Introduction to LOH and Allele Specific Copy Number User Forum
|
|
- Clarence Jordan
- 6 years ago
- Views:
Transcription
1 Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber
2 Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2. Merging LOH with copy number Why? Tips 3. Allele Specific Copy Number Paired vs Unpaired? Detecting Imbalance Visualization 4. Q & A
3 Data Sets used 20 paired tumor/normal samples Kindly provided by Ian Campbell, Peter MacCallum Cancer Centre Run on the Affymetrix Human SNP 6.0 Arrays 20 HapMap samples run on Illumina 1M
4 Why study alleles? Interest in copy number is based on the idea that the deletion or duplication of DNA can promote tumorigenesis Deletion of tumor suppressor genes Duplication of oncogenes Fundamentally deletion or duplication is not the important issue, its loss or amplification of functionality or mutation. If everyone was homozygous everywhere, CGH would be all we need. In the heterozygous case if one allele is deleted, or amplified, it can alter the expression of the functional or mutant phenotype.
5 Focus on heterozygosity In areas of heterozygosity we are not interested in merely CGH changes, instead we want to see how the alleles are changing There are two tools Partek lays at our disposal: LOH- Loss of Heterozygosity ASCN- Allele Specific Copy Number Fundamentally the difference is that LOH is a state. Either you are or you aren t. ASCN will be used to find magnitude and to help simplify images.
6 Data types and import To analyze for LOH Partek will require genotype calls Partek does not have a genotyping algorithm Import from CHP files or create them from within Partek for Affymetrix data Import from beadstudio project using Partek exporter for Illumina data To analyze for ASCN Partek will also require allele intensities Import CEL files into Partek for Affymetrix data Import from beadstudio project using Partek exporter for Illumina data
7 Loss of Heterozygosity What is it? Looking across many continuous markers, find genomic regions that contain stretches of SNP markers called heterozygous (AB) in the normal samples, but called homozygous (AA or BB) in the cancer samples. How is it determined? Partek uses the HMM algorithm to find these regions. Blood Tumor Normal Het LOH Homozygous: Heterozygous: LOH:
8 Why/When is a baseline needed? If you do not have paired data, then the baseline file is used to determine the expected rate of heterozygosity for each SNP This use case is not accurately described as Loss of Heterozygosity, rather it is the detection of runs of homozygosity (ROH), specifically unexpected ones But you have a baseline, right? There are baselines available download drawn from the Hapmap2. If you don t have a random mix of these populations, then the baseline won t give a good estimate of expected frequency! 0% heterozygous 50% heterozygous European Population Japanese with cancer ROH, but is it LOH? Japanese Population Common haplotype block False positive
9 LOH Paired is preferred when possible For baselines, use a normal population similar to your samples Better expected genotype frequencies Avoiding LOH due to common haplotype blocks within populations
10 LOH Set Up Dialog - Paired HMM parameters are difficult to tweak. Partek suggests taking the default parameters. A quick primer Max probability: Chance that if a probe is LOH, the next will be as well Genomic Decay: How quickly does the effect of one SNP s LOH on neighboring SNPs status decay Genotype error: Chance that the genotype call is made incorrectly
11 LOH Set Up Dialog - Unpaired Nearly the same except: Input baseline Default frequency If there is no baseline at all, or all the baseline samples were NCs this is used as default het frequency for the SNPs
12 LOH creates a segment table One row per sample per LOH region.
13 Paired LOH question Q: I ran paired LOH, and yet, in some of my LOH regions, the het rate is quite large, even when I set genotype error to 0! A: When looking for paired LOH, we look only at the SNPs that are heterozygous in the normal tissue. In long regions of normal homozygosity, LOH may be detected using just the few heterozygous SNPs. The many homozygous SNPs, due to genotyping error, may become heterozygous in the tumor sample; enough to noticeably effect the het rate in the region. If genotype error is non zero, this actually happens more rarely.
14 Common LOH Sig-Regions Number of samples and heterozygous rate is a possible filter. Automatically generated with LOH, when box is checked in setup.
15 LOH and Copy Number Overlap Using the LOH workflow, we can find regions of LOH, common LOH. Even places where LOH differs between groups with a little elbow grease. Using the copy number workflow we can find regions of amplification and deletion. Additionally we can overlap the two to find regions that intersect CN Overlap LOH
16 LOH and Copy Number Overlap When overlapping you must have the same sample IDs for the LOH analysis and the CN analysis Report is at the sample level, each region falls into one of 6 categories: Amplification, Deletion Amplification + LOH, Deletion + LOH Copy Neutral LOH Why do I care about cnloh? Because allelic imbalance can occur without alteration of chromosomal abundance. And a shift in the allelic balance within a sample can lead to phenotypic alternations.
17 Copy Neutral LOH is prevalent in Cancer 67% of LOH events in 26 pancreatic cancer cells lines occurs in regions with either copy neutral or copy gain regions Calhoun et al. Can Res : % of LOH events in cervical cell lines did not show a copy number change Kloth et al. BMC Genomics :53 56% of LOH events in glioblastomas were copy neutral Kuga et al. Neuro-oncology :995
18 Why Allele Specific copy number (AsCN)? Cancer Studies w/ primary specimens Pure normal population required Does not require paired samples or large reference population Can be run paired (recommended)
19 What is allele specific copy number? Like LOH, only pay attention to heterozygous SNPs In a heterozygous SNP, we expect balance between our two SNP calls. In fact, in diploid organisms, each SNP becomes an analogue of each allele! If we find that one of our alleles has become larger, the smaller, or both then we have imbalance. LOH is a case of severe imbalance, but in mixed tissue perfect LOH is hard to come by A B Normal LOH In between imbalance
20 Mixing Tumor & Normal Cell Lines on 50K SNP
21 Allele Specific CN The workflow
22 Allele Specific CN Setup No prebuilt references Requires normals to be included in project Normal samples do not have to come from the same experiment, if necessary, download some normal samples off GEO and merge them in
23 How does ASCN use the baseline? ASCN will only make estimates in areas of heterozygosity In paired data, areas of heterozygosity is defined by normals In unpaired data, areas of heterozygosity are defined from genotypes Yes, unpaired ASCN will have no estimates in areas of LOH as defined by the LOH workflow. They complement each other Not heterozygous areas are given? s ASCN must make an estimate of what intensity maps to 1 copy of an allele In paired data, this is the intensity of the allele in the normal samples In unpaired data, this is the average intensity of the allele in heterozygous samples
24 Allele Specific Copy Number (AsCN) Two rows per sample
25 Detect Allelic Imbalances Proportion = (Max-Min) / (Max + Min)
26 Using Imbalance to Drive Copy # Discovery Sort Descending on Proportion column in imbalance spreadsheet Max = 1.05 and Min = 0.95, then Proportion = 0.1 / 2 = 0.05 Max = 1.9 and Min = 0.1, then Proportion = 1.8 / 2 = 0.90 Large Proportion Values represent Allelic Imbalance
27 Copy Number vs Allele Specific Copy #
28 Common questions when viewing ASCN Why is the image sparse? In paired data, homozygous SNPs in the normal are not used. Its possible the region is dominantly homozygous In unpaired data, NC and homozygous SNPs in the sample are not tested. In areas of great aberration or LOH fewer calls are made. Why doesn t it always agree with the LOH? LOH uses the genotype calls. If there is a large dominance of one allele, often the region will be called as homozygous Why doesn t it always agree with copy number or allele ratio? These are all separate algorithms. While they are usually very close in most ways when they don t match up, there should still be a consistent story
29 Interplay between Copy Number Measures Amplification on p arm. Four clusters in allele ratio. Separation in AsCN
The Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0
The Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0 Introduction Loss of erozygosity (LOH) represents the loss of allelic differences. The SNP markers on the SNP Array 6.0 can be used
More informationStatistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies
Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley
More informationUnderstanding DNA Copy Number Data
Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationIntegrated Analysis of Copy Number and Gene Expression
Integrated Analysis of Copy Number and Gene Expression Nexus Copy Number provides user-friendly interface and functionalities to integrate copy number analysis with gene expression results for the purpose
More informationSupplementary note: Comparison of deletion variants identified in this study and four earlier studies
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies
More informationDetection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit
APPLICATION NOTE Ion PGM System Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit Key findings The Ion PGM System, in concert with the Ion ReproSeq PGS View Kit and Ion Reporter
More informationGene Expression Analysis Web Forum. Jonathan Gerstenhaber Field Application Specialist
Gene Expression Analysis Web Forum Jonathan Gerstenhaber Field Application Specialist Our plan today: Import Preliminary Analysis Statistical Analysis Additional Analysis Downstream Analysis 2 Copyright
More informationGENOME-WIDE ASSOCIATION STUDIES
GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE
More informationModule 3: Pathway and Drug Development
Module 3: Pathway and Drug Development Table of Contents 1.1 Getting Started... 6 1.2 Identifying a Dasatinib sensitive cancer signature... 7 1.2.1 Identifying and validating a Dasatinib Signature... 7
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationExtra Review Practice Biology Test Genetics
Mendel fill in the blanks: Extra Review Practice Biology Test Genetics Mendel was an Austrian monk who studied genetics primarily using plants. He started with plants that produced offspring with only
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationGenetics All somatic cells contain 23 pairs of chromosomes 22 pairs of autosomes 1 pair of sex chromosomes Genes contained in each pair of chromosomes
Chapter 6 Genetics and Inheritance Lecture 1: Genetics and Patterns of Inheritance Asexual reproduction = daughter cells genetically identical to parent (clones) Sexual reproduction = offspring are genetic
More informationGenetics 1. How do genes influence our characteristics?
Genetics 1 This activity will focus on the question: How do genes contribute to the similarities and differences between parents and their children? This question can be divided into two parts: How do
More informationDOES THE BRCAX GENE EXIST? FUTURE OUTLOOK
CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence
More informationWhole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis
HMG Advance Access published December 21, 2012 Human Molecular Genetics, 2012 1 13 doi:10.1093/hmg/dds512 Whole-genome detection of disease-associated deletions or excess homozygosity in a case control
More informationUTILIZATION OF A SNP MICROARRAY FOR CHRONIC LYMPHOCYTIC LEUKEMIA: EFFICACY, INFORMATIVE FINDINGS AND PROGNOSTIC CAPABILITIES
UTILIZATION OF A SNP MICROARRAY FOR CHRONIC LYMPHOCYTIC LEUKEMIA: EFFICACY, INFORMATIVE FINDINGS AND PROGNOSTIC CAPABILITIES S Schwartz, Z Hosseini, S Schepis, P Papenhausen Laboratory Corporation of America
More informationCITATION FILE CONTENT/FORMAT
CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined
More informationComputational Systems Biology: Biology X
Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH
More informationPedigree Construction Notes
Name Date Pedigree Construction Notes GO TO à Mendelian Inheritance (http://www.uic.edu/classes/bms/bms655/lesson3.html) When human geneticists first began to publish family studies, they used a variety
More informationMultiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016
Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics
More informationMendelian Genetics and Beyond Chapter 4 Study Prompts
Mendelian Genetics and Beyond Chapter 4 Study Prompts 1. What is a mode of inheritance? 2. Can you define the following? a. Autosomal dominant b. Autosomal recessive 3. Who was Gregor Mendel? 4. What did
More informationExercises: Differential Methylation
Exercises: Differential Methylation Version 2018-04 Exercises: Differential Methylation 2 Licence This manual is 2014-18, Simon Andrews. This manual is distributed under the creative commons Attribution-Non-Commercial-Share
More informationComprehensive performance comparison of high-resolution array platforms for genome-wide Copy Number Variation (CNV) analysis in humans
Haraksingh et al. BMC Genomics (2017) 18:321 DOI 10.1186/s12864-017-3658-x RESEARCH ARTICLE Comprehensive performance comparison of high-resolution array platforms for genome-wide Copy Number Variation
More informationChromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011
Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,
More informationVega: Variational Segmentation for Copy Number Detection
Vega: Variational Segmentation for Copy Number Detection Sandro Morganella Luigi Cerulo Giuseppe Viglietto Michele Ceccarelli Contents 1 Overview 1 2 Installation 1 3 Vega.RData Description 2 4 Run Vega
More informationNature Methods: doi: /nmeth.3115
Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationTumor suppressor genes D R. S H O S S E I N I - A S L
Tumor suppressor genes 1 D R. S H O S S E I N I - A S L What is a Tumor Suppressor Gene? 2 A tumor suppressor gene is a type of cancer gene that is created by loss-of function mutations. In contrast to
More informationIdentification of regions with common copy-number variations using SNP array
Identification of regions with common copy-number variations using SNP array Agus Salim Epidemiology and Public Health National University of Singapore Copy Number Variation (CNV) Copy number alteration
More informationFamily Trees for all grades. Learning Objectives. Materials, Resources, and Preparation
page 2 Page 2 2 Introduction Family Trees for all grades Goals Discover Darwin all over Pittsburgh in 2009 with Darwin 2009: Exploration is Never Extinct. Lesson plans, including this one, are available
More informationCNV PCA Search Tutorial
CNV PCA Search Tutorial Release 8.1 Golden Helix, Inc. March 18, 2014 Contents 1. Data Preparation 2 A. Join Log Ratio Data with Phenotype Information.............................. 2 B. Activate only
More informationCS2220 Introduction to Computational Biology
CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS
More informationHematopathology Service Memorial Sloan Kettering Cancer Center, New York
SH2017-0334 t(14;18) Negative Follicular Lymphoma with 1p36 abnormality associated with In Situ Follicular Neoplasia with t(14;18) translocation Pallavi Khattar MD, Jennifer Maerki MD, Alexander Chan MD,
More informationUnit 5: Genetics Notes
Unit 5: Genetics Notes https://goo.gl/fgtzef Name: Period: Test Date: Table of Contents Title of Page Page Number Date Warm-ups 3-4 Mendelian Genetics Notes 5-6 Mendelian Genetics Lets Practice 7 Monohybrid
More informationPedigree Analysis Why do Pedigrees? Goals of Pedigree Analysis Basic Symbols More Symbols Y-Linked Inheritance
Pedigree Analysis Why do Pedigrees? Punnett squares and chi-square tests work well for organisms that have large numbers of offspring and controlled mating, but humans are quite different: Small families.
More information1 eye 1 Set of trait cards. 1 tongue 1 Sheet of scrap paper
Access prior knowledge Why do offspring often resemble their parents? Yet rarely look exactly alike? Is it possible for offspring to display characteristics that are not apparent in their parents? What
More informationClinical Genomics. Ina E. Amarillo, PhD FACMGG
Clinical Genomics Ina E. Amarillo, PhD FACMGG Associate Medical Director, Cytogenetics Lab (CaTG), Lab and Genomic Medicine Assistant Professor, Pathology and Immunology Outline Clinical Genomics Testing
More informationGenetic alterations of histone lysine methyltransferases and their significance in breast cancer
Genetic alterations of histone lysine methyltransferases and their significance in breast cancer Supplementary Materials and Methods Phylogenetic tree of the HMT superfamily The phylogeny outlined in the
More informationCopy Number Variations and Association Mapping Advanced Topics in Computa8onal Genomics
Copy Number Variations and Association Mapping 02-715 Advanced Topics in Computa8onal Genomics SNP and CNV Genotyping SNP genotyping assumes two copy numbers at each locus (i.e., no CNVs) CNV genotyping
More informationGenetics and Diversity Punnett Squares
Genetics and Diversity Punnett Squares 1 OUTCOME QUESTION(S): S1-1-12: How are the features of the parents inherited to create unique offspring? Vocabulary & Concepts Allele Dominant Recessive Genotype
More informationCompound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com. Thursday, April 11, 13
Compound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com 1 Outline Recessive model Examples of Compound Heterozygosity Compound Double Heterozygosity (CDH) test 2 Recessive
More informationGenome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet
Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet All cancer is due to genetic mutations. However, in cancer that clusters in families (familial cancer) at least one of these mutations
More informationCHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
More informationBIOL 109L Laboratory five Fall 2018
BIOL 109L Laboratory five Fall 2018 Understanding Genetics and Inheritance Student full name: Introduction: Chromosomes are like a set of books that provide instructions for building and operating an individual.
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationIntegration of transcript expression, copy number and LOH analysis of infiltrating ductal carcinoma of the breast
RESEARCH ARTICLE Open Access Integration of transcript expression, copy number and LOH analysis of infiltrating ductal carcinoma of the breast Lesleyann Hawthorn 1*, Jesse Luce 2, Leighton Stein 2, Jenniffer
More information2017 Version. Key Question types NCEA Science 1.9 Genetic Variation AS 90948
2017 Version Key Question types NCEA Science 1.9 Genetic Variation AS 90948 Linking DNA, Alleles and Chromosomes Chromosomes are made up of DNA. DNA is a large molecule that is coiled into a double helix
More informationElucigene Male Factor Infertility Products Guide to Interpretation
Elucigene Male Factor Infertility Products Guide to Interpretation Manufactured by: Elucigene Diagnostics Citylabs Nelson Street Manchester M13 9NQ For Sales, Customer Service and Technical Support:- T:
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationMitosis and Meiosis. See Mitosis and Meiosis on the class web page
Mitosis and Meiosis Mitosis and Cellular Reproduction. A cell s hereditary material (DNA) is located on chromosomes in the cell s nucleus. In the process called mitosis, a cell s hereditary material is
More informationVOCABULARY somatic cell autosome fertilization gamete sex chromosome diploid homologous chromosome sexual reproduction meiosis
SECTION 6.1 CHROMOSOMES AND MEIOSIS Study Guide KEY CONCEPT Gametes have half the number of chromosomes that body cells have. VOCABULARY somatic cell autosome fertilization gamete sex chromosome diploid
More informationGenome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre
Genome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre Structural variation (SVs) Copy-number variations C Deletion A B C Balanced rearrangements A B A B C B A C Duplication Inversion Causes
More informationNature Genetics: doi: /ng Supplementary Figure 1. Mutational signatures in BCC compared to melanoma.
Supplementary Figure 1 Mutational signatures in BCC compared to melanoma. (a) The effect of transcription-coupled repair as a function of gene expression in BCC. Tumor type specific gene expression levels
More informationHuman Cancer Genome Project. Bioinformatics/Genomics of Cancer:
Bioinformatics/Genomics of Cancer: Professor of Computer Science, Mathematics and Cell Biology Courant Institute, NYU School of Medicine, Tata Institute of Fundamental Research, and Mt. Sinai School of
More informationUNIT III (Notes) : Genetics : Mendelian. (MHR Biology p ) Traits are distinguishing characteristics that make a unique individual.
1 UNIT III (Notes) : Genetics : endelian. (HR Biology p. 526-543) Heredity is the transmission of traits from one generation to another. Traits that are passed on are said to be inherited. Genetics is
More informationLESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2
For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?
More informationNext Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii
More informationGENETIC DRIFT & EFFECTIVE POPULATION SIZE
Instructor: Dr. Martha B. Reiskind AEC 450/550: Conservation Genetics Spring 2018 Lecture Notes for Lectures 3a & b: In the past students have expressed concern about the inbreeding coefficient, so please
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationComparative analyses of seven algorithms for copy number variant identification from single nucleotide polymorphism arrays
Published online 8 February 2010 Nucleic Acids Research, 2010, Vol. 38, No. 9 e105 doi:10.1093/nar/gkq040 Comparative analyses of seven algorithms for copy number variant identification from single nucleotide
More informationMeiosis and Introduction to Inheritance
Meiosis and Introduction to Inheritance Instructions Activity 1. Getting Started: Build a Pair of Bead Chromosomes Materials bag labeled diploid human genome (male) bag labeled diploid human genome (female)
More informationA gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single
8.3 A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single chromosome can alter their pattern of inheritance from those
More informationTake a look at the three adult bears shown in these photographs:
Take a look at the three adult bears shown in these photographs: Which of these adult bears do you think is most likely to be the parent of the bear cubs shown in the photograph on the right? How did you
More informationSUPPLEMENTARY INFORMATION
Table of Contents Supplementary Materials and Methods... 1 1 Patients and control subjects for SNP genotyping... 2 1.1 Neuroblastoma patients in discovery case series... 2 1.2 Control subjects... 3 2 Whole-genome
More informationChallenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
More informationClinical evaluation of microarray data
Clinical evaluation of microarray data David Amor 19 th June 2011 Single base change Microarrays 3-4Mb What is a microarray? Up to 10 6 bits of Information!! Highly multiplexed FISH hybridisations. Microarray
More informationLab 5: Testing Hypotheses about Patterns of Inheritance
Lab 5: Testing Hypotheses about Patterns of Inheritance How do we talk about genetic information? Each cell in living organisms contains DNA. DNA is made of nucleotide subunits arranged in very long strands.
More informationDetermination of Genotypes from Phenotypes in Humans
Determination of Genotypes from Phenotypes in Humans NAME DATE An organism can be thought of as a large collection of phenotypes. A phenotype is the appearance of a trait and it determined by genes (genotype).
More informationAuthor's response to reviews
Author's response to reviews Title: Specific Gene Expression Profiles and Unique Chromosomal Abnormalities are Associated with Regressing Tumors Among Infants with Dissiminated Neuroblastoma. Authors:
More informationMCB140: Second Midterm Spring 2010
MCB140: Second Midterm Spring 2010 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 11 pages including this page. You will have 150 minutes
More informationLaws of Inheritance. Bởi: OpenStaxCollege
Bởi: OpenStaxCollege The seven characteristics that Mendel evaluated in his pea plants were each expressed as one of two versions, or traits. Mendel deduced from his results that each individual had two
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationHuman Genetics 542 Winter 2018 Syllabus
Human Genetics 542 Winter 2018 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Jan 3 rd Wed Mapping disease genes I: inheritance patterns and linkage analysis
More informationColorspace & Matching
Colorspace & Matching Outline Color space and 2-base-encoding Quality Values and filtering Mapping algorithm and considerations Estimate accuracy Coverage 2 2008 Applied Biosystems Color Space Properties
More informationChromosomal Mutations
Notes 2/17 Chromosomal Mutations A chromosome mutation is an unpredictable change that occurs in a chromosome. These changes are most often brought on by problems that occur during meiosis or by mutagens
More informationv Feature Stamping SMS 12.0 Tutorial Prerequisites Requirements TABS model Map Module Mesh Module Scatter Module Time minutes
v. 12.0 SMS 12.0 Tutorial Objectives In this lesson will teach how to use conceptual modeling techniques to create numerical models that incorporate flow control structures into existing bathymetry. The
More informationPSSV User Manual (V2.1)
PSSV User Manual (V2.1) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant
More informationThe Chromosomal Basis of Inheritance
The Chromosomal Basis of Inheritance Factors and Genes Mendel s model of inheritance was based on the idea of factors that were independently assorted and segregated into gametes We now know that these
More informationName Lab 5-B. Phenotype refers to the expression (what you can see) of a person s genotype.
Name Lab 5-B Lab Objectives: Define the following terms: phenotype, genotype, punnet square, autosomal, dominant and recessive, sex linked, Investigate some common phenotypes and discuss the potential
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: GAIN,
More informationIntroduction to Genetics and Heredity
Introduction to Genetics and Heredity Although these dogs have similar characteristics they are each unique! I. Early Ideas About Heredity A. The Theory of Blending Inheritance Each parent contributes
More informationHuman Genetics 542 Winter 2017 Syllabus
Human Genetics 542 Winter 2017 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Module I: Mapping and characterizing simple genetic diseases Jan 4 th Wed Mapping
More informationMeiosis and Genetics
Meiosis and Genetics Humans have chromosomes in each cell What pattern do you notice in the human karyotype (a technique that organizes chromosomes by type and size)? Humans are diploid 1 Gametes are produced
More informationAssociating Copy Number and SNP Variation with Human Disease. Autism Segmental duplication Neurobehavioral, includes social disability
Technical Note Associating Copy Number and SNP Variation with Human Disease Abstract The Genome-Wide Human SNP Array 6.0 is an affordable tool to examine the role of copy number variation in disease by
More informationCopy number and somatic mutations drive tumors
Detection of copy number alterations, ploidy and loss of heterozygosity across the genome in FFPE specimens Utility for diagnosis and treatment with comparison to FISH-based and as a complement to sequencing
More informationLC480 Data Analysis of ISAV Testing at AVC
LC480 Data Analysis of ISAV Testing at AVC 2011 11 29 1 Understanding Sample Crossing Points* In an amplification reaction, the cycle at which the fluorescence of a sample rises above the background fluorescence
More informationv Feature Stamping SMS 13.0 Tutorial Prerequisites Requirements Map Module Mesh Module Scatter Module Time minutes
v. 13.0 SMS 13.0 Tutorial Objectives Learn how to use conceptual modeling techniques to create numerical models which incorporate flow control structures into existing bathymetry. The flow control structures
More informationAssociation mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative
Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47
More informationThe Hospital Anxiety and Depression Scale Guidance and Information
The Hospital Anxiety and Depression Scale Guidance and Information About Testwise Testwise is the powerful online testing platform developed by GL Assessment to host its digital tests. Many of GL Assessment
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationAnswers to Questions from old quizzes and exams Problem 1A (i). a (ii) c (iii) a (iv) d
BIOLOGY 321 SPRING 2013 ANSWERS TO ASSIGNMENT SET #2 Answers to text questions: Chapter 2 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_02.pdf Chapter 3 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_03.pdf
More informationLaboratory. Mendelian Genetics
Laboratory 9 Mendelian Genetics Biology 171L FA17 Lab 9: Mendelian Genetics Student Learning Outcomes 1. Predict the phenotypic and genotypic ratios of a monohybrid cross. 2. Determine whether a gene is
More informationSee pedigree info on extra sheet 1. ( 6 pts)
Biol 321 Quiz #2 Spring 2010 40 pts NAME See pedigree info on extra sheet 1. ( 6 pts) Examine the pedigree shown above. For each mode of inheritance listed below indicate: E = this mode of inheritance
More informationChapter 12 Multiple Choice
Chapter 12 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Gregor Mendel do to study different characteristics in his genetics experiments? a.
More information