DEFECT DENSITY METRICS

Size: px
Start display at page:

Download "DEFECT DENSITY METRICS"

Transcription

1 1 DEFECT DENSITY METRICS

2 Defect density is a measure of the total known defects divided by the size of the software entity being measured. Estimated because defects are found throughout the entire life-cycle of the product Important for cost and resource estimates for the maintenance phase of the life cycle 2

3 The Number of Known Defects is the count of total defects identified against a particular software entity, during a particular time period. Examples include: The period might be for one of the following: for a duration (say, the first month, the quarter, or the year). Defect to date since the creation of module Defects found in a program during an inspection Defects to date since the shipment of a release to the customer for each phase of the software life cycle. for the whole of the software life cycle 3

4 Size is a normalize that allows comparisons between different software entities (i.e., modules, releases, products). Size is typically counted either in Lines of Code (LOC) or Function Points. 4

5 DEFECT DENSITY USES Defect Density is used to compare the relative number of defects in various software components. This helps identify candidates for additional inspection or testing or for possible reengineering or replacement. Identifying defect components allows the concentration of limited resources into areas with the highest potential return on the investment. 5

6 DEFECT DENSITY USES Another use for Defect Density is to compare subsequent releases of a product to track the impact of defect reduction and quality improvement activities. 6

7 DEFECT DENSITY ISSUES (1) There is no general consensus on: - What constitutes a defect - How to measure SW size (2) Defect Density is a product measure but it is derived from the process of finding defects. - May say more about quality of defect finding and reporting, than about the quality of the product itself (3) Should measure number of defects with respect to time (e.g.mtbf) rather than product size 7

8 DEFECT DENSITY CAUTIONS Even if we knew the exact number of residual faults in a system, it is still: - Difficult to determine in advance the seriousness of a fault - There is much variability in the way the system is used by different users; a system is not always used as expected 8

9 More specific Defect Density (rate) = number of defects / opportunities for errors during a specified time Number of defects can be approximated as equal to the number of unique causes of observed failures Opportunities for error can be expressed as KLOC Time frame (life of product or LOP) varies 9

10 Defect Density Example Product is one year old, and is 10 KLOC Unique causes of observed failures = 50 Current Defect Density = 50/10K = 5 defects per KLOC per year After second year Unique causes of observed failures = 75 Current Defect Density = 75 / 10K = 7.5 defects per KLOC per 2year or 3.75 per KLOC per year 10

11 Timeframes must be the same Cannot compare (current) defect rate for a one year old product to the (current) defect rate of a four year old product IBM considers life of product to be 4 years Must account for new and modified code in LOC count (otherwise metric is skewed) LOC counting must remain consistent 11

12 Measuring LOC Comparison Issues How LOC is calculated Count only executable lines Count executable lines, plus data definitions Count executable lines, plus data definitions, plus comments Count physical lines Count logical lines (terminated by ; ) Normalising quality/productivity metrics considering size Size usually LOC, KLOC, or Pages of Documentation Defects per KLOC $ per LOC Pages of documentation per KLOC LOC per person-month $ per page of documentation 12

13 At IBM, the following LOC count metrics, based on logical LOC, are used: (1) Shipped Source Instructions (SSI): LOC count for the total product (2) Changed Source Instructions (CSI): LOC count for the new and changed code of the new release. The relationship between SSI and CSI is given by: SSI (current release) = SSI (previous release) + CSI (new and changed code instructions for current release) - deleted code (usually very small) - changed code (to avoid double count in both SSI & CSI) Defects can be field defects (found by customers), or internal defects (found internally).

14 We are about to launch the third release of an inventory management software system. - The size of the initial release was 50 KLOC, with a defect density of 2.0 def/kssi - In the second release, 20KLOC of code was newly added or modified (20% of which are changed lines of code, with no deleted code ). - In the third release, 30KLOC of code was newly added or modified (20% of which are changed lines of code, with no deleted code ). Assume that the LOC counts are based on source instructions (SSI/CSI). (a) Considering that the quality goal of the company has been to achieve 10% improvement in overall defect rates from release-torelease, calculate the total number of additional defects for the third release. (b) What should be the maximum (overall) defect rate target for the third release to ensure that the number of new defects does not exceed that of the second release.

Defect Removal Metrics. SE 350 Software Process & Product Quality 1

Defect Removal Metrics. SE 350 Software Process & Product Quality 1 Defect Removal Metrics 1 Objectives Understand some basic defect metrics and the concepts behind them Defect density metrics Defect detection and removal effectiveness etc. Look at the uses and limitations

More information

Instruction Manual Aerogen, Inc. Part No. AG-AL1010 Rev. C

Instruction Manual Aerogen, Inc. Part No. AG-AL1010 Rev. C Instruction Manual 2004 Aerogen, Inc. Part No. AG-AL1010 Rev. C Table of Contents Introduction... 3 System description... 4 Warnings... 5 Cautions... 5 Electromagnetic Susceptibility... 5 Symbols... 6

More information

Refactoring for Changeability: A way to go?

Refactoring for Changeability: A way to go? Refactoring for Changeability: A way to go? B. Geppert, A. Mockus, and F. Roessler {bgeppert, audris, roessler}@avaya.com Avaya Labs Research Basking Ridge, NJ 07920 http://www.research.avayalabs.com/user/audris

More information

Defect Removal. RIT Software Engineering

Defect Removal. RIT Software Engineering Defect Removal Agenda Setting defect removal targets Cost effectiveness of defect removal Matching to customer & business needs and preferences Performing defect removal Techniques/approaches/practices

More information

Goal-Oriented Measurement plus System Dynamics A Hybrid and Evolutionary Approach

Goal-Oriented Measurement plus System Dynamics A Hybrid and Evolutionary Approach Goal-Oriented Measurement plus System Dynamics A Hybrid and Evolutionary Approach Dietmar Pfahl Fraunhofer Institute IESE pfahl@iese.fhg.de Günther Ruhe University of Calgary ruhe@ucalgary.ca 1. Aim and

More information

RECALL / EVENT INVESTIGATION & PATIENT LOOK BACK

RECALL / EVENT INVESTIGATION & PATIENT LOOK BACK RECALL / EVENT INVESTIGATION & PATIENT LOOK BACK Federal, State and AABB requirements for nonconforming product investigation and recipient look back for adverse impact Stacy Ralston MPH, CLS (ASCP), RAC

More information

Outline. What s inside this paper? My expectation. Software Defect Prediction. Traditional Method. What s inside this paper?

Outline. What s inside this paper? My expectation. Software Defect Prediction. Traditional Method. What s inside this paper? Outline A Critique of Software Defect Prediction Models Norman E. Fenton Dongfeng Zhu What s inside this paper? What kind of new technique was developed in this paper? Research area of this technique?

More information

Reliability of feedback fechanism based on root cause defect analysis - case study

Reliability of feedback fechanism based on root cause defect analysis - case study Annales UMCS Informatica AI XI, 4 (2011) 21 32 DOI: 10.2478/v10065-011-0037-0 Reliability of feedback fechanism based on root cause defect analysis - case study Marek G. Stochel 1 1 Motorola Solutions

More information

Warranty. Any attempt by an unauthorized person to alter or repair the product is also not covered by the warranty.

Warranty. Any attempt by an unauthorized person to alter or repair the product is also not covered by the warranty. Warranty ii The Gentec-EO inc Holographic Beam Sampler carries a one year warranty (from date of shipment) against material and / or workmanship defects, when used under normal operating conditions. The

More information

Taking the Software Out of TSP

Taking the Software Out of TSP Taking the Software Out of TSP Implementing TSP on a Non-Software Team CGI GROUP INC. All rights reserved Jason Huibregtse TSP Symposium Sept. 2012 _experience the commitment TM Agenda Why TSP? Modifications

More information

8. Reviews. Dilbert. Review objectives Formal design reviews (FDRs) Peer reviews. Comparison of peer reviews methods Expert opinions

8. Reviews. Dilbert. Review objectives Formal design reviews (FDRs) Peer reviews. Comparison of peer reviews methods Expert opinions 8. Reviews Dilbert Review objectives Formal design reviews (FDRs) Peer reviews Inspections walkthroughs Comparison of peer reviews methods Expert opinions ppt by Galin, with major modifications by cah

More information

Western Area Power Administration, Conditional Firm Transmission Service Business Practice

Western Area Power Administration, Conditional Firm Transmission Service Business Practice Western Area Power Administration Conditional Firm Transmission Service Business Practice Background: In Order No. 890, dated February 16, 2007, the Federal Energy Regulatory Commission ( FERC or Commission

More information

Barbara Brohl Executive Director & State Licensing Authority Colorado Department of Revenue

Barbara Brohl Executive Director & State Licensing Authority Colorado Department of Revenue Barbara Brohl Executive Director & State Licensing Authority Colorado Department of Revenue 1 Background and History Colorado Industry Segments Legislative Process Rulemaking Process Regulatory & Enforcement

More information

C30-A2 ISBN ISSN Point-of-Care Blood Glucose Testing in Acute and Chronic Care Facilities; Approved Guideline Second Edition

C30-A2 ISBN ISSN Point-of-Care Blood Glucose Testing in Acute and Chronic Care Facilities; Approved Guideline Second Edition ISBN 1-56238-471-6 ISSN 0273-3099 Point-of-Care Blood Glucose Testing in Acute and Chronic Care Facilities; Approved Guideline Second Edition Volume 22 Number 17 David B. Sacks, M.D., Chairholder Patricia

More information

Flowsheet Setup. 1. Define Treatment Protocols. 2. Define Treatment Cycles. 3. Define Flowsheets. Instructions. Protocol Instructions.

Flowsheet Setup. 1. Define Treatment Protocols. 2. Define Treatment Cycles. 3. Define Flowsheets. Instructions. Protocol Instructions. Flowsheet Setup Flowsheet Setup 1. Define Treatment Protocols Protocol Instructions 2. Define Treatment Cycles 3. Define Flowsheets Diagnostic Intercourse OI IVF Donor Recipient Surrogate IP Instructions

More information

April 10, 2008 VIA ELECTRONIC MAIL

April 10, 2008 VIA ELECTRONIC MAIL VIA ELECTRONIC MAIL Donna Pickett, MPH, RHIA Medical Classification Administrator National Center for Health Statistics 3311 Toledo Road Room 2402 Hyattsville, Maryland 20782 Dear Donna: The American Health

More information

ESM and disposal of PCBs

ESM and disposal of PCBs ESM and disposal of PCBs Regional training workshop Kingston, February 2nd to 5th 2009 What does it mean? ESM stands for Environmentally Sound Management. Here sound means the state-of-the-art. What is

More information

Setting up deviation, incident, nonconformance. Presented by Debbie Parker 4 July, 2016

Setting up deviation, incident, nonconformance. Presented by Debbie Parker 4 July, 2016 Setting up deviation, incident, nonconformance systems Presented by Debbie Parker 4 July, 2016 Introduction This session will cover: Regulations Definitions Process Case Study Setting up a new system Common

More information

Preparing a US FDA Medical Device 510(K) Submission

Preparing a US FDA Medical Device 510(K) Submission Preparing a US FDA Medical Device 510(K) Submission If you want to introduce your medical device to the US market, you need to obtain clearance from the FDA. This clearance is obtained from the FDA via

More information

MyWindFit Member Analytics Portal

MyWindFit Member Analytics Portal Member Analytics Portal The member section of is a private and personalized cloud database that contains the detailed records of all your activity. It also contains an analysis package that enables you

More information

HEALTHCARE ASSOCIATED INFECTION PREVENTION AND CONTROL REPORT SEPTEMBER 2014

HEALTHCARE ASSOCIATED INFECTION PREVENTION AND CONTROL REPORT SEPTEMBER 2014 Borders NHS Board HEALTHCARE ASSOCIATED INFECTION PREVENTION AND CONTROL REPORT SEPTEMBER Aim The purpose of this paper is to update Board members of the current status of Healthcare Associated Infections

More information

The National Hepatitis C Plan - Scotland

The National Hepatitis C Plan - Scotland The National Hepatitis C Plan - Scotland Dr Nicola Rowan Scottish Government Dr John Dillon NHS Tayside University of Dundee Policy Introduction Hepatitis C Action Plan for Scotland Phase I: 2006-2008

More information

VIEW AS Fit Page! PRESS PgDn to advance slides!

VIEW AS Fit Page! PRESS PgDn to advance slides! VIEW AS Fit Page! PRESS PgDn to advance slides! UNDERSTAND REALIZE CHANGE WHY??? CHANGE THE PROCESSES OF YOUR BUSINESS CONNECTING the DOTS Customer Focus (W s) Customer Focused Metrics Customer Focused

More information

Note: This is an authorized excerpt from 2016 Healthcare Benchmarks: Digital Health To download the entire report, go to

Note: This is an authorized excerpt from 2016 Healthcare Benchmarks: Digital Health To download the entire report, go to Note: This is an authorized excerpt from 2016 Healthcare Benchmarks: Digital Health To download the entire report, go to http://store.hin.com/product.asp?itemid=5126 or call 888-446-3530. 2016 Healthcare

More information

A step forward full automatic analysis Silvère BARUT 1, Nicolas DOMINGUEZ 1, Jean-Noël NOIRET 2, Ivan KAMENEFF 3

A step forward full automatic analysis Silvère BARUT 1, Nicolas DOMINGUEZ 1, Jean-Noël NOIRET 2, Ivan KAMENEFF 3 6th International Symposium on NDT in Aerospace, 12-14th November 2014, Madrid, Spain - www.ndt.net/app.aerondt2014 More Info at Open Access Database www.ndt.net/?id=16928 A step forward full automatic

More information

Second Quarter and First Half 2011 Conference Call. 29 July, SORIN GROUP Presentation 1

Second Quarter and First Half 2011 Conference Call. 29 July, SORIN GROUP Presentation 1 Second Quarter and First Half 2011 Conference Call 29 July, 2011 SORIN GROUP Presentation 1 DISCLAIMER This presentation contains management preliminary estimates and forward-looking statements, including

More information

[HEALTH MAINTENANCE AND INVITATIONS/REMINDERS] June 2, 2014

[HEALTH MAINTENANCE AND INVITATIONS/REMINDERS] June 2, 2014 Health Maintenance tab is located on the left side menu. Health Maintenance will assist with Meaningful Use, Stage 2 objectives. Meaningful Use, objective #6 states the following: Use clinical support

More information

Erik van Veenendaal. Improve Quality Services BV. Onafhankelijk en objectief Innovatief en trendsettend (EU-projects/TU

Erik van Veenendaal. Improve Quality Services BV. Onafhankelijk en objectief Innovatief en trendsettend (EU-projects/TU Risk Based Testing in Practice Never speculate on that which can be known for certain Erik van Veenendaal (eve@improveqs.nl) PRISMA 1 Improve Quality Services BV Dienstverlenende organisatie op het gebied

More information

IEEE 803.af Management clause 33

IEEE 803.af Management clause 33 IEEE 803.af Management clause 33 33.22 Management function requirements The MII Management Interface (see 22.2.4) is used to communicate PSE and PD information to the management entity. If a Clause 22

More information

3/23/2012. Brand Building is Everyone s Business. Brands play a powerful role in our choices and actions as consumers.

3/23/2012. Brand Building is Everyone s Business. Brands play a powerful role in our choices and actions as consumers. Brand Building is Everyone s Business 2012 Transcend Hospice Marketing Group Brands play a powerful role in our choices and actions as consumers. A brand is short hand for what a company, product or service

More information

ANNUAL REPORT

ANNUAL REPORT Surgical Hearing Implant Program Otolaryngology ANNUAL REPORT 2012-2013 Department Name 1 Executive Summary Vision To enrich communication and quality of life for Manitobans by delivering safe, accessible

More information

Ergonomic Test of the Kinesis Contoured Keyboard

Ergonomic Test of the Kinesis Contoured Keyboard Global Ergonomic Technologies, Inc. Ergonomic Test of the Kinesis Contoured Keyboard Prepared by Wanda Smith, President Dan Cronin, Engineer December 16, 1992 Executive Summary A study was conducted of

More information

Diabetes Recognition Program (DRP) October 2018

Diabetes Recognition Program (DRP) October 2018 Diabetes Recognition Program (DRP) October 2018 Overview Recognition Process Agenda Benefits of Recognition Resources DRP Basics Launched in 1997. Voluntary program; non punitive. Uses nationally recognized

More information

Using USDA Food Products: Partner Agency Manual

Using USDA Food Products: Partner Agency Manual Using USDA Food Products: Partner Agency Manual What is the USDA? The United States Department of Agriculture (USDA) is the United States federal executive department responsible for developing and executing

More information

COMMITMENT. &SOLUTIONS Act like someone s life depends on what we do. TAKE THE FUZE SAFETY DESIGN QUIZ, PART I UNPARALLELED

COMMITMENT. &SOLUTIONS Act like someone s life depends on what we do. TAKE THE FUZE SAFETY DESIGN QUIZ, PART I UNPARALLELED TAKE THE FUZE SAFETY DESIGN QUIZ, PART I 61 st NDIA Fuze Conference, May 2018 Presented by: Homesh Lalbahadur Army Fuze Management Office ENTERPRISE AND SYSTEMS INTEGRATION CENTER (ESIC) / ARDEC UNPARALLELED

More information

Activated Transponder & Activator Instruction Manual

Activated Transponder & Activator Instruction Manual Activated Transponder & Activator Instruction Manual Westhold Corporation General Warranty Modules and other equipment ("Goods") purchased from Westhold Corporation are warranted against defects in materials

More information

GUIDE FOR TECHNICAL UPDATE OF PREFERENTIAL RULES OF ORIGIN

GUIDE FOR TECHNICAL UPDATE OF PREFERENTIAL RULES OF ORIGIN GUIDE FOR TECHNICAL UPDATE OF PREFERENTIAL RULES OF ORIGIN - How to update the existing Preferential Rules of Origin in relation to changes in the Harmonized System - DECEMBER 2015 (LAST UPDATED IN MAY

More information

VFC Inventory Reporting through GRITS Changes. Effective Friday, September 7, 2012

VFC Inventory Reporting through GRITS Changes. Effective Friday, September 7, 2012 VFC Inventory Reporting through GRITS Changes Effective Friday, September 7, 2012 Summary of Changes Monthly Comprehensive Report and Vaccine Accountability Statement are available in one click. Both reports

More information

the rest of our research. For be any correlation between outcome and the strength of the relationship according to the coach.

the rest of our research. For be any correlation between outcome and the strength of the relationship according to the coach. Are we sure as coaches we truly know and deliver what clients want? Anna Duckworth and Erik de Haan found some surprising evidence in their latest research the ties that Bind W hat s really the rest of

More information

SLEEP DISORDERED BREATHING The Clinical Conditions

SLEEP DISORDERED BREATHING The Clinical Conditions SLEEP DISORDERED BREATHING The Clinical Conditions Robert G. Hooper, M.D. In the previous portion of this paper, the definitions of the respiratory events that are the hallmarks of problems with breathing

More information

Analysis for [Intervention] ([Jurisdiction] Feasibility Study)

Analysis for [Intervention] ([Jurisdiction] Feasibility Study) Outcome Analysis for [Intervention] ([Jurisdiction] Feasibility Study) DATE This template is intended for you to be able to fill in the indicated information within the brackets as it relates to your intervention

More information

Evaluation Survey Report

Evaluation Survey Report Evaluation Survey Report Court Interpreter Services in Nevada Courts NEVADA SUPREME COURT, ADMINISTRATIVE OFFICE OF THE COURTS May 2011 Andrea Krlickova, Certified Court Interpreter Program Coordinator

More information

NEPHROCHECK Calibration Verification Kit Package Insert

NEPHROCHECK Calibration Verification Kit Package Insert NEPHROCHECK Calibration Verification Kit Package Insert Manufactured for Astute Medical, Inc. 3550 General Atomics Ct. Building 2 San Diego, CA 92121 USA Intended Use The NEPHROCHECK Calibration Verification

More information

VISTA400 REMOVABLE FOOT PLATE. Instructions For Use. Step on yellow pedals to close and open legs to go around chairs & ambulate.

VISTA400 REMOVABLE FOOT PLATE. Instructions For Use. Step on yellow pedals to close and open legs to go around chairs & ambulate. VISTA400 Instructions For Use Squeeze the yellow bar & push down/pull up to activate pneumatic stand assist. Step on yellow pedals to close and open legs to go around chairs & ambulate. Pull yellow levers

More information

Appendix 2 Quality assessment tools. Cochrane risk of bias tool for RCTs. Support for judgment

Appendix 2 Quality assessment tools. Cochrane risk of bias tool for RCTs. Support for judgment Appendix 2 Quality assessment tools Cochrane risk of bias tool for RCTs Item Judgment (H/L/Unclear) Random sequence generation (selection bias) Allocation concealment (selection bias) Blinding of participants

More information

Comments on Consultative Report Governance arrangements for critical OTC derivatives data elements (other than UTI and UPI)

Comments on Consultative Report Governance arrangements for critical OTC derivatives data elements (other than UTI and UPI) September 27, 2018 Secretariats of The Committee on Payments and Market Infrastructures The International Organization of Securities Commissions Comments on Consultative Report Governance arrangements

More information

SED2 Variable Frequency Drives Conventional Bypass (C-Bypass) Options

SED2 Variable Frequency Drives Conventional Bypass (C-Bypass) Options SED2 Variable Frequency Drives Conventional Bypass (C-Bypass) Options Product Description The SED2 Conventional Bypass (C-Bypass) Options are companion packages for the family of SED2 Variable Frequency

More information

Day 2 MER Analytics Exercise PMTCT Data Analysis

Day 2 MER Analytics Exercise PMTCT Data Analysis Background It is important to note that reviewing PMTCT data requires more than just comparing results to targets. This exercise will guide the user to review the PMTCT & EID cascade and coverage rates

More information

BIOSPECIMEN COLLECTION FORM

BIOSPECIMEN COLLECTION FORM BIOSPECIMEN COLLECTION FORM ID NUMBER: FORM CODE: B I O DATE: 04/01/2016 Version 2.0 ADMINISTRATIVE INFORMATION 0a. Completion Date: / / 0b. Staff ID: Month Day Year 0c. Selected for additional phantom

More information

H. Lundbeck AS (LUN) - Financial and Strategic SWOT Analysis Review

H. Lundbeck AS (LUN) - Financial and Strategic SWOT Analysis Review H. Lundbeck AS (LUN) - Financial and Strategic SWOT Analysis Review H. Lundbeck AS (LUN) - Financial and Strategic SWOT Analysis Review BioPortfolio has been marketing business and market research reports

More information

E. SelectTech 5.1 Bench Owner s / Assembly Manual

E. SelectTech 5.1 Bench Owner s / Assembly Manual 000-6189.080118.E SelectTech 5.1 Bench Owner s / Assembly Manual Congratulations on your commitment to fitness and your purchase of the Bowflex SelectTech 5.1 Bench. Before assembling your Bowflex SelectTech

More information

Inventory... 3 Inventory Types... 3 Contracting Entities Single Inventory Management... 3 FIFO... 4

Inventory... 3 Inventory Types... 3 Contracting Entities Single Inventory Management... 3 FIFO... 4 Section 8000 Inventory and Records Table of Contents Inventory... 3 Inventory Types... 3 Contracting Entities... 3 Single Inventory Management... 3 FIFO... 4 School Food Authorities (SFAs) That Act as

More information

4.0 Product Testing. 4.1 Routine Testing

4.0 Product Testing. 4.1 Routine Testing 4.0 Product Testing The MCIR program has established methods for testing new features prior to dissemination. Section 4.1 describes the routine testing processes. The defects identified through this process

More information

PSP Performance Analysis Report

PSP Performance Analysis Report PSP Performance Analysis Report Valentina Ivanova, PhD New Bulgarian University Contents: Personal Software Process Overview... 2 Planning Performance... 2 Size Estimating Performance... 2 Time Estimating

More information

Provider Dashboard User's Manual

Provider Dashboard User's Manual Provider Dashboard User's Manual CAUTION: FEDERAL LAW RESTRICTS THIS DEVICE TO SALE BY OR ON THE ORDER OF A PHYSICIAN. IMPORTANT: READ THE SAEBOVR GETTING STARTED GUIDE (BAI-VOTA-LBL- 001) IN ITS ENTIRETY

More information

FirstGroup corporate responsibility data

FirstGroup corporate responsibility data FirstGroup corporate responsibility data Created June 2017 Covering 2016/17 Summary This document provides the corporate responsibility data for FirstGroup for the reporting year 2016/17. Unless otherwise

More information

Addressing the Opioid Crisis Workgroup: Treatment and Overdose Prevention

Addressing the Opioid Crisis Workgroup: Treatment and Overdose Prevention The Accountable Community for Health of King County Addressing the Opioid Crisis Workgroup: Treatment and Overdose Prevention May 7, 2018 1 Opiate Treatment & Overdose Prevention Project Goal Immediate:

More information

Measurement. Different terminology. Marketing managers work with abstractions. Different terminology. Different terminology.

Measurement. Different terminology. Marketing managers work with abstractions. Different terminology. Different terminology. Different terminology Managerial view Marketing managers work with abstractions Concepts A generalized idea about a class of objects, attributes, occurrences or processes Propositions A set of concepts

More information

E. SelectTech 3.1 Bench Assembly / Owner s Manual

E. SelectTech 3.1 Bench Assembly / Owner s Manual 000-6190.121212.E SelectTech 3.1 Bench Assembly / Owner s Manual Congratulations on your commitment to fitness and your purchase of the Bowflex SelectTech 3.1 Bench. Before assembling your Bowflex SelectTech

More information

Treatment Adaptive Biased Coin Randomization: Generating Randomization Sequences in SAS

Treatment Adaptive Biased Coin Randomization: Generating Randomization Sequences in SAS Adaptive Biased Coin Randomization: OBJECTIVES use SAS code to generate randomization s based on the adaptive biased coin design (ABCD) must have approximate balance in treatment groups can be used to

More information

B.C. Cannabis PRIVATE RETAIL LICENSING GUIDE Applications and Operations

B.C. Cannabis PRIVATE RETAIL LICENSING GUIDE Applications and Operations B.C. Cannabis PRIVATE RETAIL LICENSING GUIDE Applications and Operations Copyright February 2018, Province of British Columbia. All rights reserved. This material is owned by the Government of British

More information

For personal use only

For personal use only HY18 Result Presentation 13 February 2018 Dig Howitt Brent Cubis CEO & President CFO HY18 Result highlights Strong momentum across developed markets continues Developed market unit growth up 12% Strengthening

More information

Current through Chapter 199 and Chapters of the 2015 Legislative Session

Current through Chapter 199 and Chapters of the 2015 Legislative Session 26-21-101. Short title. 26-21-101. Short title This article shall be known and may be cited as the "Colorado Commission for the Deaf and Hard of Hearing Act". Cite as C.R.S. 26-21-101 History. L. 2000:

More information

Fault Detection and Localisation in Reduced Test Suites

Fault Detection and Localisation in Reduced Test Suites UNIVERSITY OF SZEGED Fault Detection and Localisation in Reduced Test Suites Árpád Beszédes University of Szeged, Hungary The 29 th CREST Open Workshop, London November 2013 Overview University of Szeged,

More information

EHR Usability Test Report of OneTouch EMR

EHR Usability Test Report of OneTouch EMR EHR Usability Test Report of OneTouch EMR Report based on ISO/IEC 25062:2006 Common Industry Format for Usability Test Reports OneTouch EMR, Version 2.0 Date of Usability Test: 5/11/2014 Date of Report:

More information

THE LOCATOR OVERDENTURE IMPLANT SYSTEM PRODUCT ORDERING INFORMATION AND PRICE LIST

THE LOCATOR OVERDENTURE IMPLANT SYSTEM PRODUCT ORDERING INFORMATION AND PRICE LIST THE LOCATOR OVERDENTURE IMPLANT SYSTEM PRODUCT ORDERING INFORMATION AND PRICE LIST THE LOCATOR OVERDENTURE IMPLANT SYSTEM Each package includes your choice of a 2.4mm or 2.9mm narrow diameter LOCATOR Overdenture

More information

AquaJogg Hydro Treadmill

AquaJogg Hydro Treadmill AquaJogg Hydro Treadmill PART #: F-WXAQJG 330 LB. [150 kg] MAXIMUM WEIGHT CAPACITY MANDATORY LEAVE THIS MANUAL WITH TREADMILL OWNER To assemble your equipment read entire manual and follow all instructions.

More information

Second Regular Session Seventieth General Assembly STATE OF COLORADO INTRODUCED

Second Regular Session Seventieth General Assembly STATE OF COLORADO INTRODUCED Second Regular Session Seventieth General Assembly STATE OF COLORADO INTRODUCED LLS NO. 1-0.01 Michael Dohr x HOUSE BILL 1-1 HOUSE SPONSORSHIP Pabon, Conti, Court, Foote, Garnett, Kagan, Priola, Roupe,

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

PICTOR USER GUIDE V.1.0.R7

PICTOR USER GUIDE V.1.0.R7 1 PICTOR USER GUIDE V.1.0.R7 2 Table of contents 1. Introduction 4 2. Explanation of symbols 5 3. Description of the device structure 5 4. Device setup 8 5. Advised exercises 9 6. Warnings 12 7. Contraindications

More information

Industry s Perspective on the Status of Medical Device Regulations. FUNDISA Workshop 09 & 10 Oct Anele Vutha SAMED Regulatory Committee

Industry s Perspective on the Status of Medical Device Regulations. FUNDISA Workshop 09 & 10 Oct Anele Vutha SAMED Regulatory Committee Industry s Perspective on the Status of Medical Device Regulations FUNDISA Workshop 09 & 10 Oct 2014 Anele Vutha SAMED Regulatory Committee Today s Topics: 1. Medical Device Definition - Differences 2.

More information

Cancer Immunotherapy Artificial Intelligence: Market Shares, Strategies, and Forecasts, 2017 to 2023

Cancer Immunotherapy Artificial Intelligence: Market Shares, Strategies, and Forecasts, 2017 to 2023 Cancer Immunotherapy Artificial Intelligence: Market Shares, Strategies, and Forecasts, 2017 to 2023 Table of Contents Cancer Immunotherapy Artificial Intelligence: Executive Summary The study is designed

More information

IBM s Watson supercomputer recommended unsafe and incorrect cancer treatments, internal documents show

IBM s Watson supercomputer recommended unsafe and incorrect cancer treatments, internal documents show IBM s Watson supercomputer recommended unsafe and incorrect cancer treatments, internal documents show By Casey Ross @caseymross and Ike Swetlitz @ikeswetlitz July 25, 2018 Alex Hogan/STAT Internal IBM

More information

For personal use only

For personal use only Cochlear Limited Results for the half year ended 31 December 2011 (H1 F12) Chris Roberts, CEO Neville Mitchell, CFO Cochlear Overview Cochlear Limited (ASX:COH): global leader in implantable devices for

More information

An architecture description method for Acknowledged System of Systems based on Federated Architecture

An architecture description method for Acknowledged System of Systems based on Federated Architecture An architecture description method for Acknowledged System of Systems based on Federated Architecture Jae-Hong Ahn 1, Yeunseung Ryu 2 and Doo-Kwon Baik 3 1 Agency for Defense Development, Korea koreaseman@daum.net

More information

HL7 Immunization User Group. Monthly Meeting July 12, :00 PM ET

HL7 Immunization User Group. Monthly Meeting July 12, :00 PM ET HL7 Immunization User Group Monthly Meeting July 12, 2018 2:00 PM ET Agenda Welcome Poll: Which perspective do you primarily identify yourself with? Updates AIRA National Meeting SISC Update Discussion

More information

GEX Recommended Procedure Eff. Date: 07/27/07 Rev.: C Pg. 1 of 10

GEX Recommended Procedure Eff. Date: 07/27/07 Rev.: C Pg. 1 of 10 GEX Recommended Procedure Eff. Date: 07/27/07 Rev.: C Pg. 1 of 10 NOTICE: This document is version controlled and was produced as a part of the GEX Information Program which requires that all Series 100

More information

The following report provides details about the strategic plan and the main accomplishments from the 2015 plan.

The following report provides details about the strategic plan and the main accomplishments from the 2015 plan. INTRODUCTION In Fall 2014, the Denver Public Health Strategic Planning Committee worked with staff and partners to develop the 2015-2017 Strategic Plan. From this plan, the annual 2015 implementation plan

More information

NEW YORK STATE DEPARTMENT OF HEALTH CLINICAL LABORATORY EVALUATION PROGRAM. Crosswalk of Proposed Revisions to Cytogenetics Standards

NEW YORK STATE DEPARTMENT OF HEALTH CLINICAL LABORATORY EVALUATION PROGRAM. Crosswalk of Proposed Revisions to Cytogenetics Standards 2014 Standard 2014 Guidance 2016 Standard 2016 Guidance Cytogenetics Standard 1 (CG S1) The laboratory shall request clinical information necessary for proper initiation of test procedures and interpretation

More information

Call for Applications

Call for Applications 2013 Knowledge Synthesis Grant Program Call for Applications Program Guidelines Overview Technology Evaluation in the Elderly Network (TVN or the Network) is a new network funded by the Government of Canada

More information

FMEA AND RPN NUMBERS. Failure Mode Severity Occurrence Detection RPN A B

FMEA AND RPN NUMBERS. Failure Mode Severity Occurrence Detection RPN A B FMEA AND RPN NUMBERS An important part of risk is to remember that risk is a vector: one aspect of risk is the severity of the effect of the event and the other aspect is the probability or frequency of

More information

LAW ON MINERAL FERTILIZERS. Official Gazette of Bosnia and Herzegovina, 46/04

LAW ON MINERAL FERTILIZERS. Official Gazette of Bosnia and Herzegovina, 46/04 LAW ON MINERAL FERTILIZERS Official Gazette of Bosnia and Herzegovina, 46/04 Pursuant to Article IV.4.a) of the Constitution of Bosnia and Herzegovina, the Parliamentary Assembly of Bosnia and Herzegovina,

More information

Outcome Research Coding Protocol. Coding Studies and Rating the Level of Evidence for the. Causal Effect of an Intervention

Outcome Research Coding Protocol. Coding Studies and Rating the Level of Evidence for the. Causal Effect of an Intervention Outcome Research Coding Protocol Coding Studies and Rating the Level of Evidence for the Causal Effect of an Intervention National Panel for Evidence-Based School Counseling June, 2005 School counseling

More information

Estimating the number of components with defects post-release that showed no defects in testing

Estimating the number of components with defects post-release that showed no defects in testing SOFTWARE TESTING, VERIFICATION AND RELIABILITY Softw. Test. Verif. Reliab. 2002; 12:93 122 (DOI: 10.1002/stvr.235) Estimating the number of components with defects post-release that showed no defects in

More information

Nevertheless, NSP grantees may retain some or all program income in the NSP program;

Nevertheless, NSP grantees may retain some or all program income in the NSP program; FREQUENTLY ASKED QUESTIONS REGARDING THE TRANSFER OF NEIGHBORHOOD STABILIZATION PROGRAM (NSP) PROGRAM INCOME U.S. Department of Housing and Urban Development Office of Community Planning and Development

More information

Reports of Adverse Drug Reactions, etc. of Pharmaceuticals

Reports of Adverse Drug Reactions, etc. of Pharmaceuticals (Attachment) Reports of Adverse Drug Reactions, etc. of Pharmaceuticals 1 GLOSSARY (1) Drugs, quasi-drugs, and cosmetics -1- Related to Article 228-20, paragraph 1, item 1 of the Enforcement Ordinance

More information

Buprenorphine Order Set and Rapid Access Referral. Copyright 2017, CAMH

Buprenorphine Order Set and Rapid Access Referral. Copyright 2017, CAMH 2 Buprenorphine Order Set and Rapid Access Referral 1 Agenda Problem Identification / Identification Importance / Importance Baseline Workflow Baseline Workflow Baseline Data Baseline Data Objectives Solution

More information

Legislative Report: 5010/ICD-10 --------------------------------- WEDI EHR Work Group: Electronic Health Record Product and Vendor Profile Site (Draft) Robert M. Tennant MGMA Co-chair, WEDI EHR WG HR 4157

More information

Standard FAC Establish and Communicate System Operating Limits

Standard FAC Establish and Communicate System Operating Limits A. Introduction 1. Title: Establish and Communicate System Operating Limits 2. Number: FAC-014-2 3. Purpose: To ensure that System Operating Limits (SOLs) used in the reliable planning and operation of

More information

Cybex Free Weight Utility Bench Owner s and Service Manual Strength Systems Part Number B

Cybex Free Weight Utility Bench Owner s and Service Manual Strength Systems Part Number B www.cybexinternational.com Cybex Free Weight Utility Bench Owner s and Service Manual Strength Systems Part Number 16030-999-4 B Cybex Free Weight Utility Bench Owner s and Service Manual Strength Systems

More information

TABLE OF CONTENTS. Warning Label...1. Important Safety Instructions...2. Parts List...5. Assembly Instructions...6. Additional DVD Workouts...

TABLE OF CONTENTS. Warning Label...1. Important Safety Instructions...2. Parts List...5. Assembly Instructions...6. Additional DVD Workouts... OWNER S MANUAL TABLE OF CONTENTS TABLE OF CONTENTS Warning Label...1 Important Safety Instructions...2 Parts List...5 Assembly Instructions...6 Additional DVD Workouts...11 WARNING LABEL WARNING LABEL

More information

Assessing the efficacy of mobile phone interventions using randomised controlled trials: issues and their solutions. Dr Emma Beard

Assessing the efficacy of mobile phone interventions using randomised controlled trials: issues and their solutions. Dr Emma Beard Assessing the efficacy of mobile phone interventions using randomised controlled trials: issues and their solutions Dr Emma Beard 2 nd Behaviour Change Conference Digital Health and Wellbeing 24 th -25

More information

Vote-Counting Method to Obtain an Estimate and Confidence Interval for the Population Correlation Coefficient Using SASI AFo

Vote-Counting Method to Obtain an Estimate and Confidence Interval for the Population Correlation Coefficient Using SASI AFo Vote-Counting Method to Obtain an Estimate and Confidence Interval for the Population Correlation Coefficient Using SASI AFo Frank C. Lieble m, SAS Institute Inc., Orlando, Florida Morgan C. Wang, University

More information

MILLENIUM SCIENCE COMPLEX

MILLENIUM SCIENCE COMPLEX GLOVE BOX MILLENIUM SCIENCE COMPLEX Opened in 2012 Essentially two separate buildings Materials Research Institute and Huck Institute of Life Science $225 million to build 275, 600 square feet 66 fume

More information

PATENCY-1 Top-Line Results

PATENCY-1 Top-Line Results PATENCY-1 Top-Line Results December 13, 2016 2016 Proteon Therapeutics, Inc. Cautionary Note Regarding Forward-Looking Statements This presentation contains statements that are, or may be deemed to be,

More information

Indirect Food Additives: Adhesives and Components of Coatings and Paper and Paperboard Components

Indirect Food Additives: Adhesives and Components of Coatings and Paper and Paperboard Components 4 DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration 21 CFR Parts 175 and 176 [Docket No. 99F-09253 Indirect Food Additives: Adhesives and Components of Coatings and Paper and Paperboard

More information

ICD-10-CM Topics. November 15, 2012 VIA ELECTRONIC MAIL

ICD-10-CM Topics. November 15, 2012 VIA ELECTRONIC MAIL VIA ELECTRONIC MAIL Donna Pickett, MPH, RHIA Medical Classification Administrator National Center for Health Statistics 3311 Toledo Road Room 2402 Hyattsville, Maryland 20782 Dear Ms. Pickett: The American

More information

Hearing Conservation Program Evaluation Checklist

Hearing Conservation Program Evaluation Checklist Hearing Conservation Program Evaluation Checklist Training and Education Yes No N/A Comments 1. Is training conducted at least once a year? 2. Is the training provided by a qualified instructor? 3. Is

More information

36th Annual J.P. Morgan Healthcare Conference. Kevin Conroy, Chairman and CEO January 9, 2018

36th Annual J.P. Morgan Healthcare Conference. Kevin Conroy, Chairman and CEO January 9, 2018 36th Annual J.P. Morgan Healthcare Conference Kevin Conroy, Chairman and CEO January 9, 2018 1 Safe harbor statement This presentation contains forward-looking statements within the meaning of Section

More information