DEFECT DENSITY METRICS
|
|
- Madeleine Thomas
- 6 years ago
- Views:
Transcription
1 1 DEFECT DENSITY METRICS
2 Defect density is a measure of the total known defects divided by the size of the software entity being measured. Estimated because defects are found throughout the entire life-cycle of the product Important for cost and resource estimates for the maintenance phase of the life cycle 2
3 The Number of Known Defects is the count of total defects identified against a particular software entity, during a particular time period. Examples include: The period might be for one of the following: for a duration (say, the first month, the quarter, or the year). Defect to date since the creation of module Defects found in a program during an inspection Defects to date since the shipment of a release to the customer for each phase of the software life cycle. for the whole of the software life cycle 3
4 Size is a normalize that allows comparisons between different software entities (i.e., modules, releases, products). Size is typically counted either in Lines of Code (LOC) or Function Points. 4
5 DEFECT DENSITY USES Defect Density is used to compare the relative number of defects in various software components. This helps identify candidates for additional inspection or testing or for possible reengineering or replacement. Identifying defect components allows the concentration of limited resources into areas with the highest potential return on the investment. 5
6 DEFECT DENSITY USES Another use for Defect Density is to compare subsequent releases of a product to track the impact of defect reduction and quality improvement activities. 6
7 DEFECT DENSITY ISSUES (1) There is no general consensus on: - What constitutes a defect - How to measure SW size (2) Defect Density is a product measure but it is derived from the process of finding defects. - May say more about quality of defect finding and reporting, than about the quality of the product itself (3) Should measure number of defects with respect to time (e.g.mtbf) rather than product size 7
8 DEFECT DENSITY CAUTIONS Even if we knew the exact number of residual faults in a system, it is still: - Difficult to determine in advance the seriousness of a fault - There is much variability in the way the system is used by different users; a system is not always used as expected 8
9 More specific Defect Density (rate) = number of defects / opportunities for errors during a specified time Number of defects can be approximated as equal to the number of unique causes of observed failures Opportunities for error can be expressed as KLOC Time frame (life of product or LOP) varies 9
10 Defect Density Example Product is one year old, and is 10 KLOC Unique causes of observed failures = 50 Current Defect Density = 50/10K = 5 defects per KLOC per year After second year Unique causes of observed failures = 75 Current Defect Density = 75 / 10K = 7.5 defects per KLOC per 2year or 3.75 per KLOC per year 10
11 Timeframes must be the same Cannot compare (current) defect rate for a one year old product to the (current) defect rate of a four year old product IBM considers life of product to be 4 years Must account for new and modified code in LOC count (otherwise metric is skewed) LOC counting must remain consistent 11
12 Measuring LOC Comparison Issues How LOC is calculated Count only executable lines Count executable lines, plus data definitions Count executable lines, plus data definitions, plus comments Count physical lines Count logical lines (terminated by ; ) Normalising quality/productivity metrics considering size Size usually LOC, KLOC, or Pages of Documentation Defects per KLOC $ per LOC Pages of documentation per KLOC LOC per person-month $ per page of documentation 12
13 At IBM, the following LOC count metrics, based on logical LOC, are used: (1) Shipped Source Instructions (SSI): LOC count for the total product (2) Changed Source Instructions (CSI): LOC count for the new and changed code of the new release. The relationship between SSI and CSI is given by: SSI (current release) = SSI (previous release) + CSI (new and changed code instructions for current release) - deleted code (usually very small) - changed code (to avoid double count in both SSI & CSI) Defects can be field defects (found by customers), or internal defects (found internally).
14 We are about to launch the third release of an inventory management software system. - The size of the initial release was 50 KLOC, with a defect density of 2.0 def/kssi - In the second release, 20KLOC of code was newly added or modified (20% of which are changed lines of code, with no deleted code ). - In the third release, 30KLOC of code was newly added or modified (20% of which are changed lines of code, with no deleted code ). Assume that the LOC counts are based on source instructions (SSI/CSI). (a) Considering that the quality goal of the company has been to achieve 10% improvement in overall defect rates from release-torelease, calculate the total number of additional defects for the third release. (b) What should be the maximum (overall) defect rate target for the third release to ensure that the number of new defects does not exceed that of the second release.
Defect Removal Metrics. SE 350 Software Process & Product Quality 1
Defect Removal Metrics 1 Objectives Understand some basic defect metrics and the concepts behind them Defect density metrics Defect detection and removal effectiveness etc. Look at the uses and limitations
More informationInstruction Manual Aerogen, Inc. Part No. AG-AL1010 Rev. C
Instruction Manual 2004 Aerogen, Inc. Part No. AG-AL1010 Rev. C Table of Contents Introduction... 3 System description... 4 Warnings... 5 Cautions... 5 Electromagnetic Susceptibility... 5 Symbols... 6
More informationRefactoring for Changeability: A way to go?
Refactoring for Changeability: A way to go? B. Geppert, A. Mockus, and F. Roessler {bgeppert, audris, roessler}@avaya.com Avaya Labs Research Basking Ridge, NJ 07920 http://www.research.avayalabs.com/user/audris
More informationDefect Removal. RIT Software Engineering
Defect Removal Agenda Setting defect removal targets Cost effectiveness of defect removal Matching to customer & business needs and preferences Performing defect removal Techniques/approaches/practices
More informationGoal-Oriented Measurement plus System Dynamics A Hybrid and Evolutionary Approach
Goal-Oriented Measurement plus System Dynamics A Hybrid and Evolutionary Approach Dietmar Pfahl Fraunhofer Institute IESE pfahl@iese.fhg.de Günther Ruhe University of Calgary ruhe@ucalgary.ca 1. Aim and
More informationRECALL / EVENT INVESTIGATION & PATIENT LOOK BACK
RECALL / EVENT INVESTIGATION & PATIENT LOOK BACK Federal, State and AABB requirements for nonconforming product investigation and recipient look back for adverse impact Stacy Ralston MPH, CLS (ASCP), RAC
More informationOutline. What s inside this paper? My expectation. Software Defect Prediction. Traditional Method. What s inside this paper?
Outline A Critique of Software Defect Prediction Models Norman E. Fenton Dongfeng Zhu What s inside this paper? What kind of new technique was developed in this paper? Research area of this technique?
More informationReliability of feedback fechanism based on root cause defect analysis - case study
Annales UMCS Informatica AI XI, 4 (2011) 21 32 DOI: 10.2478/v10065-011-0037-0 Reliability of feedback fechanism based on root cause defect analysis - case study Marek G. Stochel 1 1 Motorola Solutions
More informationWarranty. Any attempt by an unauthorized person to alter or repair the product is also not covered by the warranty.
Warranty ii The Gentec-EO inc Holographic Beam Sampler carries a one year warranty (from date of shipment) against material and / or workmanship defects, when used under normal operating conditions. The
More informationTaking the Software Out of TSP
Taking the Software Out of TSP Implementing TSP on a Non-Software Team CGI GROUP INC. All rights reserved Jason Huibregtse TSP Symposium Sept. 2012 _experience the commitment TM Agenda Why TSP? Modifications
More information8. Reviews. Dilbert. Review objectives Formal design reviews (FDRs) Peer reviews. Comparison of peer reviews methods Expert opinions
8. Reviews Dilbert Review objectives Formal design reviews (FDRs) Peer reviews Inspections walkthroughs Comparison of peer reviews methods Expert opinions ppt by Galin, with major modifications by cah
More informationWestern Area Power Administration, Conditional Firm Transmission Service Business Practice
Western Area Power Administration Conditional Firm Transmission Service Business Practice Background: In Order No. 890, dated February 16, 2007, the Federal Energy Regulatory Commission ( FERC or Commission
More informationBarbara Brohl Executive Director & State Licensing Authority Colorado Department of Revenue
Barbara Brohl Executive Director & State Licensing Authority Colorado Department of Revenue 1 Background and History Colorado Industry Segments Legislative Process Rulemaking Process Regulatory & Enforcement
More informationC30-A2 ISBN ISSN Point-of-Care Blood Glucose Testing in Acute and Chronic Care Facilities; Approved Guideline Second Edition
ISBN 1-56238-471-6 ISSN 0273-3099 Point-of-Care Blood Glucose Testing in Acute and Chronic Care Facilities; Approved Guideline Second Edition Volume 22 Number 17 David B. Sacks, M.D., Chairholder Patricia
More informationFlowsheet Setup. 1. Define Treatment Protocols. 2. Define Treatment Cycles. 3. Define Flowsheets. Instructions. Protocol Instructions.
Flowsheet Setup Flowsheet Setup 1. Define Treatment Protocols Protocol Instructions 2. Define Treatment Cycles 3. Define Flowsheets Diagnostic Intercourse OI IVF Donor Recipient Surrogate IP Instructions
More informationApril 10, 2008 VIA ELECTRONIC MAIL
VIA ELECTRONIC MAIL Donna Pickett, MPH, RHIA Medical Classification Administrator National Center for Health Statistics 3311 Toledo Road Room 2402 Hyattsville, Maryland 20782 Dear Donna: The American Health
More informationESM and disposal of PCBs
ESM and disposal of PCBs Regional training workshop Kingston, February 2nd to 5th 2009 What does it mean? ESM stands for Environmentally Sound Management. Here sound means the state-of-the-art. What is
More informationSetting up deviation, incident, nonconformance. Presented by Debbie Parker 4 July, 2016
Setting up deviation, incident, nonconformance systems Presented by Debbie Parker 4 July, 2016 Introduction This session will cover: Regulations Definitions Process Case Study Setting up a new system Common
More informationPreparing a US FDA Medical Device 510(K) Submission
Preparing a US FDA Medical Device 510(K) Submission If you want to introduce your medical device to the US market, you need to obtain clearance from the FDA. This clearance is obtained from the FDA via
More informationMyWindFit Member Analytics Portal
Member Analytics Portal The member section of is a private and personalized cloud database that contains the detailed records of all your activity. It also contains an analysis package that enables you
More informationHEALTHCARE ASSOCIATED INFECTION PREVENTION AND CONTROL REPORT SEPTEMBER 2014
Borders NHS Board HEALTHCARE ASSOCIATED INFECTION PREVENTION AND CONTROL REPORT SEPTEMBER Aim The purpose of this paper is to update Board members of the current status of Healthcare Associated Infections
More informationThe National Hepatitis C Plan - Scotland
The National Hepatitis C Plan - Scotland Dr Nicola Rowan Scottish Government Dr John Dillon NHS Tayside University of Dundee Policy Introduction Hepatitis C Action Plan for Scotland Phase I: 2006-2008
More informationVIEW AS Fit Page! PRESS PgDn to advance slides!
VIEW AS Fit Page! PRESS PgDn to advance slides! UNDERSTAND REALIZE CHANGE WHY??? CHANGE THE PROCESSES OF YOUR BUSINESS CONNECTING the DOTS Customer Focus (W s) Customer Focused Metrics Customer Focused
More informationNote: This is an authorized excerpt from 2016 Healthcare Benchmarks: Digital Health To download the entire report, go to
Note: This is an authorized excerpt from 2016 Healthcare Benchmarks: Digital Health To download the entire report, go to http://store.hin.com/product.asp?itemid=5126 or call 888-446-3530. 2016 Healthcare
More informationA step forward full automatic analysis Silvère BARUT 1, Nicolas DOMINGUEZ 1, Jean-Noël NOIRET 2, Ivan KAMENEFF 3
6th International Symposium on NDT in Aerospace, 12-14th November 2014, Madrid, Spain - www.ndt.net/app.aerondt2014 More Info at Open Access Database www.ndt.net/?id=16928 A step forward full automatic
More informationSecond Quarter and First Half 2011 Conference Call. 29 July, SORIN GROUP Presentation 1
Second Quarter and First Half 2011 Conference Call 29 July, 2011 SORIN GROUP Presentation 1 DISCLAIMER This presentation contains management preliminary estimates and forward-looking statements, including
More information[HEALTH MAINTENANCE AND INVITATIONS/REMINDERS] June 2, 2014
Health Maintenance tab is located on the left side menu. Health Maintenance will assist with Meaningful Use, Stage 2 objectives. Meaningful Use, objective #6 states the following: Use clinical support
More informationErik van Veenendaal. Improve Quality Services BV. Onafhankelijk en objectief Innovatief en trendsettend (EU-projects/TU
Risk Based Testing in Practice Never speculate on that which can be known for certain Erik van Veenendaal (eve@improveqs.nl) PRISMA 1 Improve Quality Services BV Dienstverlenende organisatie op het gebied
More informationIEEE 803.af Management clause 33
IEEE 803.af Management clause 33 33.22 Management function requirements The MII Management Interface (see 22.2.4) is used to communicate PSE and PD information to the management entity. If a Clause 22
More information3/23/2012. Brand Building is Everyone s Business. Brands play a powerful role in our choices and actions as consumers.
Brand Building is Everyone s Business 2012 Transcend Hospice Marketing Group Brands play a powerful role in our choices and actions as consumers. A brand is short hand for what a company, product or service
More informationANNUAL REPORT
Surgical Hearing Implant Program Otolaryngology ANNUAL REPORT 2012-2013 Department Name 1 Executive Summary Vision To enrich communication and quality of life for Manitobans by delivering safe, accessible
More informationErgonomic Test of the Kinesis Contoured Keyboard
Global Ergonomic Technologies, Inc. Ergonomic Test of the Kinesis Contoured Keyboard Prepared by Wanda Smith, President Dan Cronin, Engineer December 16, 1992 Executive Summary A study was conducted of
More informationDiabetes Recognition Program (DRP) October 2018
Diabetes Recognition Program (DRP) October 2018 Overview Recognition Process Agenda Benefits of Recognition Resources DRP Basics Launched in 1997. Voluntary program; non punitive. Uses nationally recognized
More informationUsing USDA Food Products: Partner Agency Manual
Using USDA Food Products: Partner Agency Manual What is the USDA? The United States Department of Agriculture (USDA) is the United States federal executive department responsible for developing and executing
More informationCOMMITMENT. &SOLUTIONS Act like someone s life depends on what we do. TAKE THE FUZE SAFETY DESIGN QUIZ, PART I UNPARALLELED
TAKE THE FUZE SAFETY DESIGN QUIZ, PART I 61 st NDIA Fuze Conference, May 2018 Presented by: Homesh Lalbahadur Army Fuze Management Office ENTERPRISE AND SYSTEMS INTEGRATION CENTER (ESIC) / ARDEC UNPARALLELED
More informationActivated Transponder & Activator Instruction Manual
Activated Transponder & Activator Instruction Manual Westhold Corporation General Warranty Modules and other equipment ("Goods") purchased from Westhold Corporation are warranted against defects in materials
More informationGUIDE FOR TECHNICAL UPDATE OF PREFERENTIAL RULES OF ORIGIN
GUIDE FOR TECHNICAL UPDATE OF PREFERENTIAL RULES OF ORIGIN - How to update the existing Preferential Rules of Origin in relation to changes in the Harmonized System - DECEMBER 2015 (LAST UPDATED IN MAY
More informationVFC Inventory Reporting through GRITS Changes. Effective Friday, September 7, 2012
VFC Inventory Reporting through GRITS Changes Effective Friday, September 7, 2012 Summary of Changes Monthly Comprehensive Report and Vaccine Accountability Statement are available in one click. Both reports
More informationthe rest of our research. For be any correlation between outcome and the strength of the relationship according to the coach.
Are we sure as coaches we truly know and deliver what clients want? Anna Duckworth and Erik de Haan found some surprising evidence in their latest research the ties that Bind W hat s really the rest of
More informationSLEEP DISORDERED BREATHING The Clinical Conditions
SLEEP DISORDERED BREATHING The Clinical Conditions Robert G. Hooper, M.D. In the previous portion of this paper, the definitions of the respiratory events that are the hallmarks of problems with breathing
More informationAnalysis for [Intervention] ([Jurisdiction] Feasibility Study)
Outcome Analysis for [Intervention] ([Jurisdiction] Feasibility Study) DATE This template is intended for you to be able to fill in the indicated information within the brackets as it relates to your intervention
More informationEvaluation Survey Report
Evaluation Survey Report Court Interpreter Services in Nevada Courts NEVADA SUPREME COURT, ADMINISTRATIVE OFFICE OF THE COURTS May 2011 Andrea Krlickova, Certified Court Interpreter Program Coordinator
More informationNEPHROCHECK Calibration Verification Kit Package Insert
NEPHROCHECK Calibration Verification Kit Package Insert Manufactured for Astute Medical, Inc. 3550 General Atomics Ct. Building 2 San Diego, CA 92121 USA Intended Use The NEPHROCHECK Calibration Verification
More informationVISTA400 REMOVABLE FOOT PLATE. Instructions For Use. Step on yellow pedals to close and open legs to go around chairs & ambulate.
VISTA400 Instructions For Use Squeeze the yellow bar & push down/pull up to activate pneumatic stand assist. Step on yellow pedals to close and open legs to go around chairs & ambulate. Pull yellow levers
More informationAppendix 2 Quality assessment tools. Cochrane risk of bias tool for RCTs. Support for judgment
Appendix 2 Quality assessment tools Cochrane risk of bias tool for RCTs Item Judgment (H/L/Unclear) Random sequence generation (selection bias) Allocation concealment (selection bias) Blinding of participants
More informationComments on Consultative Report Governance arrangements for critical OTC derivatives data elements (other than UTI and UPI)
September 27, 2018 Secretariats of The Committee on Payments and Market Infrastructures The International Organization of Securities Commissions Comments on Consultative Report Governance arrangements
More informationSED2 Variable Frequency Drives Conventional Bypass (C-Bypass) Options
SED2 Variable Frequency Drives Conventional Bypass (C-Bypass) Options Product Description The SED2 Conventional Bypass (C-Bypass) Options are companion packages for the family of SED2 Variable Frequency
More informationDay 2 MER Analytics Exercise PMTCT Data Analysis
Background It is important to note that reviewing PMTCT data requires more than just comparing results to targets. This exercise will guide the user to review the PMTCT & EID cascade and coverage rates
More informationBIOSPECIMEN COLLECTION FORM
BIOSPECIMEN COLLECTION FORM ID NUMBER: FORM CODE: B I O DATE: 04/01/2016 Version 2.0 ADMINISTRATIVE INFORMATION 0a. Completion Date: / / 0b. Staff ID: Month Day Year 0c. Selected for additional phantom
More informationH. Lundbeck AS (LUN) - Financial and Strategic SWOT Analysis Review
H. Lundbeck AS (LUN) - Financial and Strategic SWOT Analysis Review H. Lundbeck AS (LUN) - Financial and Strategic SWOT Analysis Review BioPortfolio has been marketing business and market research reports
More informationE. SelectTech 5.1 Bench Owner s / Assembly Manual
000-6189.080118.E SelectTech 5.1 Bench Owner s / Assembly Manual Congratulations on your commitment to fitness and your purchase of the Bowflex SelectTech 5.1 Bench. Before assembling your Bowflex SelectTech
More informationInventory... 3 Inventory Types... 3 Contracting Entities Single Inventory Management... 3 FIFO... 4
Section 8000 Inventory and Records Table of Contents Inventory... 3 Inventory Types... 3 Contracting Entities... 3 Single Inventory Management... 3 FIFO... 4 School Food Authorities (SFAs) That Act as
More information4.0 Product Testing. 4.1 Routine Testing
4.0 Product Testing The MCIR program has established methods for testing new features prior to dissemination. Section 4.1 describes the routine testing processes. The defects identified through this process
More informationPSP Performance Analysis Report
PSP Performance Analysis Report Valentina Ivanova, PhD New Bulgarian University Contents: Personal Software Process Overview... 2 Planning Performance... 2 Size Estimating Performance... 2 Time Estimating
More informationProvider Dashboard User's Manual
Provider Dashboard User's Manual CAUTION: FEDERAL LAW RESTRICTS THIS DEVICE TO SALE BY OR ON THE ORDER OF A PHYSICIAN. IMPORTANT: READ THE SAEBOVR GETTING STARTED GUIDE (BAI-VOTA-LBL- 001) IN ITS ENTIRETY
More informationFirstGroup corporate responsibility data
FirstGroup corporate responsibility data Created June 2017 Covering 2016/17 Summary This document provides the corporate responsibility data for FirstGroup for the reporting year 2016/17. Unless otherwise
More informationAddressing the Opioid Crisis Workgroup: Treatment and Overdose Prevention
The Accountable Community for Health of King County Addressing the Opioid Crisis Workgroup: Treatment and Overdose Prevention May 7, 2018 1 Opiate Treatment & Overdose Prevention Project Goal Immediate:
More informationMeasurement. Different terminology. Marketing managers work with abstractions. Different terminology. Different terminology.
Different terminology Managerial view Marketing managers work with abstractions Concepts A generalized idea about a class of objects, attributes, occurrences or processes Propositions A set of concepts
More informationE. SelectTech 3.1 Bench Assembly / Owner s Manual
000-6190.121212.E SelectTech 3.1 Bench Assembly / Owner s Manual Congratulations on your commitment to fitness and your purchase of the Bowflex SelectTech 3.1 Bench. Before assembling your Bowflex SelectTech
More informationTreatment Adaptive Biased Coin Randomization: Generating Randomization Sequences in SAS
Adaptive Biased Coin Randomization: OBJECTIVES use SAS code to generate randomization s based on the adaptive biased coin design (ABCD) must have approximate balance in treatment groups can be used to
More informationB.C. Cannabis PRIVATE RETAIL LICENSING GUIDE Applications and Operations
B.C. Cannabis PRIVATE RETAIL LICENSING GUIDE Applications and Operations Copyright February 2018, Province of British Columbia. All rights reserved. This material is owned by the Government of British
More informationFor personal use only
HY18 Result Presentation 13 February 2018 Dig Howitt Brent Cubis CEO & President CFO HY18 Result highlights Strong momentum across developed markets continues Developed market unit growth up 12% Strengthening
More informationCurrent through Chapter 199 and Chapters of the 2015 Legislative Session
26-21-101. Short title. 26-21-101. Short title This article shall be known and may be cited as the "Colorado Commission for the Deaf and Hard of Hearing Act". Cite as C.R.S. 26-21-101 History. L. 2000:
More informationFault Detection and Localisation in Reduced Test Suites
UNIVERSITY OF SZEGED Fault Detection and Localisation in Reduced Test Suites Árpád Beszédes University of Szeged, Hungary The 29 th CREST Open Workshop, London November 2013 Overview University of Szeged,
More informationEHR Usability Test Report of OneTouch EMR
EHR Usability Test Report of OneTouch EMR Report based on ISO/IEC 25062:2006 Common Industry Format for Usability Test Reports OneTouch EMR, Version 2.0 Date of Usability Test: 5/11/2014 Date of Report:
More informationTHE LOCATOR OVERDENTURE IMPLANT SYSTEM PRODUCT ORDERING INFORMATION AND PRICE LIST
THE LOCATOR OVERDENTURE IMPLANT SYSTEM PRODUCT ORDERING INFORMATION AND PRICE LIST THE LOCATOR OVERDENTURE IMPLANT SYSTEM Each package includes your choice of a 2.4mm or 2.9mm narrow diameter LOCATOR Overdenture
More informationAquaJogg Hydro Treadmill
AquaJogg Hydro Treadmill PART #: F-WXAQJG 330 LB. [150 kg] MAXIMUM WEIGHT CAPACITY MANDATORY LEAVE THIS MANUAL WITH TREADMILL OWNER To assemble your equipment read entire manual and follow all instructions.
More informationSecond Regular Session Seventieth General Assembly STATE OF COLORADO INTRODUCED
Second Regular Session Seventieth General Assembly STATE OF COLORADO INTRODUCED LLS NO. 1-0.01 Michael Dohr x HOUSE BILL 1-1 HOUSE SPONSORSHIP Pabon, Conti, Court, Foote, Garnett, Kagan, Priola, Roupe,
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationPICTOR USER GUIDE V.1.0.R7
1 PICTOR USER GUIDE V.1.0.R7 2 Table of contents 1. Introduction 4 2. Explanation of symbols 5 3. Description of the device structure 5 4. Device setup 8 5. Advised exercises 9 6. Warnings 12 7. Contraindications
More informationIndustry s Perspective on the Status of Medical Device Regulations. FUNDISA Workshop 09 & 10 Oct Anele Vutha SAMED Regulatory Committee
Industry s Perspective on the Status of Medical Device Regulations FUNDISA Workshop 09 & 10 Oct 2014 Anele Vutha SAMED Regulatory Committee Today s Topics: 1. Medical Device Definition - Differences 2.
More informationCancer Immunotherapy Artificial Intelligence: Market Shares, Strategies, and Forecasts, 2017 to 2023
Cancer Immunotherapy Artificial Intelligence: Market Shares, Strategies, and Forecasts, 2017 to 2023 Table of Contents Cancer Immunotherapy Artificial Intelligence: Executive Summary The study is designed
More informationIBM s Watson supercomputer recommended unsafe and incorrect cancer treatments, internal documents show
IBM s Watson supercomputer recommended unsafe and incorrect cancer treatments, internal documents show By Casey Ross @caseymross and Ike Swetlitz @ikeswetlitz July 25, 2018 Alex Hogan/STAT Internal IBM
More informationFor personal use only
Cochlear Limited Results for the half year ended 31 December 2011 (H1 F12) Chris Roberts, CEO Neville Mitchell, CFO Cochlear Overview Cochlear Limited (ASX:COH): global leader in implantable devices for
More informationAn architecture description method for Acknowledged System of Systems based on Federated Architecture
An architecture description method for Acknowledged System of Systems based on Federated Architecture Jae-Hong Ahn 1, Yeunseung Ryu 2 and Doo-Kwon Baik 3 1 Agency for Defense Development, Korea koreaseman@daum.net
More informationHL7 Immunization User Group. Monthly Meeting July 12, :00 PM ET
HL7 Immunization User Group Monthly Meeting July 12, 2018 2:00 PM ET Agenda Welcome Poll: Which perspective do you primarily identify yourself with? Updates AIRA National Meeting SISC Update Discussion
More informationGEX Recommended Procedure Eff. Date: 07/27/07 Rev.: C Pg. 1 of 10
GEX Recommended Procedure Eff. Date: 07/27/07 Rev.: C Pg. 1 of 10 NOTICE: This document is version controlled and was produced as a part of the GEX Information Program which requires that all Series 100
More informationThe following report provides details about the strategic plan and the main accomplishments from the 2015 plan.
INTRODUCTION In Fall 2014, the Denver Public Health Strategic Planning Committee worked with staff and partners to develop the 2015-2017 Strategic Plan. From this plan, the annual 2015 implementation plan
More informationNEW YORK STATE DEPARTMENT OF HEALTH CLINICAL LABORATORY EVALUATION PROGRAM. Crosswalk of Proposed Revisions to Cytogenetics Standards
2014 Standard 2014 Guidance 2016 Standard 2016 Guidance Cytogenetics Standard 1 (CG S1) The laboratory shall request clinical information necessary for proper initiation of test procedures and interpretation
More informationCall for Applications
2013 Knowledge Synthesis Grant Program Call for Applications Program Guidelines Overview Technology Evaluation in the Elderly Network (TVN or the Network) is a new network funded by the Government of Canada
More informationFMEA AND RPN NUMBERS. Failure Mode Severity Occurrence Detection RPN A B
FMEA AND RPN NUMBERS An important part of risk is to remember that risk is a vector: one aspect of risk is the severity of the effect of the event and the other aspect is the probability or frequency of
More informationLAW ON MINERAL FERTILIZERS. Official Gazette of Bosnia and Herzegovina, 46/04
LAW ON MINERAL FERTILIZERS Official Gazette of Bosnia and Herzegovina, 46/04 Pursuant to Article IV.4.a) of the Constitution of Bosnia and Herzegovina, the Parliamentary Assembly of Bosnia and Herzegovina,
More informationOutcome Research Coding Protocol. Coding Studies and Rating the Level of Evidence for the. Causal Effect of an Intervention
Outcome Research Coding Protocol Coding Studies and Rating the Level of Evidence for the Causal Effect of an Intervention National Panel for Evidence-Based School Counseling June, 2005 School counseling
More informationEstimating the number of components with defects post-release that showed no defects in testing
SOFTWARE TESTING, VERIFICATION AND RELIABILITY Softw. Test. Verif. Reliab. 2002; 12:93 122 (DOI: 10.1002/stvr.235) Estimating the number of components with defects post-release that showed no defects in
More informationNevertheless, NSP grantees may retain some or all program income in the NSP program;
FREQUENTLY ASKED QUESTIONS REGARDING THE TRANSFER OF NEIGHBORHOOD STABILIZATION PROGRAM (NSP) PROGRAM INCOME U.S. Department of Housing and Urban Development Office of Community Planning and Development
More informationReports of Adverse Drug Reactions, etc. of Pharmaceuticals
(Attachment) Reports of Adverse Drug Reactions, etc. of Pharmaceuticals 1 GLOSSARY (1) Drugs, quasi-drugs, and cosmetics -1- Related to Article 228-20, paragraph 1, item 1 of the Enforcement Ordinance
More informationBuprenorphine Order Set and Rapid Access Referral. Copyright 2017, CAMH
2 Buprenorphine Order Set and Rapid Access Referral 1 Agenda Problem Identification / Identification Importance / Importance Baseline Workflow Baseline Workflow Baseline Data Baseline Data Objectives Solution
More informationLegislative Report: 5010/ICD-10 --------------------------------- WEDI EHR Work Group: Electronic Health Record Product and Vendor Profile Site (Draft) Robert M. Tennant MGMA Co-chair, WEDI EHR WG HR 4157
More informationStandard FAC Establish and Communicate System Operating Limits
A. Introduction 1. Title: Establish and Communicate System Operating Limits 2. Number: FAC-014-2 3. Purpose: To ensure that System Operating Limits (SOLs) used in the reliable planning and operation of
More informationCybex Free Weight Utility Bench Owner s and Service Manual Strength Systems Part Number B
www.cybexinternational.com Cybex Free Weight Utility Bench Owner s and Service Manual Strength Systems Part Number 16030-999-4 B Cybex Free Weight Utility Bench Owner s and Service Manual Strength Systems
More informationTABLE OF CONTENTS. Warning Label...1. Important Safety Instructions...2. Parts List...5. Assembly Instructions...6. Additional DVD Workouts...
OWNER S MANUAL TABLE OF CONTENTS TABLE OF CONTENTS Warning Label...1 Important Safety Instructions...2 Parts List...5 Assembly Instructions...6 Additional DVD Workouts...11 WARNING LABEL WARNING LABEL
More informationAssessing the efficacy of mobile phone interventions using randomised controlled trials: issues and their solutions. Dr Emma Beard
Assessing the efficacy of mobile phone interventions using randomised controlled trials: issues and their solutions Dr Emma Beard 2 nd Behaviour Change Conference Digital Health and Wellbeing 24 th -25
More informationVote-Counting Method to Obtain an Estimate and Confidence Interval for the Population Correlation Coefficient Using SASI AFo
Vote-Counting Method to Obtain an Estimate and Confidence Interval for the Population Correlation Coefficient Using SASI AFo Frank C. Lieble m, SAS Institute Inc., Orlando, Florida Morgan C. Wang, University
More informationMILLENIUM SCIENCE COMPLEX
GLOVE BOX MILLENIUM SCIENCE COMPLEX Opened in 2012 Essentially two separate buildings Materials Research Institute and Huck Institute of Life Science $225 million to build 275, 600 square feet 66 fume
More informationPATENCY-1 Top-Line Results
PATENCY-1 Top-Line Results December 13, 2016 2016 Proteon Therapeutics, Inc. Cautionary Note Regarding Forward-Looking Statements This presentation contains statements that are, or may be deemed to be,
More informationIndirect Food Additives: Adhesives and Components of Coatings and Paper and Paperboard Components
4 DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration 21 CFR Parts 175 and 176 [Docket No. 99F-09253 Indirect Food Additives: Adhesives and Components of Coatings and Paper and Paperboard
More informationICD-10-CM Topics. November 15, 2012 VIA ELECTRONIC MAIL
VIA ELECTRONIC MAIL Donna Pickett, MPH, RHIA Medical Classification Administrator National Center for Health Statistics 3311 Toledo Road Room 2402 Hyattsville, Maryland 20782 Dear Ms. Pickett: The American
More informationHearing Conservation Program Evaluation Checklist
Hearing Conservation Program Evaluation Checklist Training and Education Yes No N/A Comments 1. Is training conducted at least once a year? 2. Is the training provided by a qualified instructor? 3. Is
More information36th Annual J.P. Morgan Healthcare Conference. Kevin Conroy, Chairman and CEO January 9, 2018
36th Annual J.P. Morgan Healthcare Conference Kevin Conroy, Chairman and CEO January 9, 2018 1 Safe harbor statement This presentation contains forward-looking statements within the meaning of Section
More information