Our next questions are about Contingency Management.
|
|
- Rosemary Richards
- 6 years ago
- Views:
Transcription
1 II.B Our next questions are about Contingenc t. Higgins and Petr (1999) describe Contingenc t as the sstematic reinforcement of desired behaviors and the withholding of reinforcement or punishment of undesired behaviors. Desired behaviors that can be the target of Contingenc t can include abstinence from substance use and participation in treatment. Random drug testing is often used as part of a Contingenc t program. There are a number of substance abuse treatment manuals and books that include Contingenc t as a major component of treatment, including the following: Contingenc t Strategies and Ideas Contingenc t in Substance Abuse Treatment Prize Incentives Contingenc t for Substance Abuse 01. Are ou familiar with Contingenc t? 1 es [GO TO QUESTION 01_1a] 0 no [GO TO QUESTION MM01]
2 II.B _1aa 01_1ab 01_1ac 01_1ad 01_1ae 01_1af 01_1ag 01_1ah 01_1ai 01_1aj 01_1ak 01_1ak_sp ec 01_1a. How did ou and our staff learn about Contingenc t? Choose all that appl a. in school b. b attending a seminar, conference, or workshop c. b reading journal articles d. b reviewing the treatment manual e. b finding information on the internet f. b attending a training for a specific contingenc management approach g. b working with a consultant h. b discussing it with colleagues and other treatment programs that have experience with it i. through a clinical supervisor or training program j. b participating in research k. Other (please specif):
3 II.B _1b 01_1b. Which of these choices best summarizes our knowledge and experience with Contingenc t? a We are not interested in Contingenc t and do not think it would be effective in our program. [IF SELECTED, GO TO QUESTION 01_2b] b We have considered Contingenc t but see man pros and cons. [IF SELECTED, GO TO QUESTION 01_3b] c We are planning on using Contingenc t in our program, but we haven t used it et. [IF SELECTED, GO TO QUESTION 01_4b] d We are using Contingenc t in our program, but we haven t decided whether we are going to make it a permanent part of our program. [IF SELECTED, GO TO QUESTION 01_5b] e We have made Contingenc t a permanent part of our f program. [IF SELECTED, GO TO QUESTION 01_6b] We have used Contingenc t in our program in the past, but don t use it currentl. [IF SELECTED, GO TO QUESTION 01_7b]
4 II.B _2ba 01_2bb 01_2bc 01_2bd 01_2be 01_2bf 01_2bg 01_2bh 01_2bi 01_2bj 01_2bj_spe c II.B _2c 01_2b. What are the reasons ou think Contingenc t would not be effective in our program? Choose all that appl a it isn t consistent with our program s treatment approach and philosoph b it isn t culturall appropriate c it is too structured and we need more flexibilit d it hasn t been studied enough with American Indians or Alaska Natives e it doesn t fit well with the other treatments we use in our program f it is too expensive and/or time consuming g we don t have the appropriate staff to do this in our program h the training is too expensive and/or too difficult to access/arrange i some of m staff would refuse to use it j Other (please specif): 01_2c. Do ou feel an pressure to use Contingenc t in our program? 1 es [GO TO QUESTION 01_2d] 0 no [GO TO QUESTION MM01]
5 II.B _2da 01_2db 01_2dc 01_2dd 01_2de 01_2df 01_2dg 01_2dh 01_2dh_sp ec 01_2d. From what sources do ou feel this pressure to use Contingenc t in our program? Choose all that appl a our clients b our program s clinical staff c our supervisor d tribal/program leadership e state accreditation organization/single State Authorities f Medicaid, Medicare, or other insurance requirements g grant requirements h Other (please specif): [GO TO QUESTION MM01]
6 II.B _3ba 01_3bb 01_3bc 01_3bd 01_3be 01_3bf 01_3bg 01_3bh 01_3bi 01_3bj 01_3bj_spe c 01_3b. What do ou see as the pros of Contingenc t? Choose all that appl a. it is consistent with our program s treatment approach and philosoph b. it is culturall appropriate c. the existing research base proves it is effective d. it is innovative and promotes good practice e. it fits with the expertise and training of our staff f. it ensures consistent and standardized treatment within our program g. it is a billable service h. it can be marketed for political purposes and/or funding requests i. its raises the reputation of our program j. Other (please specif):
7 II.B _3ca 01_3cb 01_3cc 01_3cd 01_3ce 01_3cf 01_3cg 01_3ch 01_3ci 01_3cj 01_3cj_spe c II.B _3d 01_3c. What do ou see as the cons of Contingenc t? Choose all that appl a it isn t consistent with our program s treatment approach and philosoph b it isn t culturall appropriate c it is too structured and we need more flexibilit d it hasn t been studied enough with American Indians or Alaska Natives e it doesn t fit well with the other treatments we use in our program f it is too expensive and/or time consuming g we don t have the appropriate staff to do this in our program h the training is too expensive and/or too difficult to access/arrange i some of m staff would refuse to use it j Other (please specif): 01_3d. Do ou feel an pressure to use Contingenc t in our program? 1 es [GO TO QUESTION 01_3e] 0 no [GO TO QUESTION MM01]
8 II.B _3ea 01_3eb 01_3ec 01_3ed 01_3ee 01_3ef 01_3eg 01_3eh 01_3eh_sp ec 01_3e. From what sources do ou feel this pressure to use Contingenc t in our program? Choose all that appl a our clients b our program s clinical staff c our supervisor d tribal/program leadership e state accreditation agenc/single State Authorit f Medicaid, Medicare, or other insurance requirements g grant requirements h Other (please specif): [GO TO QUESTION MM01]
9 II.B _4ba 01_4bb 01_4bc 01_4bd 01_4be 01_4bf 01_4bg 01_4bh 01_4bi 01_4bj 01_4bj_spe c 01_4b. What do ou and our staff like about Contingenc t? Choose all that appl a it is consistent with our program s treatment approach and philosoph b it is culturall appropriate c the existing research base proves it is effective d it is innovative and promotes good practice e it fits with the expertise and training of our staff f it ensures consistent and standardized treatment within our program g it is a billable service h it can be marketed for political purposes and/or funding requests i its use raises the reputation of our program j Other (please specif):
10 II.B _4ca 01_4cb 01_4cc 01_4cd 01_4ce 01_4cf 01_4cg 01_4ch 01_4ch_sp ec 01_4c. How do ou plan on preparing our staff for using Contingenc t? Choose all that appl a b attending a seminar, conference, or workshop b b reading journal articles c b reviewing a treatment manual d b reviewing information on the internet e b attending a training for a specific contingenc management approach f b working with a consultant g b discussing it with colleagues and other treatment programs that have experience with it h Other (please specif):
11 II.B _4d 01_4d_1a 01_4d_1b 01_4d_1c 01_4d_1d 01_4d_1d_ spec 01_4d. How will ou use Contingenc t in our program? a we will use it exactl how it is described in the manual and/or trainings b we will use the parts of manual we think are most helpful c we will rewrite the manual to make it more culturall appropriate and/or fit better with our overall program d we won t use the manual itself but will use the concepts that are part of the intervention, such as the sstematic reinforcement of desired behaviors 01_4d_1. Which Contingenc t manual(s) are ou thinking of using in our program? Choose all that appl a Contingenc t Strategies and Ideas b Contingenc t in Substance Abuse Treatment c Prize Incentives Contingenc t for Substance Abuse d Other (please specif):
12 II.B _4e 01_4fa 01_4fb 01_4fc 01_4fd 01_4fe 01_4ff 01_4fg 01_4fh 01_4fi 01_4fj 01_4fk 01_4fk_spe c 01_4e. How do ou plan on using Contingenc t in our program? a it will be a core component of our program and ever client will receive it b it will be used with clients that will be most likel to benefit from it c we haven t decided how we are going to use it in our program 01_4f. Do ou and our staff have an of the following concerns about using Contingenc t in our program? Choose all that appl a we are concerned that it isn t full consistent with our program s treatment approach and philosoph b we are concerned about its cultural appropriateness c we worr that it is too structured and we need more flexibilit d we are concerned that it hasn t been studied enough with American Indians or Alaska Natives e we aren t sure if it will fit well with the other treatments we use in our program f we are concerned it is too expensive and/or time consuming to use g we are concerned that we ma not have the appropriate staff to implement it effectivel h we are concerned that the training is too expensive and/or too difficult to access/arrange i we are concerned that some of our staff would refuse to use it j we have no concerns about it k Other (please specif):
13 II.B _4g 01_4g. Do ou feel an pressure to use Contingenc t in our program? 1 es [GO TO QUESTION 01_4h] 0 no [GO TO QUESTION MM01]
14 II.B _4ha 01_4hb 01_4hc 01_4hd 01_4he 01_4hf 01_4hg 01_4hh 01_4hh_sp ec 01_4i 01_4h. From what sources do ou feel this pressure to use Contingenc t in our program? Choose all that appl a our clients b our program s clinical staff c our supervisor d tribal/program leadership e state accreditation organization/single State Authorit f Medicaid, Medicare, or other insurance requirements g grant requirements h Other (please specif): 01_4i. Are these pressures part of the reason ou are considering using Contingenc t in our program? 1 es 0 no [GO TO QUESTION MM01]
15 II.B _5b II.B _5c 01_5b. How long have ou used Contingenc t in our program? a less than 6 months b 6 months to 1 ear c 2 to 5 ears d more than 5 ears 01_5c. Did ou feel an pressure to use Contingenc t in our program? 1 es [GO TO QUESTION 01_5d] 0 no [GO TO QUESTION 01_5f]
16 II.B _5da 01_5db 01_5dc 01_5dd 01_5de 01_5df 01_5dg 01_5dh 01_5dh_sp ec 01_5e 01_5d. From what sources did ou feel this pressure to use Contingenc t in our program? Choose all that appl a our clients b our program s clinical staff c our supervisor d tribal/program leadership e state accreditation organization/single State Authorit f Medicaid, Medicare, or other insurance requirements g grant requirements h Other (please specif): 01_5e. Are these pressures part of the reason ou are using Contingenc t in our program? 1 es 0 no
17 II.B _5fa 01_5fb 01_5fc 01_5fd 01_5fe 01_5ff 01_5fg 01_5fh 01_5fi 01_5fj 01_5fk 01_5fl 01_5fl_spe c 01_5f. What were the other reasons that ou and our staff decided to use Contingenc t in our program? Choose all that appl a it is consistent with our program s treatment approach and philosophies b it is culturall appropriate c the existing research base proves it is effective d it is innovative and promotes good practice e it fits with the expertise and training of our staff f it ensures consistent and standardized treatment within our program g it is a billable service h it can be marketed for political purposes and/or funding requests i its use raises the reputation of our program j No other reasons k don t know we made this decision before I joined the program l Other (please specif):
18 II.B _5ga 01_5gb 01_5gc 01_5gd 01_5ge 01_5gf 01_5gg 01_5gh 01_5gh_sp ec 01_5g. How did our staff prepare for using Contingenc t in our program? Choose all that appl a b attending a seminar, conference, or workshop b b reading journal articles c b reviewing a treatment manual d b reviewing information on the internet e b attending a training for a specific contingenc management approach f b working with a consultant g b discussing it with colleagues and other treatment programs that have experience with it h Other (please specif):
19 II.B _5h 01_5h_1a 01_5h_1b 01_5h_1c 01_5h_1d 01_5h_1d_ spec 01_5h. How do ou and our staff use Contingenc t in our program? a we use it exactl how it is described in the manual and/or trainings b we use the parts of manual we think are most helpful c we rewrote the manual to make it more culturall appropriate and/or fit better with our overall program d we don t use the manual itself but will use the concepts that are part of the intervention, such as the sstematic reinforcement of desired behaviors 01_5h_1. Which Cognitive Behavioral Therap manual(s) are ou thinking of using in our program? Choose all that appl a Contingenc t Strategies and Ideas b Contingenc t in Substance Abuse Treatment c Prize Incentives Contingenc t for Substance Abuse d Other (please specif):
20 II.B _5i 01_5ja 01_5jb 01_5jc 01_5jd 01_5je 01_5jf 01_5jf_spe c 01_5k 01_5i. How do ou and our staff use Contingenc t in our program? a it is a core component of our program and ever client receives it b we use it with clients that will most likel benefit from it 01_5j. How do ou evaluate the outcomes of Contingenc t in our program? Choose all that appl a staff meetings and discussions b client satisfaction questionnaires c client outcomes surves and interviews d treatment record audits/reviews e we haven t evaluated it f Other (please specif): 01_5k. How effective has Contingenc t been in our program? a not effective at all b somewhat effective c ver effective
21 II.B _5l_1 01_5l_2 01_5l_3 01_5l_1. How satisfied are ou with Contingenc t? a not satisfied b somewhat satisfied c ver satisfied 01_5l_2. How satisfied are our staff with Contingenc t? a not satisfied b somewhat satisfied c ver satisfied 01_5l_3. How satisfied are our clients with Contingenc t? a not satisfied b somewhat satisfied c ver satisfied
22 II.B _5na 01_5nb 01_5nc 01_5nd 01_5ne 01_5nf 01_5ng 01_5ng_sp ec 01_5n. How do ou monitor our staff s use of Contingenc t in our program? Choose all that appl a staff meetings b individual discussions with clinical supervisor c treatment record audits/reviews d reviews of audio or video recordings of sessions e direct observation of sessions b clinical supervisor f we haven t monitored our staff s use of Contingenc t g Other (please specif):
23 II.B _5oa 01_5ob 01_5oc 01_5od 01_5oe 01_5of 01_5og 01_5oh 01_5oi 01_5oj 01_5ok 01_5ok_sp ec 01_5o. Do ou and our staff have an of the following concerns about using Contingenc t in our program? Choose all that appl a it isn t full consistent with our program s treatment approach and philosoph b we are concerned about its cultural appropriateness c it is too structured and we need more flexibilit in treating our clients d we are concerned that it hasn t been studied enough with American Indians or Alaska Natives e it doesn t fit well with the other treatments we use in our program f it is expensive and/or time consuming g we are concerned that we reall don t have the appropriate staff to use it effectivel in our program h the training is too expensive and/or too difficult to access/arrange i some of our staff refuse to use it j we have no concerns about it k Other (please specif):
24 II.B _5pa 01_5pb 01_5pc 01_5pd 01_5pe 01_5pf 01_5pg 01_5ph 01_5pi 01_5pj 01_5pj_spe c 01_5p. Wh are ou unsure whether ou will make Contingenc t a permanent part of our program? Choose all that appl a it isn t consistent with our program s treatment approach and philosoph b it isn t culturall appropriate c it is too structured and we need more flexibilit in treating our clients d it hasn t been studied enough with American Indians or Alaska Natives e it doesn t fit well with the other treatments we use in our program f it is too expensive and/or time consuming g we don t have the appropriate staff to do this in our program h the training is too expensive and/or too difficult to access/arrange i some of m staff would refuse to use it j Other (please specif): [GO TO QUESTION MM01]
25 II.B _6b II.B _6c 01_6b. How long have ou used Contingenc t in our program? a less than 6 months b 6 months to 1 ear c 2 to 5 ears d more than 5 ears 01_6c. Did ou feel an pressure to use Contingenc t in our program? 1 es [GO TO QUESTION 01_6d] 0 no [GO TO QUESTION 01_6f]
26 II.B _6da 01_6db 01_6dc 01_6dd 01_6de 01_6df 01_6dg 01_6dh 01_6dh_sp ec 01_6e 01_6d. From what sources did ou feel this pressure to use Contingenc t in our program? Choose all that appl a our clients b our program s clinical staff c our supervisor d tribal/program leadership e state accreditation organization/single State Authorit f Medicaid, Medicare, or other insurance requirements g grant requirements h Other (please specif): 01_6e. Are these pressures part or all of the reason ou are using Contingenc t in our program? 1 es 0 no
27 II.B _6fa 01_6fb 01_6fc 01_6fd 01_6fe 01_6ff 01_6fg 01_6fh 01_6fi 01_6fj 01_6fk 01_6fl 01_6fl_spe c 01_6f. What were the other reasons that ou and our staff decided to use Contingenc t in our program? Choose all that appl a it is consistent with our program s treatment approach and philosophies b it is culturall appropriate c the existing research base proves it is effective d it is innovative and promotes good practice e it fits with the expertise and training of our staff f it ensures consistent and standardized treatment within our program g it is a billable service h it can be marketed for political purposes and/or funding requests i its use raises the reputation of our program j No other reasons k don t know we made this decision before I joined the program l Other (please specif):
28 II.B _6ga 01_6gb 01_6gc 01_6gd 01_6ge 01_6gf 01_6gg 01_6gh 01_6gh_sp ec 01_6g. How did our staff prepare for using Contingenc t in our program? Choose all that appl a b attending a seminar, conference, or workshop b b reading journal articles c b reviewing a treatment manual d b reviewing information on the internet e b attending a training for a specific contingenc management approach f b working with a consultant g b discussing it with colleagues and other treatment programs that have experience with it h Other (please specif):
29 II.B _6h 01_6h_1a 01_6h_1b 01_6h_1c 01_6h_1d 01_6h_1d_ spec 01_6h. How do ou and our staff use Contingenc t manual in our program? a we use it exactl how it is described in the manual and/or trainings b we use the parts of manual we think are most helpful c we rewrote the manual to make it more culturall appropriate and/or fit better with our overall program d we don t use the manual itself but use ke concepts that are part of the intervention, such as the sstematic reinforcement of desired behaviors 01_6h_1. Which Cognitive Behavioral Therap manual(s) are ou thinking of using in our program? Choose all that appl a Contingenc t Strategies and Ideas b Contingenc t in Substance Abuse Treatment c Prize Incentives Contingenc t for Substance Abuse d Other (please specif):
30 II.B _6i 01_6ja 01_6jb 01_6jc 01_6jd 01_6je 01_6jf 01_6jf_spe c 01_6k 01_6i. How do ou and our staff use Contingenc t in our program? a it is a core component of our program and ever client receives it b we use it with clients that are most likel to benefit from it 01_6j. How do ou evaluate the outcomes of Contingenc t in our program? Choose all that appl a staff meetings and discussions b client satisfaction questionnaires c client outcomes surves and interviews d treatment record audits/reviews e Other (please specif): f we haven t evaluated it 01_6k. How effective has Contingenc t been in our program? a not effective at all b somewhat effective c ver effective
31 II.B _6l_1 01_6l_2 01_6l_3 01_6l_1. How satisfied are ou with Contingenc t? a not satisfied b somewhat satisfied c ver satisfied 01_6l_2. How satisfied are our staff with Contingenc t? a not satisfied b somewhat satisfied c ver satisfied 01_6l_3. How satisfied are our clients with Contingenc t? a not satisfied b somewhat satisfied c ver satisfied
32 II.B _6oa 01_6ob 01_6oc 01_6od 01_6oe 01_6of 01_6og 01_6og_sp ec 01_6o. How do ou monitor how well our staff uses Contingenc t in our program? Choose all that appl a staff meetings b individual discussions with clinical supervisor c treatment record audits/reviews d reviews of audio or video recordings of sessions e direct observation of sessions b clinical supervisor f we haven t monitored our staff s use of Contingenc t g Other (please specif):
33 II.B _6pa 01_6pb 01_6pc 01_6pd 01_6pe 01_6pf 01_6pg 01_6ph 01_6pi 01_6pj 01_6pk 01_6pk_sp ec 01_6p. Do ou and our staff have an of the following concerns about using Contingenc t in our program? Choose all that appl a it isn t full consistent with our program s treatment approach and philosoph b we are concerned about its cultural appropriateness c it is too structured and we need more flexibilit in treating our clients d we are concerned that it hasn t been studied enough with American Indians or Alaska Natives e it doesn t fit well with the other treatments we use in our program f it is expensive and/or time consuming to use g we are concerned that we reall don t have the appropriate staff to use it effectivel in our program h the training is too expensive and/or too difficult to access/arrange i some of our staff refuse to use it j we have no concerns k Other (please specif):
34 II.B _6qa 01_6qb 01_6qc 01_6qd 01_6qe 01_6qf 01_6qg 01_6qh 01_6qi 01_6qj 01_6qk 01_6ql 01_6ql_spe c 01_6q. Wh did ou decide to make Contingenc t a permanent part of our program? Choose all that appl a it is effective b our clients like it c it is billable d it is consistent with our program s treatment approach and philosoph e it is culturall appropriate f it fits with the expertise and training of our staff g it fits well with the other treatments we use in our program h it is innovative and promotes good practice i it ensures consistent and standardized treatment within our program j it can be marketed for political purposes and/or funding requests k its use raises the reputation of our program l Other (please specif): GO TO QUESTION MM01
35 II.B _7b 01_7c II.B _7d 01_7b. How long did ou use Contingenc t in our program? a less than 6 months b 6 months to 1 ear c 2 to 5 ears d more than 5 ears 01_7c. How long ago did ou stop using Contingenc t in our program? a less than 6 months ago b 6 months to 1 ear ago c 2 to 5 ears ago d more than 5 ears ago 01_7d. Did ou feel an pressure to use Contingenc t in our program? 1 es [GO TO QUESTION 01_7e] 0 no [GO TO QUESTION 01_7g]
36 II.B _7ea 01_7eb 01_7ec 01_7ed 01_7ee 01_7ef 01_7eg 01_7eh 01_7eh_sp ec 01_7f 01_7e. From what sources did ou feel this pressure to use Contingenc t in our program? Choose all that appl a our clients b our program s clinical staff c our supervisor d tribal/program leadership e state accreditation organization/single State Authorit f Medicaid, Medicare, or other insurance requirements g grant requirements h Other (please specif): 01_7f. Are these pressures part or all of the reason ou used Contingenc t in our program? 1 es 0 no
37 II.B _7ga 01_7gb 01_7gc 01_7gd 01_7ge 01_7gf 01_7gg 01_7gh 01_7gi 01_7gj 01_7gk 01_7gk_sp ec 01_7g. What were the other reasons that ou and our staff decided to use Contingenc t in our program? Choose all that appl a it is consistent with our program s treatment approach and philosoph b it is culturall appropriate c the existing research base proves it is effective d it is innovative and promotes good practice e it ensures consistent and standardized treatment within our program f it is a billable service g it can be marketed for political purposes and/or funding requests h its use raises the reputation of our program i No other reasons j don t know we made this decision before I joined the program k Other (please specif):
38 II.B _7ha 01_7hb 01_7hc 01_7hd 01_7he 01_7hf 01_7hg 01_7hh 01_7hh_sp ec 01_7h. How did our staff prepare for using Contingenc t in our program? Choose all that appl a b attending a seminar, conference, or workshop b b reading journal articles c b reviewing a treatment manual d b reviewing information on the internet e b attending a training for a specific contingenc management approach f b working with a consultant g b discussing it with colleagues and other treatment programs that have experience with it h Other (please specif):
39 II.B _7i 01_7i_1a 01_7i_1b 01_7i_1c 01_7i_1d 01_7i_1d_s pec 01_7i. How did ou and our staff use Contingenc t in our program? a we used it exactl how it is described in the manual and/or trainings b we used the parts of manual we think are most helpful c we rewrote the manual to make it more culturall appropriate and/or fit better with our overall program d we didn t use the manual itself but will use the concepts that are part of the intervention, such as the sstematic reinforcement of desired behaviors 01_7i_1. Which Cognitive Behavioral Therap manual(s) are ou thinking of using in our program? Choose all that appl a Contingenc t Strategies and Ideas b Contingenc t in Substance Abuse Treatment c Prize Incentives Contingenc t for Substance Abuse d Other (please specif):
40 II.B _7j 01_7ka 01_7kb 01_7kc 01_7kd 01_7ke 01_7ke_sp ec 01_7kf 01_7l 01_7j. How did ou and our staff use Contingenc t in our program? a it is a core component of our program and ever client receives it b we use it with clients that are most likel to benefit from it 01_7k. How did ou evaluate the outcomes of Contingenc t in our program? Choose all that appl a staff meetings and discussions b client satisfaction questionnaires c client outcomes surves and interviews d treatment record audits/reviews e Other (please specif): f we didn t evaluate it 01_7l. How effective was Contingenc t in our program? a not effective at all b somewhat effective c ver effective
41 II.B _7l_1 01_7l_2 01_7l_3 01_7l_1. How satisfied were ou with Contingenc t? a not satisfied b somewhat satisfied c ver satisfied 01_7l_2. How satisfied were our staff with Contingenc t? a not satisfied b somewhat satisfied c ver satisfied 01_7l_3. How satisfied were our clients with Contingenc t? a not satisfied b somewhat satisfied c ver satisfied
42 II.B _7pa 01_7pb 01_7pc 01_7pd 01_7pe 01_7pf 01_7pg 01_7pg_sp ec 01_7p. How did ou monitor our staff s use of Contingenc t in our program? Choose all that appl a staff meetings and discussions b clinical supervision c treatment record audits/reviews d reviews of audio or video recordings of sessions e direct observation of sessions b clinical supervisor f we haven t monitored our staff s use of Contingenc t g Other (please specif):
43 II.B _7qa 01_7qb 01_7qc 01_7qd 01_7qe 01_7qf 01_7qg 01_7qh 01_7qi 01_7qj 01_7qk 01_7qk_sp ec 01_7q. Did ou and our staff have an of the following concerns about using Contingenc t in our program? Choose all that appl a it wasn t full consistent with our program s treatment approach and philosoph b we were concerned about its cultural appropriateness c it was too structured and we need more flexibilit in treating our clients d we were concerned that it hasn t been studied enough with American Indians or Alaska Natives e it didn t fit well with the other treatments we use in our program f it was too expensive and/or time consuming to use g we were concerned that we reall don t have the appropriate staff to use it effectivel in our program h the training was too expensive and/or too difficult to access/arrange i some of our staff refused to use it j we had no concerns about it k Other (please specif):
44 II.B _7ra 01_7rb 01_7rc 01_7rd 01_7re 01_7rf 01_7rg 01_7rh 01_7ri 01_7rj 01_7rj_spe c 01_7r. Wh did ou stop using Contingenc t in our program? Choose all that appl a it wasn t effective for our clients b our clients didn t like it c it was too expensive and/or too time consuming to use d it wasn t full consistent with our program s treatment approach and philosoph e we were concerned about its cultural appropriateness f it was too structured and we need more flexibilit in treating our clients g it didn t fit well with the other treatments we use in our program h we didn t have the appropriate staff to continue to use it in our program i some of our staff refused to use it j Other (please specif): [GO TO QUESTION MM01]
Our next questions are about Multisystemic Therapy.
II.B.10.01 01 Our next questions are about Multisys Therapy. The National Registry of Evidene-Based Praties and Programs (NREPP) desribes Multisys Therapy as follows: Multisys Therapy () for juvenile offenders
More informationDeclaration of conformity Adapter
Declaration of conformity acc. to VO (EG) 1935/2004 and VO (EU) 10/2011 as well as acc. to FDA Document ID: 34466 Editing status: 2017-05-19 2 CFR FDA stands for Food and Drug Administration, a U.S. authority.
More information!"#$%&" '($&)*+,"-.(/%*+,"
!"#$%&" '($&)*+,"-.(/%*+," 01%/2),3"4).5"61%7$28"6%9)$5"%$"#/2++7! The Healthy Schools Partnership: Innovative Energy Balance Programming with RD Nutrition Coaches :%871"6%815;"
More informationFINAL TOPLINE. Diabetes Group. Qualities That Matter: Public Perceptions of Quality in Diabetes Care, Joint Replacement and Maternity Care
FINAL TOPLINE Group Qualities That Matter: Public Perceptions of Quality in Care, Joint Replacement and Maternity Care National Survey of adults recently diagnosed with type 2 diabetes about their perceptions
More informationIPC REVISION WORKING GROUP. Ninth Session Geneva, June 2 to 13, 2003
E IPC/WG/9/3 ORIGINAL: English only DATE: May 23, 2003 WORLD INTELLECTUAL PROPERTY ORGANIZATION GENEVA SPECIAL UNION FOR THE INTERNATIONAL PATENT CLASSIFICATION (IPC UNION) IPC REVISION WORKING GROUP Ninth
More informationNCHA Financial Feature
NCHA Financial Feature November 2, 2018 CMS Finalizes Calendar Year 2019 Payments and 2020 Policy Changes for Home Health Agencies and Home Infusion Therapy Suppliers The Centers for Medicare and Medicaid
More informationSpherical Bearings Heavy Duty Equipments
Spherical Bearings Heavy Duty Equipments Highlights Quality Service Price Wbf Replacement Parts adaptableto > Caterpillar >Komatsu >Volvo 1 WBF SPHERICAL BEARINGS adaptable to Caterpillar Part No. Description
More informationSurvey Title: Employee Engagement Survey Report Type: Top 5 High Schools with High Turnover
Survey Title: 2017-2018 Employee Engagement Survey Report Type: Top 5 High Schools with High Turnover Q24(c). I am engaged in my work. Strongly Disagree + Disagree 2 1.71% 1 0.78% 1 0.64% 1 0.61% 3 2.33%
More informationDeclaration of conformity VEGAVIB 61
Declaration of conformity acc. to VO (EG) 1935/2004 and VO (EU) 10/2011 as well as acc. to FDA Document ID: 32556 Editing status: 2016-10-25 2 CFR FDA stands for Food and Drug Administration, a U.S. authority.
More informationChapter 5 A Dose Dependent Screen for Modifiers of Kek5
Chapter 5 A Dose Dependent Screen for Modifiers of Kek5 "#$ ABSTRACT Modifier screens in Drosophila have proven to be a powerful tool for uncovering gene interaction and elucidating molecular pathways.
More informationThe Effects of Hydrophilic Contact Lens Wear on the Reduction of Progressive Myopia in Adolescents. by Bob Deck
The Effects of Hydrophilic Contact Lens Wear on the Reduction of Progressive Myopia in Adolescents by Bob Deck The purpose of this retrospective study was to evaluate the effects of hydrophilic contact
More information!!!!!! C<&<3#<+!8%3%9%+!?D!&(012%3E&>.&-<370%!!!!!!!!!!!!!!!
"#$"%"&'()*(+#,,-.(/#0&1(23"%."45(6)47&038&")4("4(6)%.(6%",#&-7( "#$%&#'() * +,$--.//,(012%3 4 *56"078%39(9%#.+:.;%.3#.&-+C
More informationFri Nov 02 09:11:33 EDT 2012 QIES Workbench. Record Layout Report
file:///c:/users/hpmresdacsw1/appdata/local/temp/qwu_j78975_p1_mds_3 NH_... Page 1 of 24 11/27/212 Fri Nov 2 9:11:33 EDT 212 QIES Workbench Record Layout Report For Job: MDS 3. NH All Elements 4/1/212
More informationALLTRADE FORKLIFT PARTS PTE LTD
ATTENTION PAGE : 1 (HALLA) FAC0300060 FAC0300080 FAC0311070 FAC0311240 FAD0300600 OK675-15-010 OK675-15-082 OS211-15-173 OS213-15-172 QK0905-15 (HANGCA) 053022 053023 198911A 36010-L9000-G00 40DH-512000
More informationEOPS PROBATION STUDENT LIST
EOPS PROBATION STUDENT LIST Fall 2018 EOPS The following students have been placed on EOPS Probation due to their not satisfying the semester g.p.a. and/or semester units completed requirements of the
More informationSeek, Test, Treat and Retain for Vulnerable Populations: Data Harmonization Measure
Seek, Test, Treat and Retain for Vulnerable Populations: Measure MENTAL HEALTH Center for Epidemiologic Studies Depression Scale (CES-D) Reference: Radloff, L.S. (1977). The CES-D Scale: a self-report
More informationNORC AmeriSpeak Omnibus Survey: 41% of Americans Do Not Intend to Get a Flu Shot this Season
Omnibus Survey: 41% of Americans Do Intend to Get a Flu Shot this Season Interview Dates: November 14-19, 2018 Nationally representative sample of 1,202 English-speaking adults age 18 and over, conducted
More information(Press Release) The Results of Radioactive Material Monitoring of the Surface Water Bodies within Ibaraki Prefecture
(P l) h l f dc Ml M f h fc W Bd h Ib Pfc Fd, Dcb 2, 2011 W E D, E M B, M f h E Dc l: 03-5521-8316 chbd: 03-3581-3351 Dc: b Yhd (x. 6610) Dp Dc: F (x. 6614) Cd: H H (x. 6628) I ccdc h h Cph d M Pl dd b
More information2016 Themes and Topics List
2016 Themes and Topics List Theme A: Development A.01. Neurogenesis and Gliogenesis A.01.a. Nervous system patterning and developmental cell death A.01.b. Proliferation: Self renewal and cell cycle A.01.c.
More informationA1a. Have you ever had a time in your life when you felt sad, blue, or depressed for two weeks or more in a row?
PhenX Measure: General Psychiatric Assessment (#120100) PhenX Protocol: General Psychiatric Assessment - Adult (#120101) Date of Interview/Examination (MM/DD/YYYY): SECTION A: [Major Depressive Episode]
More informationQM Reports Technical Specifications: Version 1.0
Exhibit 271 Introduction The measures contained on the Quality Measure (QM) Reports are calculated in two major steps. In the first step, two samples of assessments are selected: a long-stay sample and
More informationDeclaration of conformity VEGABAR 82
Declaration of conformity acc. to VO (EG) 1935/2004 and VO (EU) 10/2011 as well as acc. to FDA and USP Class VI as well as ADI-free Document ID: 47480 Editing status: 2018-09-11 2 CFR FDA stands for Food
More informationQUALITY INDICATORS FOR RESIDENTIAL CARE FACILITIES Maine Bureau of Medical Services
1.) Prevalence of Bladder Incontinence (High Degree of Incontinence) Previous QI103 2.) Prevalence of Bladder Incontinence (Low Degree of Incontinence) Previous QI104 3.) Prevalence of Bowel Incontinence
More informationAppendix A: International Classification of Diseases, 10th Revision, Clinical Modification Codes (ICD-10) Utilized for VTE Events
Online Appendices to Mahan et al. External validation of a risk assessment model for venous thromboembolism in the hospitalised acutely-ill medical patient (VTE-VALOURR) (Thromb Haemost 2014; 112.4) Appendix
More informationThe Question of Adapting Motivational Interviewing with American Indian and Alaska Native Populations. Kamilla L. Venner, PhD UNM/CASAA
The Question of Adapting Motivational Interviewing with American Indian and Alaska Native Populations Kamilla L. Venner, PhD UNM/CASAA Adapting Evidence-based treatment to reduce Health Disparities One
More informationPrescription for Progress Study conducted by the Siena College Research Institute April 10 - May 4, Stakeholders - MOE +/- 4.
How serious a public health problem in the State of New York is each of the following: [Q1A-Q1I ROTATED] Q1A. Alcohol abuse Very serious 61% 63% 53% 63% 36% 71% 52% Somewhat serious 35% 35% 38% 33% 52%
More informationChildhood Cancer Survivor Study Study Proposal: Male Health Questionnaire (MHQ) November 6, 2012
Childhood Cancer Survivor Study Study Proposal: Male Health Questionnaire (MHQ) November 6, 2012 1. STUDY TITLE: Perceptions of risk for Male Health Problems in childhood and adolescent cancer survivors:
More informationMolecular and Cellular Tumor Pathology Laboratory, Cancer Center Karolinska,
Antiproliferative Effects of 1α-OH-vitD 3 in Malignant Melanoma. Potential Therapeutic implications Lucia Spath 1,+, Alessandra Ulivieri 1,4+, Luca Lavra 1,4, Laura Fidanza 2, Marta Carlesimo 2, Maria
More informationARIC Data Book. Cohort, Exam 3. Personal History Form: FORM CODE=PHX VERSION=A
Page 1 of 20 Personal History Form: FORM CODE=PHX VERSION=A Instructions: This form should be completed during the participant's visit. Whenever numerical responses are required, enter the number so that
More information!"#$%&'%()!%('%!!*'%()+','-./).01'$+) 23.-'1!)'%)!%('%!!*'%(
!"#$%&'%()!%('%!!*'%()+','-./).01'$+) 23.-'1!)'%)!%('%!!*'%(!"#$%&'(&!)*)#+*!)*)#+*,-*.%//*-&*.&'%$01+#$1"&2+)#+%%-#+) 3*4+5%-6&,-*54$7&8%/#)+6&'2+) 901#-6&8%:%"*;"4
More informationMulti-Country Opinion Research Survey TOPLINE RESULTS GLOBAL AVERAGE
Multi-Country Opinion Research Survey TOPLINE RESULTS GLOBAL AVERAGE KEY SPECIFICATIONS AUDIENCE: LEGAL AGE, GENERAL POPULATION ADULTS SAMPLE SIZE: n=31,002 GEOGRAPHY: ARGENTINA AUSTRALIA AUSTRIA BRAZIL
More information02/19/02 OBSESSIVE-COMPULSIVE DISORDER SECTION
02/19/02 OBSESSIVE-COMPULSIVE DISORDER SECTION *O1. *O1a. Some people have repeated unpleasant thoughts or impulses that they can t get out of their heads that make these people feel compelled to behave
More informationMDS 3.0 Quality Measures USER S MANUAL
MDS 3.0 Quality Measures USER S MANUAL Effective April 1, 2017 Prepared for: The Centers for Medicare & Medicaid Services under Contract No. HHSM500-2013- 13015I (HHSM-500-T0001). (RTI Project Number 0214077.001.001)
More informationComputing composite scores of patients report of health professional behaviour Summary, Methods and Results Last updated 8 March 2011
Computing composite scores of patients report of health professional behaviour Summary, Methods and Results Last updated 8 March 2011 Summary: The patient questionnaire includes items which assess patients
More informationReducing Barriers to Risk Appropriate Cancer Genetics Services: Current Strategies
Reducing Barriers to Risk Appropriate Cancer Genetics Services: Current Strategies Kara J. Milliron, MS, CGC Mark D. Pearlman, MD Disclosure I am a contract genetic counselor with Informed DNA, Inc. The
More informationReject Code Reason for Rejection What to do
Reject Code Reason for Rejection What to do 10 Hospital where services rendered missing or invalid. Input the Hospital where services were rendered on the HCFA. 11 Patient first name missing or invalid.
More informationCH.13 Understanding Problem Behaviors through Functional Assessment Functional Assessment: Functions of Problem Behaviors
CH.13 Understanding Problem Behaviors through Functional Assessment - Functional Assessment: the process of identifying these variables (3 term contingence) before treating a problem behavior - The behavior
More informationSupplement to Achieving a State of Healthy Weight
Composition of Ratings of Practices 0 (Highest to Lowest) Fully Met Partially Met Not Addressed Contradicted IB: Feed infants on cue IA: No cow s milk < yr IB: Hold infant to feed IC: Plan solid introduction
More informationEvidence-Based Practice: Psychosocial Interventions
Evidence-Based Practice: Psychosocial Interventions Maxine Stitzer, Ph.D. Johns Hopkins Univ SOM NIDA Blending Conference June 3, 2008 Cincinnati, Ohio Talk Outline What is an evidence-based practice?
More informationdiffers from U LINEAR A SIGN A303 GRASS + U+1075C LINEAR A SIGN A703 D U Collating order. Collation order is as in the code chart.
JTC1/SC2/WG2 N3755 L2/10-004 2010-01-22 Universal Multiple-Octet Coded Character Set International Organization for Standardization Organisation Internationale de Normalisation Международная организация
More informationIterative Join Graph Propagation
Iterative Join Graph Propagation Vibhav Gogate Stat methods class dapted from Robert Mateescu s slides The University of Texas at Dallas What is IJGP? IJGP is an approximate algorithm for belief updating
More informationVARIATION IN MEASUREMENT OF HIV RNA VIRAL LOAD
VARIATION IN MEASUREMENT OF HIV RNA VIRAL LOAD SOURCES OF VARIATION (RANDOM VS SYSTEMATIC) MAGNITUDE OF EACH SOURCE CONSEQUENCES FOR CONFIDENCE LIMITS AROUND MEASUREMENTS AND CHANGES DATA FROM ROCHE HIV
More informationSurveys with questions on adolescents and HPV
NIS Teen 2008 (The NIS is a list-assisted random-digit-dialing telephone survey followed by a mailed survey to children s immunization providers that began data collection in April 1994 to monitor childhood
More informationQI Version #: 6.3 MDS 2.0 Form Type: QUARTERLY ASSESSMENT FORM-TWO PAGE DOMAIN: ACCIDENTS
DOMAIN: ACCIDENTS 1. Incidence of new fractures 1 1.1A0001 Residents with new fractures on most recent Residents who did not have fractures on the previous new hip fracture (J4c is checked on most recent
More informationQUALITY MEASURES NELIA ADACI RNC, BSN, CDONA, C-NE, RAC-CT VICE PRESIDENT, THE CHARTS GROUP
HCANJ QUALITY MEASURES NELIA ADACI RNC, BSN, CDONA, C-NE, RAC-CT VICE PRESIDENT, THE CHARTS GROUP 1 OUTLINE What are Quality Measures? 4 Purposes of QM s Key Definitions Review the QM s Managing the QM
More informationCUCM Mixed Mode with Tokenless CTL
CUCM Mixed Mode with Tokenless CTL Document ID: 118893 Contributed by Milosz Zajac, Michal Myszor, and Leszek Wojnarski, Cisco TAC Engineers. Apr 08, 2015 Contents Introduction Prerequisites Requirements
More informationDeselection 2011 QZ Pathology. DISPLAY_CALL_NO TITLE_BRIEF PUB_DATE LAKESHORE OWNS QZ 4 A Anderson's Pathology. 1985
DISPLAY_CALL_NO TITLE_BRIEF PUB_DATE LAKESHORE OWNS QZ 4 A552 1985 Anderson's Pathology. 1985 QZ 4 A552 1985 Anderson's Pathology. 1985 QZ 4 A552 1990 Anderson's pathology / 1990 QZ 4 A552 1990 Anderson's
More informationrdd Doc 643 Filed 04/02/14 Entered 04/02/14 18:32:35 Main Document Pg 1 of 13 UNITED STATES BANKRUPTCY COURT SOUTHERN DISTRICT OF NEW YORK
Pg 1 of 13 UNITED STATES BANKRUPTCY COURT SOUTHERN DISTRICT OF NEW YORK ) In re: ) Chapter 11 ) SOUND SHORE MEDICAL CENTER, OF ) Case No. 13-22840 (RDD) WESTCHESTER, et al. 1 Debtors. ) ) (Jointly Administered)
More informationCourses in the Bachelor program in Psychology (major)
Universität Zürich Binzmühlestrasse 1, Box 1 CH-8050 Zürich www.psychologie.uzh.ch Fall Semester 2016 Clinical Psychology 200a00x 00x Angststörungen Theorien, Befunde und Therapiemöglichkeiten (Anxiety
More informationTHE TRISECTION OF ANY ANGLE
THE TRISECTION OF ANY ANGLE This article has been written during Markos Georgallides : Tel-00357-99 634628 last month of 2010 and is solely for Civil Engineer(NATUA) : Fax-00357-24 653551 my own amusement
More information+",-./0/$1#2/&!.";.4,&!>4$$#$;& Ohio Center for Autism and Low Incidence +"./&?/GF#%1&"7&*9:1,&8-/F%.9,&?#1".=/.1&
!"#$%&'& *&+",-./0/$1#2/& 3.4,/5".6&7".& 89--".:$;&1& 5#%0&*9:1,&!"#$%&(&!"#$%&)&?"$$4&@5/$1A&B*& +0.#1&3#>>/.A&CD& &&&& Ohio Center for Autism and Low Incidence 470 Glenmont Ave. Columbus, Ohio
More informationWO 2012/ A3. 15 November 2012 ( ) P O P C T
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International
More informationP G K R P E W M G W L K P R G G A V N Y A R P L Q G R V T M T R D V Y S D T A F
Supplementary Figure 1 VRC01 45-08-110497H 45-08-212510H 45-08-511533H 45-08-541880H Q V Q L V Q S G G Q M K K P G E S M R I S C R A S G Y E F I D C T L N W I R L A CAGGTGCAGCTGGTGCAGTCTGGGGGTCAGATGAAGAAGCCTGGCGAGTCGATGAGAATTTCTTGTCGGGCTTCTGGATATGAATTTATTGATTGTACGCTAAATTGGATTCGTCTGGCC
More informationSAMPLE PATIENT SURVEY QUESTIONNAIRE
This document includes questions you could use- either as a stand alone document or as part of a larger survey- to assess a patient s satisfaction with their contraceptive care experience. --- Patient
More informationCharacterising hepatitis C virus transmission dynamics in a highrisk incarcerated population
Characterising hepatitis C virus transmission dynamics in a highrisk incarcerated population Neil Bretaña, Lies Boelen, Rowena Bull, Suzy Teutsch, Peter White, Andrew Lloyd, Fabio Luciani on behalf of
More informationHow to Get Paid for Doing EBD
How to Get Paid for Doing EBD Robert D. Compton, DDS President Robert Compton, DDS Executive Director DentaQuest Institute Disclosure DentaQuest Institute President DentaQuest Benefits Senior VP & CDO
More informationCUCM Cluster Changed from Mixed Mode to Non Secure Mode Configuration Example
CUCM Cluster Changed from Mixed Mode to Non Secure Mode Configuration Example Document ID: 118892 Contributed by Marek Leus, Leszek Wojnarski, and Milosz Zajac, Cisco TAC Engineers. Apr 10, 2015 Contents
More informationDeselection 2011 WD Metabolic Diseases/ Nutrition Disorders/Allergies
DISPLAY_CALL_NO TITLE_BRIEF PUB_DATE WD 105 D963m 1988 Magnesium in clinical practice / 1988 WD 105 N976 1984 Nutritional assessment / 1984 WD 105 S855i 1996 Iron nutrition in health and disease / 1996
More informationCIHI s Population Grouping Methodology: Beyond Predicting Costs
CIHI s Population Grouping Methodology: Beyond Predicting Costs Yvonne Rosehart Canadian Institute for Health Information October 12, 2017 yrosehart@cihi.ca cihi.ca @cihi_icis CIHI s Population Grouping
More informationMedication Abbreviations
ABBREVIATIONS: QUIZ 2 Medication Abbreviations 1. Which one of the following abbreviations means antidiuretic hormone? a. AH b. AD c. AIDS d. AS e. ADH 2. Which of the following abbreviations means in
More informationNeuronal GPCR OCTR-1 regulates innate immunity by controlling protein synthesis in
Supplementary Information Neuronal GPCR OCTR-1 regulates innate immunity by controlling protein synthesis in Caenorhabditis elegans Yiyong Liu 1, Durai Sellegounder 1, and Jingru Sun 1 * 1 Department of
More informationPractical Interventions for Co-occurring Disorders: Dissemination from Efficacy and Effectiveness Studies
Practical Interventions for Co-occurring Disorders: Dissemination from Efficacy and Effectiveness Studies Sitharthan Thiagarajan *Australian Centre for Addiction Research www.acar.net.au Today s presentation
More informationNashville HMIS Intake Template Use COC Funded Projects: HMIS Intake at Entry Template
HMIS Data Collection Template for Project ENTRY CoC Program This form can be used by all CoC-funded project types: Prevention, Street Outreach, Safe Haven, Transitional Housing, Rapid Re-housing, Permanent
More information7th International Congress of the Spanish Society of Obesity Surgery. Valladolid Spain May, 2004.
7th International Congress of the Spanish Society of Obesity Surgery. Valladolid Spain May, 2004. DIMINISHING POSTOPERATIVE RISKS OF GASTRIC BYPASS Stenosis Stenosis Leak Leak Bleeding Bleeding Stenosis
More information(43) Publication date: 04 September 2014 ( ) (22) Filing Date: 27 February 2014 ( )
(54) Title (EN): INCOHERENT TYPE-III MATERIALS FOR CHARGE CARRIERS CONTROL DEVICES (54) Title (FR): MATÉRIAUX DE TYPE III INCOHÉRENTS POUR DISPOSITIFS DE RÉGULATION DE PORTEURS DE CHARGES (72) Inventor(s):
More informationFRAGILE FAMILIES SCALES DOCUMENTATION AND QUESTION SOURCES FOR ONE-YEAR QUESTIONNAIRES REVISED 9/29/05
FRAGILE FAMILIES SCALES DOCUMENTATION AND QUESTION SOURCES FOR ONE-YEAR QUESTIONNAIRES REVISED 9/29/05 Table of Contents I. Introduction 3 II. Abbreviations 4 III. Description of Scales/Concepts 5 1. Mental
More informationTo test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
More informationVital Statistics MS, Clinical Counseling Program
Vital Statistics MS, Clinical Counseling Program Program Data Current enrollment: 59 Number of students who graduated during academic year 2016-2017: 21 Program completion rate: 95% Licensure examination
More informationARIC Data Book. CHD Cohort Surveillance
Page 1 of 14 Coroner/Medical Examiner Form Data set name: C17CORA1 Instructions: The Coroner/Medical Examiner Form is completed for each eligible out-of-hospital death that was identified as a coroner
More information2017 TOBACCO USAGE COMMUNITY SURVEY. Tobacco-Free Action of Columbia Greene
2017 TOBACCO USAGE COMMUNITY SURVEY Tobacco-Free Action of Table of Contents County 2017: Summary... 2 County 2017: Summary... 2 Smoking Behavior... 2 Display and Sale of Tobacco Products... 2 Attitudes
More informationfor DUMMIES How to Use this Guide Why Conduct Research? Research Design - Now What?
EAGALA Research for DUMMIES How to Use this Guide This guide was created for the people who really want to do research, but don t know where to start. It is a general outline created so that those who
More informationKaren Sakala, RN BSN, PCMH-CCE Diabetes Advisory Council June 20, 2014
Karen Sakala, RN BSN, PCMH-CCE Diabetes Advisory Council June 20, 2014 ! Focused on Community Health Centers (FQHCs) in NM! Goal: To improve the ABCs of diabetes! FY 2009-10: Assessment questionnaire!
More information!"#$%#&'#%&()*%+',"-'*.%'/)0'-1&'2)33%4'104'*.%'-1#4#"/%'*.)00%456' 7*"#89'(1:%';' '
"#$%&()*& 1.n.roystering young pickpocket from Charles Dickens Oliver Twist. 2.n. printed handbill full of tidings from the WMI&AA with a closing date for contributions of 25th of each month to Ken Virtue
More informationBOSTON GLOBE/HARVARD T.H. CHAN SCHOOL OF PUBLIC HEALTH PRESCRIPTION PAINKILLER ABUSE: U.S. ATTITUDES
BOSTON GLOBE/HARVARD T.H. CHAN SCHOOL OF PUBLIC HEALTH PRESCRIPTION PAINKILLER ABUSE: U.S. ATTITUDES This survey was conducted for the Boston Globe and the Harvard T.H. Chan School of Public Health via
More informationEvaluators Perspectives on Research on Evaluation
Supplemental Information New Directions in Evaluation Appendix A Survey on Evaluators Perspectives on Research on Evaluation Evaluators Perspectives on Research on Evaluation Research on Evaluation (RoE)
More informationIntegrated Care for Depression, Anxiety and PTSD. Introduction: Overview of Clinical Roles and Ideas
Integrated Care for Depression, Anxiety and PTSD University of Washington An Evidence-based d Approach for Behavioral Health Professionals (LCSWs, MFTs, and RNs) Alameda Health Consortium November 15-16,
More informationSCID-I (for DSM-IV-TR) Posttraumatic Stress (JAN 2007) Anxiety Disorders F. 25
SCID-I (for DSM-IV-TR) Posttraumatic Stress (JAN 2007) Anxiety Disorders F. 25 *POSTTRAUMATIC STRESS * Sometimes things happen to people that are extremely upsetting--things like being in a life threatening
More information( )* CVID) (Common variable immunodeficiency. IgM (Immunoglobulin A) IgA (Immunoglobulin G) $ $%&' $%&' ()* +
1394/6/19: 1394/8/27: 1394 #! "/357 /!" B (CVID) %&#! B 4 3 2 1 &' ()!"#$ ( )* -, *+ '()!#!" # $ %&#! (Common variable immunodeficiency CVID) : "2 : @A,: *B -- "2!2-1 3+4 "2 +" 5)-67 89:; :2 "2 ? (Hypogammaglobulinemia)!2-1
More informationAspects of Hypoglycemia
Aspects of Hypoglycemia Erik T. Paterson 1 M.D. Abstract To two groups of patients the standard six hour oral glucose tolerance test was administered. Over 80 percent of both groups had abnormal responses
More informationAlcohol Awareness Study 2010
Alcohol Awareness Study 2010 - Prepared for - The Salvation Army - Prepared by - Roy Morgan Research Level 1, 401 Collins Street, Melbourne, VIC, 3000 Discover your edge Alcohol Awareness Survey 2010 CONTENTS
More informationMatrix Interferences in ICP-MS: Causes, Effects, and Strategies to Reduce or Eliminate Them
Matrix Interferences in ICP-MS: Causes, Effects, and Strategies to Reduce or Eliminate Them Ruth E. Wolf, Ph. D. and Daniel H. Jones HUMAN HEALTH ENVIRONMENTAL HEALTH 2017 2014 PerkinElmer Matrix Effects
More informationLinking Contemporary High Resolution Magnetic Resonance Imaging to the Von Economo
Supplementary Materials of Title Linking Contemporary High Resolution Magnetic Resonance Imaging to the Von Economo legacy: A study on the comparison of MRI cortical thickness and histological measurements
More informationCarey guides KARI BERG
Carey guides KARI BERG OK, OK, I GET IT! I UNDERSTAND THAT I HAVE TO TARGET CRIMINOGENIC NEEDS. BUT HOW DO I DO THIS WHEN I ONLY HAVE 15 MINUTES WITH A CLIENT. HOW CAN I CHANGE THEIR BEHAVIOR DURING THAT
More informationTURFGRASS SOIL MANAGEMENT RESEARCH REPORT P.E. Rieke and S. L. McBurney Crop and Soil Sciences, M.S.U.
TURFGRASS SOIL MANAGEMENT RESEARCH REPORT - 1984 P.E. Rieke and S. L. McBurney Crop and Soil Sciences, M.S.U. This report summarizes turf research conducted at the Hancock Turfgrass Center in 1984 and
More informationExpanding Contraceptive Access: Developing and Implementing State-based Approaches March 16, Co-sponsored by:
Expanding Contraceptive Access: Developing and Implementing State-based Approaches March 16, 2017 Co-sponsored by: How to Use Webex Audio: If you can hear us through your computer, you do not need to use
More informationWorkforce Data The American Board of Pediatrics
Workforce Data 2009-2010 The American Board of Pediatrics Caution. Before using this report as a resource, please read the information below! Please use caution when comparing data in this version of the
More informationNote: The trainings below represent a foundational list, and may be adapted based on audience and need.
MOTIVATIONAL INTERVIEWING Introduction to Motivational Interviewing (offered in English and Spanish) 2-day Course (12-14 credit hours) This course is designed to introduce clinicians and staff members
More informationEmerging Issues in Cancer Prevention and Control
Emerging Issues in Cancer Prevention and Control Marcus Plescia, MD, MPH Director, Division of Cancer Prevention and Control Centers for Disease Control & Prevention National Center for Chronic Disease
More informationNote: The trainings below represent a foundational list, and may be adapted based on audience and need.
MOTIVATIONAL INTERVIEWING Introduction to Motivational Interviewing (offered in English and Spanish) 2-day Course (12-14 credit hours) This course is designed to introduce clinicians and staff members
More informationRated 10 out of 10 by B.F What do you like about our services? the workout is always different
Testimonials: Rated 10 out of 10 by F.C. I trained with Deana for over a year. I loved how positive, upbeat, and strong she was. I learned so much and I ve never been healthier! Due to a new work schedule
More informationAtsuo Yanagisawa, M.D., Ph.D.
Effect of Vitamin C and antioxidative nutrition on radiationinduced gene expression in Fukushima nuclear plant workers Atsuo Yanagisawa, M.D., Ph.D. Japanese College of IV Therapy 1 !&#$%!"#$% There
More informationBETWEEN. The lnquiries, Complaints and Reports Committee of the College of. -and-
CPO File No. 2015-0099/2016-0120 DISCIPLINE COMMITTEE OF THE COLLEGE OF PHYSIOTHERAPISTS OF ONTARIO BETWEEN COLLEGE OF PHYSIOTHERAPISTS OF ONTARIO -and- MOHANNAD BAKRI, Registration Number 12180 NOT CE
More informationRespond to the following questions for all household members each adult and child. A separate form should be included for each household member.
HMIS Data Collection Template for Project ENTRY CoC Program This form can be used by all CoC-funded project types: Prevention, Street Outreach, Safe Haven, Transitional Housing, Rapid Re-housing, Permanent
More informationJudy Kruger, PhD, MS, Deborah A. Galuska, PhD, MPH, Mary K. Serdula, MD, MPH, Deborah A. Jones, PhD
Attempting to Lose Weight Specific Practices Among U.S. Adults Judy Kruger, PhD, MS, Deborah A. Galuska, PhD, MPH, Mary K. Serdula, MD, MPH, Deborah A. Jones, PhD Background: Methods: Results: Conclusions:
More informationEvaluation and Assessment: 2PSY Summer, 2015
Evaluation and Assessment: 2PSY - 542 Summer, 2015 Instructor:, Ph.D., LMHC, NCC Meeting times: Perquisite: August 10-14, 2015 8:00am-5:00pm Admission to the MAC program Required Texts No Textbook Required
More informationIrritable Bowel Syndrome (IBS) Guideline Implementation & Communication Tool
Delfini Group, LLC Evidence-based Clinical Consults, Medical Education Seminars, Training & Tools Irritable Bowel Syndrome (IBS) Guideline Implementation & Communication Tool This document is designed
More informationBass Line :The African Health and Sex Survey
Bass Line 2008-09 :The African Health and Sex Survey West Midlands Strategic Health Authority data report (n=401, June 2009) This document reports data from Bass Line 2008-09, an assessment of the sexual
More informationCLINICAL STUDY REPORT SYNOPSIS
CLINICAL STUDY REPORT SYNOPSIS Document No.: EDMS-PSDB-6511694:4.0 Name of Sponsor/Company Johnson & Johnson Pharmaceutical Research & Development Name of Finished Product Name of Active Ingredient Protocol
More informationPrivate Intensive Therapy Retreats Information for Therapists
Private Intensive Therapy Retreats Information for Therapists In the interest of making the Fairy Tale Model of trauma-informed treatment more widely available, Trauma Institute & Child Trauma Institute
More information2016 Denise M. Guérin. Presented for Boston College Employee Development Office April 6, 2016 by Denise M. Guérin, JD, MS-PPM, PMP
2016 Denise M. Guérin Presented for Boston College Employee Development Office April 6, 2016 by Denise M. Guérin, JD, MS-PPM, PMP 1 Q&A from Session #2 Review of Network Logic Diagram Critical Path Method
More information