SALSA MLPA KIT P050-B2 CAH

Transcription

1 SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to previous lots. CONGENITAL ADRENAL HYPERPLASIA (CAH) results from a deficiency in one of the enzymes involved in cortisol biosynthesis. CAH affects about 1 in 5,000 births, with a carrier frequency of 1 in 35. As a result of defective cortisol synthesis, ACTH levels increase, resulting in overproduction and accumulation of cortisol precursors. This causes excessive production of adrenal androgens from early fetal life, resulting in virilization. In about 95% of cases, CAH is caused by deficiency of the 21-hydroxylating enzyme encoded by the CYP21A2 (CYP21) gene on chromosome 6p21.3. Other genes near CYP21A2 include the inactive pseudogene CYP21A1P (=CYP21P), the complement C4A, C4B, TNXB (Tenascin-XB) and its pseudogene TNXA. TNXA is a small duplicated part of the TNXB gene. Interestingly, the sequences of CYP21A2, CYP21A1P, C4A and C4B are almost identical. Orientation of genes from the 6p telomere to the centromere is as follows: C4A- CYP21A1P-TNXA-C4B-CYP21A2-TNXB-ATF6B(CREBL1). CAH due to 21-hydroxylase deficiency is unusual among genetic diseases in that approximately 95% of the mutant alleles are due to the recombination between a gene (CYP21A2) and its pseudogene (CYP21A1P). Approximately 20% of mutant alleles have DNA deletions of 30 kb that have been generated by unequal meiotic crossing-over, whereas 75% are gene conversions of deleterious mutations normally present in CYP21A1P which have been transferred to CYP21A2 (White and Speiser, 2000).. The P050 CAH probemix is designed to detect large deletions and large gene conversions in the CYP21A2, C4 and TNXB genes on 6p21.3. This P050-B2 CAH probemix contains 5 probes for CYP21A2 (exons 1, 3, 4, 6 and 8); among these are the 8 bp deletion, I172N, Cluster E6 and Q318X mutation. Furthermore, this P050-B2 CAH probemix contains 3 CYP21A1P-specific probes, 3 TNXB probes, 1 C4A probe, 1 C4B probe, and 1 probe for the CREBL1 gene located q-telomeric of TNXB. In addition, 2 other probes located on chromosome 6p21.3, 1 Y-chromosome specific probe (UTY gene) and 16 reference probes are included. This SALSA MLPA kit is designed to detect deletions/duplications of one or more exons of the aforementioned genes. Heterozygous deletions of recognition sequences should give a 35-50% reduced relative peak area of the amplification product of that probe. Note that a mutation or polymorphism in the sequence detected by a probe can also cause a reduction in relative peak area, even when not located exactly on the ligation site! In addition, some probe signals are more sensitive to sample purity and small changes in experimental conditions. Therefore, deletions and duplications detected by MLPA should always be confirmed by other methods. Not all deletions and duplications detected by MLPA will be pathogenic; users should always verify the latest scientific literature when interpreting their findings. Finally, note that most defects in this gene are expected to be small mutations which will not be detected by this MLPA test. SALSA kits are sold by for research purposes and to demonstrate the possibilities of the MLPA technique. This kit is not CE/FDA certified for use in diagnostic procedures. SALSA MLPA kits are supplied with all necessary buffers and enzymes. Purchase of the SALSA MLPA test kits includes a limited license to use these products for research purposes. The use of this MLPA kit requires a thermocycler with heated lid and sequence type electrophoresis equipment. Different fluorescent PCR primers are available. The MLPA technique has been first described in Nucleic Acid Research 30, e57 (2002). Related SALSA MLPA kits P155 Ehlers-Danlos syndrome III & IV: contains probes for COL3A1, TNXB More information Website : info@mlpa.com (information & technical questions); order@mlpa.com (for orders) Mail : bv; Willem Schoutenstraat 6, 1057 DN Amsterdam, the Netherlands SALSA kit P050 CAH Page 1 of 6

2 P050 genes The TNXB gene spans 80 kb and has at least 43 exons. Disruption of both copies of TNXB is the cause of a recessive form of the Ehlers-Danlos syndrome (MIM ). Haploinsufficiency of the TNXB gene can cause the hypermobility type of Ehlers-Danlos syndrome (Zweers et al. 2003). The C4A and C4B genes both encode a functional complement protein. C4A is usually approximately 22 kb long, whereas the C4B gene is polymorphic in size, either 22 or 16 kb, due to the presence/absence of a 6 kb intron. The 2 proteins differ by only 4 amino acids. The A stands for the acidic version, the B for the basic version. About half of the rare C4A + C4B null genes are the result of DNA deletions, which can extend into the CYP21A2 gene. Null alleles of either the C4A or C4B loci are however very common, occurring in about 10 to 16% of unaffected people respectively. It has been reported that homozygous deficiency of C4A is associated with systemic lupus erythematosus and with type I diabetes mellitus; homozygous deficiency of C4B is associated with susceptibility to bacterial meningitis. The usual copy number in the white population of C4A + C4B is between 2 and 6 copies per cell. This diversity may be related to different intrinsic strengths among humans to defend themselves against infections and susceptibility to autoimmune diseases. Studies show that the frequency of the C4B null allele in young and old men is 17.6 and 3.4% respectively; suggesting the C4B null allele may be a negative factor for survival. Figure 1: A schematic representation of the chromosome 6p21.3 region. Data analysis The P050-B2 probemix contains 33 different MLPA probes with amplification products between 130 and 391 nt. In addition, it contains 9 control fragments generating an amplification product smaller than 120 nt: four DNA Quantity fragments (Q-fragments) at nt, three DNA denaturation control fragments (Dfragments) at nt, one X-fragment at 100 nt and one Y-fragment at 105 nt. More information on how to interpret observations on these control fragments can be found in the MLPA protocol. Data generated by this probemix can first be normalised intra-sample by dividing the peak area of each probe s amplification product by the total area of only the reference probes in this probemix (block normalisation). Secondly, inter-sample normalisation can be achieved by dividing the intra-normalised probe ratio in a sample by the average intra-normalised probe ratio of all reference samples. Please note that this type of normalisation assumes no changes occurred in the genomic regions recognised by the reference probes. Data normalisation should be performed within one experiment. Only samples purified by the same method should be compared. Confirmation of most exons deletions and amplifications can be done by e.g. Southern blotting, long range PCR, qpcr, FISH. Note that Coffalyser, the MLPA analysis tool developed at, can be downloaded free of charge from our website This probemix was developed by A.O.H. Nygren and J.P. Schouten at. In case the results obtained with this probemix lead to a scientific publication, it would be very much appreciated if the first probemix designer could be made a coauthor. Info/remarks/suggestions for improvement: info@mlpa.com. SALSA kit P050 CAH Page 2 of 6

3 Table 1. SALSA MLPA P050-B2 CAH probemix Length Chromosomal position SALSA MLPA probe (nt) Reference Other CAH Q-fragments: DNA quantity; only visible with less than 100 ng sample DNA D-fragments: Low signal of 88 or 96 nt fragment indicates incomplete denaturation 100 X-fragment: Specific for the X chromosome 105 Y-fragment: Specific for the Y chromosome 130 Reference probe L q LTA probe L p Reference probe L q Reference probe L q ± C4B probe L02586 C4B Exon ± Reference probe L p Reference probe L q * CYP21A2 probe L01507 Exon C4A probe L04177 C4A Exon Reference probe L q Reference probe L p CYP21A2 probe L04179 Exon CYP21A2 probe L01508 Exon Reference probe L p CYP21A2 probe L01509 Exon UTY probe L00464 Yq Reference probe L q Reference probe L q CYP21A1P(=CYP21P) probe L exon Reference probe L p CYP21A2 probe L04895 Exon TNXB probe L01515 Exon Reference probe L q TNXB probe L02588 Exon TNXB probe L01513 Exon Reference probe L q ATF6B probe (CREBL1) L01512 ATF6B 346 BAK probe L p CYP21A2P(=CYP21P) probe L04182 Exon ± Reference probe L p Reference probe L p ± CYP21A1P(=CYP21P) probe L04181 Intron Reference probe L q26 ± The 154 nt C4B probe, 160 nt and 364 nt reference probes and 382 nt CYP21A1P probe have been reported to be more variable. * The 172 nt probe can give false deletions as a SNP exists under the first G of the target sequence (underlined and bold in the sequence in the next table). The probe could also be influenced by the 8bp deletion located in exon 3. The 178 nt probe may be less reliable. The 210 nt CYP21A2 probe has been reported to detect the mutation I172N. The 229 nt and 283 nt probes could be influenced by the exon 6 mutation cluster. The 283 nt probe is influenced by a mutation in the pseudogene (mutation Q318X; 1996C>T) which can cause false duplications. Always confirm a single exon change by another method. The signal of the 274 reference probe is higher in lot 0510 than in previous lots. SALSA kit P050 CAH Page 3 of 6

4 Please note The C4A-C4B region has been found to be very variable. Teisberg et al. (1988) studied RFLP patterns in the C4 gene region, determining C4 haplotype pattern and C4 gene number. Among 76 haplotypes, 12 had 1 C4 gene, 58 had 2 C4 genes, and 6 had 3 C4 genes. All probes specific to the 6p21 region (but outside the 6p21.3 region) should not be used as reference probe since larger genomic rearrangements are known to occur within this region. Exon numbering might be different as compared to literature! Please notify us of any mistakes. The identity of the genes detected by the control probes is available on request: info@mlpa.com. Table 2. 6p21.3 specific probes arranged according to chromosomal location Length (nt) SALSA MLPA probe Exon L04177 C4A Exon L L L04894 CYP21A1P 5 Exon 1 CYP21A1P Intron 2 CYP21A1P Exon L02586 C4B Exon L L01507 Wildtype of exon 3 Delta 8 bp L01508 Wildtype of I172N mutation L01509 Wildtype of exon 6 cluster L04895 Wildtype of Q318X CYP21A2, 18 nt before exon 1, reverse CYP21A2 Exon 3 CYP21A2 Exon 4 CYP21A2 Exon 6 CYP21A2 Exon L01515 TNXB Exon L02588 TNXB Exon L01513 TNXB Exon L01512 ATF6B Exon 1 Complete Probe Target Sequences CCAGGACCCCTGTCCAGTGTTAGA- CAGGAGCATGCAGGGGGGTTTGGTGGGCAAT CCCAGGTCGGGGCGGACACCC- TTGCCTGCACGGGTGATGTGGAACCAGAAAG GGAAGCTCTTGGGGGGCATATCTTC- AGGAGAAGAAGCAGGTGTTGAGGAGGCAGAAGAAGGTC GGATTAAGCCTCAATCCTCTGCGGCA- GAGGGTCAGGAAGGGAGCTCTGCGGGGAG AAGGCCCCTGCGGACCTGCG- GGGTGTTGCCCACAACAACCTCATGGCAATGGCC CTTGACCCCACCTTCAGGTACCC -TCCCACCGACCCGCCCACAGAGTGGCCCTTTTCT CCCGGACCTGTCCTTGGGAGACT- ACTCCCTGCTCTGGAAAGCCCACAAGAAGCTCACCCGC CTCTCTCCTCACCTGCAGCATCAT- CTGTTACCTCACCTTCGGAGACAAGATCAAGGTGCCTCACAG CCCC GCAGGCCATAGAGAAGAGGGATCACAT- CGTGGAGATGCAGCTGAGGCAGCACAAGGTGGGACTGTA TCCCCAGATTCAGCAGCGACTGC- AGGAGGAGCTAGACCACGAACTGGGCCCTGGTGC CGTGGCTGAGGAGACCTCCAGCTCTCT- GCGCCTGTCCTGGACGGTAGCCCAGGGCCCCTTT CAGGCCAGTTCGACTCTTTTGTGGTCCAGTT- CAAGGACAAAGACGGGCCCCAGGTGGTGCCCGT GACGCCGCCCTCCCGGGGTT- GGGGACAGAGCAGGTGCAGAGGCACTGCAGCTGCTCG CGCGTTTCTTCACCGACAACCTGCTT- AGCCCGGAGGACTGGGGTCTGCAGAGTGAGGCAC Distance to next probe Note: Exon numbering used here may differ from literature! Complete probe sequences are available on request: info@mlpa.com. Please notify us of any mistakes: info@mlpa.com kb 0.8 kb 2.6 kb 20.0 kb 9.5 kb 0.8 kb 0.3 kb 0.3 kb 0.3 kb 6 kb 23.9 kb 38.0 kb 18.9 kb SALSA kit P050 CAH Page 4 of 6

5 SALSA MLPA kit P050-B2 CAH sample pictures , , ,36 164,66 159,27 192,45 220,25 256,35 247, ,72 91,39 133,37 152,78 170,32 177,34 201,51 209,65 282,47 299, ,43 85,94 100,88 139,99 183,93 229,31 239,31 264,32 335,87 318,45 292,98 308,50 373,89 345,11 363,31 327,60 351,18 390, , Dye Signal Size (nt) Figure 2. Capillary electrophoresis pattern from a sample of approximately 50 ng human male control DNA analyzed with SALSA MLPA kit P050-B2 CAH (lot 0510) , , ,93 128,41 152,85 164,73 159,31 192,50 220,24 256,30 247,65 170,38 209, ,99 91,44 96,53 133,43 140,07 177,40 183,98 201,55 229,31 264,26 299,33 282,43 318,45 292,92 308,53 335,89 351,23 363,36 373,91 327,61 345, ,60 390, Dye Signal Size (nt) Figure 3. Capillary electrophoresis pattern from a sample of approximately 50 ng human female control DNA analyzed with SALSA MLPA kit P050-B2 CAH (lot 0510). SALSA kit P050 CAH Page 5 of 6

6 Figure 4. Top: schematic representation of the 6p21.3 region. Double-headed arrows indicate the extent of deletions identified by MLPA. Bottom: Capillary electrophoresis pattern of four DNA samples analysed with the P050 CAH kit (lot 1005). a) male reference DNA; b) male CAH patient carrying a homozygous deletion of C4B and CYP21A2; c) male CAH patient carrying a homozygous deletion spanning exon 1-6 of CYP21A2; d) female with a homozygous deletion of C4A and CYP21A1P. 1, 3, 4, 6, 8 and 10 are peaks corresponding to the respective exons of CYP21A2. P1, P2 are CYP21A1P-specific probes; T1, T2, T3 are specific to TNXB; C4A and C4B to corresponding genes. Implemented Changes compared to the previous product description version. Version 25 (46) - Product description adapted to a new lot (lot number added, small changes in Table 1 and 2, new picture included). - Small changes of probe lengths in Table 1 and 2 in order to better reflect the true lengths of the amplification products. Version 24 (43) - Altered product description to incorporate a new lot (lot number added, new picture included). - Small textual changes made on page 1. - Notes added for the 364 nt and 211 nt probes on page 3, Table 1. Version 23 - The text This SALSA MLPA kit is designed on page 1 has been modified. - Several textual changes have been made to Table 2. - The CREBL1 gene name has changed to ATF6B. - Warnings have been added for 154,160, 172,178 and 382 nt probes on page 3, Table 1. - Tables have been numbered. - Data analysis method has been modified. SALSA kit P050 CAH Page 6 of 6