, due to genotyping error, may become heterozygous in the tumor sample; enough to noticeably effect the het rate in the region. If genotype error is non zero, this actually happens more rarely.

14 Common LOH Sig-Regions Number of samples and heterozygous rate is a possible filter. Automatically generated with LOH, when box is checked in setup.

15 LOH and Copy Number Overlap Using the LOH workflow, we can find regions of LOH, common LOH. Even places where LOH differs between groups with a little elbow grease. Using the copy number workflow we can find regions of amplification and deletion. Additionally we can overlap the two to find regions that intersect CN Overlap LOH

16 LOH and Copy Number Overlap When overlapping you must have the same sample IDs for the LOH analysis and the CN analysis Report is at the sample level, each region falls into one of 6 categories: Amplification, Deletion Amplification + LOH, Deletion + LOH Copy Neutral LOH Why do I care about cnloh? Because allelic imbalance can occur without alteration of chromosomal abundance. And a shift in the allelic balance within a sample can lead to phenotypic alternations.

17 Copy Neutral LOH is prevalent in Cancer 67% of LOH events in 26 pancreatic cancer cells lines occurs in regions with either copy neutral or copy gain regions Calhoun et al. Can Res : % of LOH events in cervical cell lines did not show a copy number change Kloth et al. BMC Genomics :53 56% of LOH events in glioblastomas were copy neutral Kuga et al. Neuro-oncology :995

18 Why Allele Specific copy number (AsCN)? Cancer Studies w/ primary specimens Pure normal population required Does not require paired samples or large reference population Can be run paired (recommended)

19 What is allele specific copy number? Like LOH, only pay attention to heterozygous SNPs In a heterozygous SNP, we expect balance between our two SNP calls. In fact, in diploid organisms, each SNP becomes an analogue of each allele! If we find that one of our alleles has become larger, the smaller, or both then we have imbalance. LOH is a case of severe imbalance, but in mixed tissue perfect LOH is hard to come by A B Normal LOH In between imbalance

20 Mixing Tumor & Normal Cell Lines on 50K SNP

21 Allele Specific CN The workflow

22 Allele Specific CN Setup No prebuilt references Requires normals to be included in project Normal samples do not have to come from the same experiment, if necessary, download some normal samples off GEO and merge them in

23 How does ASCN use the baseline? ASCN will only make estimates in areas of heterozygosity In paired data, areas of heterozygosity is defined by normals In unpaired data, areas of heterozygosity are defined from genotypes Yes, unpaired ASCN will have no estimates in areas of LOH as defined by the LOH workflow. They complement each other Not heterozygous areas are given? s ASCN must make an estimate of what intensity maps to 1 copy of an allele In paired data, this is the intensity of the allele in the normal samples In unpaired data, this is the average intensity of the allele in heterozygous samples

24 Allele Specific Copy Number (AsCN) Two rows per sample

25 Detect Allelic Imbalances Proportion = (Max-Min) / (Max + Min)

26 Using Imbalance to Drive Copy # Discovery Sort Descending on Proportion column in imbalance spreadsheet Max = 1.05 and Min = 0.95, then Proportion = 0.1 / 2 = 0.05 Max = 1.9 and Min = 0.1, then Proportion = 1.8 / 2 = 0.90 Large Proportion Values represent Allelic Imbalance

27 Copy Number vs Allele Specific Copy #

28 Common questions when viewing ASCN Why is the image sparse? In paired data, homozygous SNPs in the normal are not used. Its possible the region is dominantly homozygous In unpaired data, NC and homozygous SNPs in the sample are not tested. In areas of great aberration or LOH fewer calls are made. Why doesn t it always agree with the LOH? LOH uses the genotype calls. If there is a large dominance of one allele, often the region will be called as homozygous Why doesn t it always agree with copy number or allele ratio? These are all separate algorithms. While they are usually very close in most ways when they don t match up, there should still be a consistent story

29 Interplay between Copy Number Measures Amplification on p arm. Four clusters in allele ratio. Separation in AsCN

The Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0

The Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0 The Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0 Introduction Loss of erozygosity (LOH) represents the loss of allelic differences. The SNP markers on the SNP Array 6.0 can be used

More information

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley

More information

Understanding DNA Copy Number Data

Understanding DNA Copy Number Data Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php

More information

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Integrated Analysis of Copy Number and Gene Expression

Integrated Analysis of Copy Number and Gene Expression Integrated Analysis of Copy Number and Gene Expression Nexus Copy Number provides user-friendly interface and functionalities to integrate copy number analysis with gene expression results for the purpose

More information

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies

More information

Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit

Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit APPLICATION NOTE Ion PGM System Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit Key findings The Ion PGM System, in concert with the Ion ReproSeq PGS View Kit and Ion Reporter

More information

Gene Expression Analysis Web Forum. Jonathan Gerstenhaber Field Application Specialist

Gene Expression Analysis Web Forum. Jonathan Gerstenhaber Field Application Specialist Gene Expression Analysis Web Forum Jonathan Gerstenhaber Field Application Specialist Our plan today: Import Preliminary Analysis Statistical Analysis Additional Analysis Downstream Analysis 2 Copyright

More information

GENOME-WIDE ASSOCIATION STUDIES

GENOME-WIDE ASSOCIATION STUDIES GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE

More information

Module 3: Pathway and Drug Development

Module 3: Pathway and Drug Development Module 3: Pathway and Drug Development Table of Contents 1.1 Getting Started... 6 1.2 Identifying a Dasatinib sensitive cancer signature... 7 1.2.1 Identifying and validating a Dasatinib Signature... 7

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

Extra Review Practice Biology Test Genetics

Extra Review Practice Biology Test Genetics Mendel fill in the blanks: Extra Review Practice Biology Test Genetics Mendel was an Austrian monk who studied genetics primarily using plants. He started with plants that produced offspring with only

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

Genetics All somatic cells contain 23 pairs of chromosomes 22 pairs of autosomes 1 pair of sex chromosomes Genes contained in each pair of chromosomes

Genetics All somatic cells contain 23 pairs of chromosomes 22 pairs of autosomes 1 pair of sex chromosomes Genes contained in each pair of chromosomes Chapter 6 Genetics and Inheritance Lecture 1: Genetics and Patterns of Inheritance Asexual reproduction = daughter cells genetically identical to parent (clones) Sexual reproduction = offspring are genetic

More information

Genetics 1. How do genes influence our characteristics?

Genetics 1. How do genes influence our characteristics? Genetics 1 This activity will focus on the question: How do genes contribute to the similarities and differences between parents and their children? This question can be divided into two parts: How do

More information

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence

More information

Whole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis

Whole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis HMG Advance Access published December 21, 2012 Human Molecular Genetics, 2012 1 13 doi:10.1093/hmg/dds512 Whole-genome detection of disease-associated deletions or excess homozygosity in a case control

More information

UTILIZATION OF A SNP MICROARRAY FOR CHRONIC LYMPHOCYTIC LEUKEMIA: EFFICACY, INFORMATIVE FINDINGS AND PROGNOSTIC CAPABILITIES

UTILIZATION OF A SNP MICROARRAY FOR CHRONIC LYMPHOCYTIC LEUKEMIA: EFFICACY, INFORMATIVE FINDINGS AND PROGNOSTIC CAPABILITIES UTILIZATION OF A SNP MICROARRAY FOR CHRONIC LYMPHOCYTIC LEUKEMIA: EFFICACY, INFORMATIVE FINDINGS AND PROGNOSTIC CAPABILITIES S Schwartz, Z Hosseini, S Schepis, P Papenhausen Laboratory Corporation of America

More information

CITATION FILE CONTENT/FORMAT

CITATION FILE CONTENT/FORMAT CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined

More information

Computational Systems Biology: Biology X

Computational Systems Biology: Biology X Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH

More information

Pedigree Construction Notes

Pedigree Construction Notes Name Date Pedigree Construction Notes GO TO à Mendelian Inheritance (http://www.uic.edu/classes/bms/bms655/lesson3.html) When human geneticists first began to publish family studies, they used a variety

More information

Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016

Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics

More information

Mendelian Genetics and Beyond Chapter 4 Study Prompts

Mendelian Genetics and Beyond Chapter 4 Study Prompts Mendelian Genetics and Beyond Chapter 4 Study Prompts 1. What is a mode of inheritance? 2. Can you define the following? a. Autosomal dominant b. Autosomal recessive 3. Who was Gregor Mendel? 4. What did

More information

Exercises: Differential Methylation

Exercises: Differential Methylation Exercises: Differential Methylation Version 2018-04 Exercises: Differential Methylation 2 Licence This manual is 2014-18, Simon Andrews. This manual is distributed under the creative commons Attribution-Non-Commercial-Share

More information

Comprehensive performance comparison of high-resolution array platforms for genome-wide Copy Number Variation (CNV) analysis in humans

Comprehensive performance comparison of high-resolution array platforms for genome-wide Copy Number Variation (CNV) analysis in humans Haraksingh et al. BMC Genomics (2017) 18:321 DOI 10.1186/s12864-017-3658-x RESEARCH ARTICLE Comprehensive performance comparison of high-resolution array platforms for genome-wide Copy Number Variation

More information

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,

More information

Vega: Variational Segmentation for Copy Number Detection

Vega: Variational Segmentation for Copy Number Detection Vega: Variational Segmentation for Copy Number Detection Sandro Morganella Luigi Cerulo Giuseppe Viglietto Michele Ceccarelli Contents 1 Overview 1 2 Installation 1 3 Vega.RData Description 2 4 Run Vega

More information

Nature Methods: doi: /nmeth.3115

Nature Methods: doi: /nmeth.3115 Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

Tumor suppressor genes D R. S H O S S E I N I - A S L

Tumor suppressor genes D R. S H O S S E I N I - A S L Tumor suppressor genes 1 D R. S H O S S E I N I - A S L What is a Tumor Suppressor Gene? 2 A tumor suppressor gene is a type of cancer gene that is created by loss-of function mutations. In contrast to

More information

Identification of regions with common copy-number variations using SNP array

Identification of regions with common copy-number variations using SNP array Identification of regions with common copy-number variations using SNP array Agus Salim Epidemiology and Public Health National University of Singapore Copy Number Variation (CNV) Copy number alteration

More information

Family Trees for all grades. Learning Objectives. Materials, Resources, and Preparation

Family Trees for all grades. Learning Objectives. Materials, Resources, and Preparation page 2 Page 2 2 Introduction Family Trees for all grades Goals Discover Darwin all over Pittsburgh in 2009 with Darwin 2009: Exploration is Never Extinct. Lesson plans, including this one, are available

More information

CNV PCA Search Tutorial

CNV PCA Search Tutorial CNV PCA Search Tutorial Release 8.1 Golden Helix, Inc. March 18, 2014 Contents 1. Data Preparation 2 A. Join Log Ratio Data with Phenotype Information.............................. 2 B. Activate only

More information

CS2220 Introduction to Computational Biology

CS2220 Introduction to Computational Biology CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS

More information

Hematopathology Service Memorial Sloan Kettering Cancer Center, New York

Hematopathology Service Memorial Sloan Kettering Cancer Center, New York SH2017-0334 t(14;18) Negative Follicular Lymphoma with 1p36 abnormality associated with In Situ Follicular Neoplasia with t(14;18) translocation Pallavi Khattar MD, Jennifer Maerki MD, Alexander Chan MD,

More information

Unit 5: Genetics Notes

Unit 5: Genetics Notes Unit 5: Genetics Notes https://goo.gl/fgtzef Name: Period: Test Date: Table of Contents Title of Page Page Number Date Warm-ups 3-4 Mendelian Genetics Notes 5-6 Mendelian Genetics Lets Practice 7 Monohybrid

More information

Pedigree Analysis Why do Pedigrees? Goals of Pedigree Analysis Basic Symbols More Symbols Y-Linked Inheritance

Pedigree Analysis Why do Pedigrees? Goals of Pedigree Analysis Basic Symbols More Symbols Y-Linked Inheritance Pedigree Analysis Why do Pedigrees? Punnett squares and chi-square tests work well for organisms that have large numbers of offspring and controlled mating, but humans are quite different: Small families.

More information

1 eye 1 Set of trait cards. 1 tongue 1 Sheet of scrap paper

1 eye 1 Set of trait cards. 1 tongue 1 Sheet of scrap paper Access prior knowledge Why do offspring often resemble their parents? Yet rarely look exactly alike? Is it possible for offspring to display characteristics that are not apparent in their parents? What

More information

Clinical Genomics. Ina E. Amarillo, PhD FACMGG

Clinical Genomics. Ina E. Amarillo, PhD FACMGG Clinical Genomics Ina E. Amarillo, PhD FACMGG Associate Medical Director, Cytogenetics Lab (CaTG), Lab and Genomic Medicine Assistant Professor, Pathology and Immunology Outline Clinical Genomics Testing

More information

Genetic alterations of histone lysine methyltransferases and their significance in breast cancer

Genetic alterations of histone lysine methyltransferases and their significance in breast cancer Genetic alterations of histone lysine methyltransferases and their significance in breast cancer Supplementary Materials and Methods Phylogenetic tree of the HMT superfamily The phylogeny outlined in the

More information

Copy Number Variations and Association Mapping Advanced Topics in Computa8onal Genomics

Copy Number Variations and Association Mapping Advanced Topics in Computa8onal Genomics Copy Number Variations and Association Mapping 02-715 Advanced Topics in Computa8onal Genomics SNP and CNV Genotyping SNP genotyping assumes two copy numbers at each locus (i.e., no CNVs) CNV genotyping

More information

Genetics and Diversity Punnett Squares

Genetics and Diversity Punnett Squares Genetics and Diversity Punnett Squares 1 OUTCOME QUESTION(S): S1-1-12: How are the features of the parents inherited to create unique offspring? Vocabulary & Concepts Allele Dominant Recessive Genotype

More information

Compound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com. Thursday, April 11, 13

Compound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com. Thursday, April 11, 13 Compound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com 1 Outline Recessive model Examples of Compound Heterozygosity Compound Double Heterozygosity (CDH) test 2 Recessive

More information

Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet

Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet All cancer is due to genetic mutations. However, in cancer that clusters in families (familial cancer) at least one of these mutations

More information

CHROMOSOMAL MICROARRAY (CGH+SNP)

CHROMOSOMAL MICROARRAY (CGH+SNP) Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due

More information

BIOL 109L Laboratory five Fall 2018

BIOL 109L Laboratory five Fall 2018 BIOL 109L Laboratory five Fall 2018 Understanding Genetics and Inheritance Student full name: Introduction: Chromosomes are like a set of books that provide instructions for building and operating an individual.

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Integration of transcript expression, copy number and LOH analysis of infiltrating ductal carcinoma of the breast

Integration of transcript expression, copy number and LOH analysis of infiltrating ductal carcinoma of the breast RESEARCH ARTICLE Open Access Integration of transcript expression, copy number and LOH analysis of infiltrating ductal carcinoma of the breast Lesleyann Hawthorn 1*, Jesse Luce 2, Leighton Stein 2, Jenniffer

More information

2017 Version. Key Question types NCEA Science 1.9 Genetic Variation AS 90948

2017 Version. Key Question types NCEA Science 1.9 Genetic Variation AS 90948 2017 Version Key Question types NCEA Science 1.9 Genetic Variation AS 90948 Linking DNA, Alleles and Chromosomes Chromosomes are made up of DNA. DNA is a large molecule that is coiled into a double helix

More information

Elucigene Male Factor Infertility Products Guide to Interpretation

Elucigene Male Factor Infertility Products Guide to Interpretation Elucigene Male Factor Infertility Products Guide to Interpretation Manufactured by: Elucigene Diagnostics Citylabs Nelson Street Manchester M13 9NQ For Sales, Customer Service and Technical Support:- T:

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

Mitosis and Meiosis. See Mitosis and Meiosis on the class web page

Mitosis and Meiosis. See Mitosis and Meiosis on the class web page Mitosis and Meiosis Mitosis and Cellular Reproduction. A cell s hereditary material (DNA) is located on chromosomes in the cell s nucleus. In the process called mitosis, a cell s hereditary material is

More information

VOCABULARY somatic cell autosome fertilization gamete sex chromosome diploid homologous chromosome sexual reproduction meiosis

VOCABULARY somatic cell autosome fertilization gamete sex chromosome diploid homologous chromosome sexual reproduction meiosis SECTION 6.1 CHROMOSOMES AND MEIOSIS Study Guide KEY CONCEPT Gametes have half the number of chromosomes that body cells have. VOCABULARY somatic cell autosome fertilization gamete sex chromosome diploid

More information

Genome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre

Genome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre Genome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre Structural variation (SVs) Copy-number variations C Deletion A B C Balanced rearrangements A B A B C B A C Duplication Inversion Causes

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Mutational signatures in BCC compared to melanoma.

Nature Genetics: doi: /ng Supplementary Figure 1. Mutational signatures in BCC compared to melanoma. Supplementary Figure 1 Mutational signatures in BCC compared to melanoma. (a) The effect of transcription-coupled repair as a function of gene expression in BCC. Tumor type specific gene expression levels

More information

Human Cancer Genome Project. Bioinformatics/Genomics of Cancer:

Human Cancer Genome Project. Bioinformatics/Genomics of Cancer: Bioinformatics/Genomics of Cancer: Professor of Computer Science, Mathematics and Cell Biology Courant Institute, NYU School of Medicine, Tata Institute of Fundamental Research, and Mt. Sinai School of

More information

UNIT III (Notes) : Genetics : Mendelian. (MHR Biology p ) Traits are distinguishing characteristics that make a unique individual.

UNIT III (Notes) : Genetics : Mendelian. (MHR Biology p ) Traits are distinguishing characteristics that make a unique individual. 1 UNIT III (Notes) : Genetics : endelian. (HR Biology p. 526-543) Heredity is the transmission of traits from one generation to another. Traits that are passed on are said to be inherited. Genetics is

More information

LESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2

LESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2 For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?

More information

Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters

Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii

More information

GENETIC DRIFT & EFFECTIVE POPULATION SIZE

GENETIC DRIFT & EFFECTIVE POPULATION SIZE Instructor: Dr. Martha B. Reiskind AEC 450/550: Conservation Genetics Spring 2018 Lecture Notes for Lectures 3a & b: In the past students have expressed concern about the inbreeding coefficient, so please

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

Comparative analyses of seven algorithms for copy number variant identification from single nucleotide polymorphism arrays

Comparative analyses of seven algorithms for copy number variant identification from single nucleotide polymorphism arrays Published online 8 February 2010 Nucleic Acids Research, 2010, Vol. 38, No. 9 e105 doi:10.1093/nar/gkq040 Comparative analyses of seven algorithms for copy number variant identification from single nucleotide

More information

Meiosis and Introduction to Inheritance

Meiosis and Introduction to Inheritance Meiosis and Introduction to Inheritance Instructions Activity 1. Getting Started: Build a Pair of Bead Chromosomes Materials bag labeled diploid human genome (male) bag labeled diploid human genome (female)

More information

A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single

A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single 8.3 A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single chromosome can alter their pattern of inheritance from those

More information

Take a look at the three adult bears shown in these photographs:

Take a look at the three adult bears shown in these photographs: Take a look at the three adult bears shown in these photographs: Which of these adult bears do you think is most likely to be the parent of the bear cubs shown in the photograph on the right? How did you

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Table of Contents Supplementary Materials and Methods... 1 1 Patients and control subjects for SNP genotyping... 2 1.1 Neuroblastoma patients in discovery case series... 2 1.2 Control subjects... 3 2 Whole-genome

More information

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014 Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical

More information

Clinical evaluation of microarray data

Clinical evaluation of microarray data Clinical evaluation of microarray data David Amor 19 th June 2011 Single base change Microarrays 3-4Mb What is a microarray? Up to 10 6 bits of Information!! Highly multiplexed FISH hybridisations. Microarray

More information

Lab 5: Testing Hypotheses about Patterns of Inheritance

Lab 5: Testing Hypotheses about Patterns of Inheritance Lab 5: Testing Hypotheses about Patterns of Inheritance How do we talk about genetic information? Each cell in living organisms contains DNA. DNA is made of nucleotide subunits arranged in very long strands.

More information

Determination of Genotypes from Phenotypes in Humans

Determination of Genotypes from Phenotypes in Humans Determination of Genotypes from Phenotypes in Humans NAME DATE An organism can be thought of as a large collection of phenotypes. A phenotype is the appearance of a trait and it determined by genes (genotype).

More information

Author's response to reviews

Author's response to reviews Author's response to reviews Title: Specific Gene Expression Profiles and Unique Chromosomal Abnormalities are Associated with Regressing Tumors Among Infants with Dissiminated Neuroblastoma. Authors:

More information

MCB140: Second Midterm Spring 2010

MCB140: Second Midterm Spring 2010 MCB140: Second Midterm Spring 2010 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 11 pages including this page. You will have 150 minutes

More information

Laws of Inheritance. Bởi: OpenStaxCollege

Laws of Inheritance. Bởi: OpenStaxCollege Bởi: OpenStaxCollege The seven characteristics that Mendel evaluated in his pea plants were each expressed as one of two versions, or traits. Mendel deduced from his results that each individual had two

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Human Genetics 542 Winter 2018 Syllabus

Human Genetics 542 Winter 2018 Syllabus Human Genetics 542 Winter 2018 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Jan 3 rd Wed Mapping disease genes I: inheritance patterns and linkage analysis

More information

Colorspace & Matching

Colorspace & Matching Colorspace & Matching Outline Color space and 2-base-encoding Quality Values and filtering Mapping algorithm and considerations Estimate accuracy Coverage 2 2008 Applied Biosystems Color Space Properties

More information

Chromosomal Mutations

Chromosomal Mutations Notes 2/17 Chromosomal Mutations A chromosome mutation is an unpredictable change that occurs in a chromosome. These changes are most often brought on by problems that occur during meiosis or by mutagens

More information

v Feature Stamping SMS 12.0 Tutorial Prerequisites Requirements TABS model Map Module Mesh Module Scatter Module Time minutes

v Feature Stamping SMS 12.0 Tutorial Prerequisites Requirements TABS model Map Module Mesh Module Scatter Module Time minutes v. 12.0 SMS 12.0 Tutorial Objectives In this lesson will teach how to use conceptual modeling techniques to create numerical models that incorporate flow control structures into existing bathymetry. The

More information

PSSV User Manual (V2.1)

PSSV User Manual (V2.1) PSSV User Manual (V2.1) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance The Chromosomal Basis of Inheritance Factors and Genes Mendel s model of inheritance was based on the idea of factors that were independently assorted and segregated into gametes We now know that these

More information

Name Lab 5-B. Phenotype refers to the expression (what you can see) of a person s genotype.

Name Lab 5-B. Phenotype refers to the expression (what you can see) of a person s genotype. Name Lab 5-B Lab Objectives: Define the following terms: phenotype, genotype, punnet square, autosomal, dominant and recessive, sex linked, Investigate some common phenotypes and discuss the potential

More information

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: GAIN,

More information

Introduction to Genetics and Heredity

Introduction to Genetics and Heredity Introduction to Genetics and Heredity Although these dogs have similar characteristics they are each unique! I. Early Ideas About Heredity A. The Theory of Blending Inheritance Each parent contributes

More information

Human Genetics 542 Winter 2017 Syllabus

Human Genetics 542 Winter 2017 Syllabus Human Genetics 542 Winter 2017 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Module I: Mapping and characterizing simple genetic diseases Jan 4 th Wed Mapping

More information

Meiosis and Genetics

Meiosis and Genetics Meiosis and Genetics Humans have chromosomes in each cell What pattern do you notice in the human karyotype (a technique that organizes chromosomes by type and size)? Humans are diploid 1 Gametes are produced

More information

Associating Copy Number and SNP Variation with Human Disease. Autism Segmental duplication Neurobehavioral, includes social disability

Associating Copy Number and SNP Variation with Human Disease. Autism Segmental duplication Neurobehavioral, includes social disability Technical Note Associating Copy Number and SNP Variation with Human Disease Abstract The Genome-Wide Human SNP Array 6.0 is an affordable tool to examine the role of copy number variation in disease by

More information

Copy number and somatic mutations drive tumors

Copy number and somatic mutations drive tumors Detection of copy number alterations, ploidy and loss of heterozygosity across the genome in FFPE specimens Utility for diagnosis and treatment with comparison to FISH-based and as a complement to sequencing

More information

LC480 Data Analysis of ISAV Testing at AVC

LC480 Data Analysis of ISAV Testing at AVC LC480 Data Analysis of ISAV Testing at AVC 2011 11 29 1 Understanding Sample Crossing Points* In an amplification reaction, the cycle at which the fluorescence of a sample rises above the background fluorescence

More information

v Feature Stamping SMS 13.0 Tutorial Prerequisites Requirements Map Module Mesh Module Scatter Module Time minutes

v Feature Stamping SMS 13.0 Tutorial Prerequisites Requirements Map Module Mesh Module Scatter Module Time minutes v. 13.0 SMS 13.0 Tutorial Objectives Learn how to use conceptual modeling techniques to create numerical models which incorporate flow control structures into existing bathymetry. The flow control structures

More information

Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative

Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47

More information

The Hospital Anxiety and Depression Scale Guidance and Information

The Hospital Anxiety and Depression Scale Guidance and Information The Hospital Anxiety and Depression Scale Guidance and Information About Testwise Testwise is the powerful online testing platform developed by GL Assessment to host its digital tests. Many of GL Assessment

More information

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

Answers to Questions from old quizzes and exams Problem 1A (i). a (ii) c (iii) a (iv) d

Answers to Questions from old quizzes and exams Problem 1A (i). a (ii) c (iii) a (iv) d BIOLOGY 321 SPRING 2013 ANSWERS TO ASSIGNMENT SET #2 Answers to text questions: Chapter 2 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_02.pdf Chapter 3 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_03.pdf

More information

Laboratory. Mendelian Genetics

Laboratory. Mendelian Genetics Laboratory 9 Mendelian Genetics Biology 171L FA17 Lab 9: Mendelian Genetics Student Learning Outcomes 1. Predict the phenotypic and genotypic ratios of a monohybrid cross. 2. Determine whether a gene is

More information

See pedigree info on extra sheet 1. ( 6 pts)

See pedigree info on extra sheet 1. ( 6 pts) Biol 321 Quiz #2 Spring 2010 40 pts NAME See pedigree info on extra sheet 1. ( 6 pts) Examine the pedigree shown above. For each mode of inheritance listed below indicate: E = this mode of inheritance

More information

Chapter 12 Multiple Choice

Chapter 12 Multiple Choice Chapter 12 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Gregor Mendel do to study different characteristics in his genetics experiments? a.

More information