Supplemental Information. Figures. Figure S1

Size: px
Start display at page:

Download "Supplemental Information. Figures. Figure S1"

Transcription

1 Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the exon, the yellow boxes represent the untranslated regions and the black lines represent non-coding regions. jagger1 is the RIKEN pst20518 line and jagger2 is the GABI-Kat 134A10 line. The arrows represent the primers used for genotyping the plants (1: LP-GK-134A10; 2: DS34; 3: 0849; 4: RP-GK-134A10). B. Amplification of the Ds transposon insert in homozygous jagger1-/-, heterozygous jagger1+/- mutant lines and wild-type. C. Amplification of the T-DNA insert in homozygous jagger2-/- and heterozygous jagger2+/- mutant lines. f: LP-GK-134A10; r: RP-GK-134A10; wt: wild-type; mut: mutant; m: DNA ladder. 1

2 Figure S2 Seed set analysis in wild-typle and jagger-/- ethanol-fixed siliques. jagger1-1-/- (B) and jagger1-2-/- (D) siliques reveal no differences with the corresponding wild-type siliques, wild-type Nossen (A) and wild-type Col-0 (C), respectively. 2

3 Figure S3 jagger-/- crossed with synergids, central cell and egg cell GFP marker lines. A. jagger-/- crossed with the synergid marker line MYB98prom:GFP. The synergids express this gene correctly. B. Wild-Type ovules expressing the construct MYB98 prom:gfp normally. The green GFP signal is present in the synergids as expected. C. jagger-/- crossed with the central cell marker line At2g20595prom:GFP. The central cell express the gene properly. D. Wild-Type ovules expressing the 3

4 construct At2g20595prom:GFP normally. The green GFP signal is present in the central cell as expected. E. jagger-/- crossed with the egg cell marker line EC1.2 prom:gfp. The egg cell express the gene as expected. F. Wild-Type ovules expressing the construct EC1.2 prom:gfp normally. The green GFP signal is present in the egg cell as expected. CC central cell; EC Egg cell; SY synergids. Bars: 20 μm. 4

5 Figure S4 Relative expression of JAGGER in wild-type and 35sprom:JAGGER mutant flowers. Plants 1, 2 and 3 were the only 3 independent lines containing the 35sprom:JAGGER constructs that survived the BASTA treatment. From these plants, only plants 1 and 2 were overexpressing JAGGER relative to the wild type plants. The relative gene expression was measured using stably expressed reference genes (RUB1 and ACT8) in three biological samples with similar results. The data correspond to the ratio of the expression in wild type or 35sprom:JAGGER lines compared to the wild-type and are the mean ± sd of three technical replicates of a biological sample. Wt wild type. 5

6 Figure S5 Analysis of zygote and embryo development in jagger-/- crossed with the egg cell marker line EC1.2 prom:gfp. A. Wild-Type seeds expressing the construct EC1.2 prom:gfp normally in the zygote. The green GFP signal is present in the zygote as expected. B. jagger1-2-/- crossed with the egg cell marker line EC1.2 prom:gfp. The zygote expresses the gene as expected. D. jagger1-2-/- crossed with the egg cell marker line EC1.2 prom:gfp. The zygote expresses the gene as expected, and, as in B, only one zygote is observed. E. Wild-Type seeds expressing the construct EC1.2 prom:gfp normally. The green GFP signal is present in the embryo as expected. E. jagger1-1-/- crossed with the egg cell marker line EC1.2 prom:gfp. The embryo express the gene as expected. F. jagger1-2-/- crossed with the egg cell marker line EC1.2 prom:gfp. The embryo expresses the gene as expected, and, as in E, only one embryo is observed. Differential interference contrast (DIC) and fluorescence images are overlaid. All pistils were observed hours after pollination. E embryo; Z zygote. Bars: 50 μm. 6

7 Figure S6 Analysis of persistent synergid nucleus in seeds from jagger-/- pistils pollinated with AGL62:GFP pollen. A. Four nuclei endosperm stage ovule from wild-type plants containing the AGL62:GFP construct. B. Four nuclei endosperm stage ovule from jagger-/- plants cross-pollinated with AGL62:GFP wild-type pollen. The white arrow points a persistent synergid nucleus with expressing GFP. In both figures the 4 endosperm nuclei are highlighted by white arrowheads. Bars: 50 μm. 7

8 Tables Table S1 - Primer list used in the different experiments. Primers used for jagger1 and jagger 2 genotyping LP-GK-134A10 RP-GK-134A10 TGTCTCCCCACATTTGCCAT ACAACCATATGAAGCCCTTCC DS34 CCGTCCCGCAAGTTAAATATG ATATTGACCATCATACTCATTGC Primers used for obtaining JAGGER different constructs AtP_4390 GGGGACAAGTTTGTACAAAAAAGCAGGCTCTTTTTCCATTGTCTCAATTTG * AtP_4391 GGGGACCACTTTGTACAAGAAAGCTGGGTATGCTTCTTCTTCTTTTGGTGTT * AtP_4486 GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGGTTCCAAGATTGTCCAAG * AtP_4487 GGGGACAAGTTTGTACAAAAAAGCAGGCTGAATATTTATAGGACAAGTTTATG * AtP_4339 GGGGACAAGTTTGTACAAAAAAGCAGGCTCCTCTCCACCAGCACCGG * AtP_4340 GGGGACCACTTTGTACAAGAAAGCTGGGTAAATCAAATTCTCACATTAACACC * AtP_590 AtP_591 CTCAGAATTCGTTGGGTATGTTCTCACTTTC GTCACTCGAGTCCCATCCTTCATTTTAAACAT * attb1 and attb2 adaptor sequences for recombination are underlined. Primers used in Real Time RT-PCR experiments RUB1-fw RUB1-rv CTGTTCACGGAACCCAATTC TGTCGGTCAGACCTTTTTCC ACT8-fw CTCAGGTATTGCAGACCGTATGAG 8

9 ACT8-rv CAGAGTATGATGAAGCAGGTCCAG AGP4-RT-fw TCGCCACTTCAGCACTCGCTC AGP4-RT-rv CGGGAGCACTGCTTGGGCTC Primers used to obtain in situ hybridization probes AGP4insitufw GGCTCTATTCGCCACTTCAG AGP4insitufwT7 TAATACGACTCACTATAGGGGGCTCTATTCGCCACTTCAG * AGP4insiturv AACGGCGGCGTACATAATAG AGP4insiturvT7 TAATACGACTCACTATAGGGAACGGCGGCGTACATAATAG * *T7 adaptors underlined. 9

Cell-FateSwitchofSynergidtoEggCellinArabidopsis eostre Mutant Embryo Sacs Arises from Misexpression of the BEL1-Like Homeodomain Gene BLH1 W

Cell-FateSwitchofSynergidtoEggCellinArabidopsis eostre Mutant Embryo Sacs Arises from Misexpression of the BEL1-Like Homeodomain Gene BLH1 W The Plant Cell, Vol. 19: 3578 3592, November 2007, www.plantcell.org ª 2007 American Society of Plant Biologists Cell-FateSwitchofSynergidtoEggCellinArabidopsis eostre Mutant Embryo Sacs Arises from Misexpression

More information

Open Flower. Juvenile leaf Flowerbud. Carpel 35 NA NA NA NA 61 NA 95 NA NA 15 NA 41 3 NA

Open Flower. Juvenile leaf Flowerbud. Carpel 35 NA NA NA NA 61 NA 95 NA NA 15 NA 41 3 NA PaxDB Root Juvenile leaf Flowerbud Open Flower Carpel Mature Pollen Silique Seed Sec3a Sec3b Sec5a Sec5b Sec6 Sec8 Sec10a/b Sec15a Sec15b Exo84a Exo84b Exo84c Exo70A1 Exo70A2 Exo70A3 49 47 8 75 104 79

More information

Supplemental Data. Di Giorgio et al. (2016). Plant Cell /tpc

Supplemental Data. Di Giorgio et al. (2016). Plant Cell /tpc Supplemental Figure 1. Synteny analysis of NIP4;1 and NIP4;2. Examination of the NIP4;1-NIP4;2 region in rabidopsis thaliana and equivalent evolutionary regions in other dicot genomes are shown on the

More information

BIOLOGY CLASS: VIII TOPIC: Life Processes: Growth, Reproduction & Development (plants) Difference between self-pollination & cross pollination

BIOLOGY CLASS: VIII TOPIC: Life Processes: Growth, Reproduction & Development (plants) Difference between self-pollination & cross pollination BIOLOGY CLASS: VIII TOPIC: Life Processes: Growth, Reproduction & Development (plants) Difference between self-pollination & cross pollination Self -Pollination 1. It is transfer of pollen grains from

More information

Unit E: Plant Propagation. Lesson 1: Understanding Sexual Reproduction

Unit E: Plant Propagation. Lesson 1: Understanding Sexual Reproduction Unit E: Plant Propagation Lesson 1: Understanding Sexual Reproduction 1 Vocabulary Cross-pollination Diploid Endosperm Fertilization Gametes Genes Haploid Hybrids Pollination Seed Self-pollination Sexual

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures

SUPPLEMENTARY INFORMATION. Supplementary Figures SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure 1: Characterization of CerTN-L15 expressed in Arabidopsis roots. a. Ratiometric images of CerTN-L15 in roots under osmotic stress Ratiometric

More information

The MADS Domain Protein DIANA Acts Together with AGAMOUS-LIKE80 to Specify the Central Cell in Arabidopsis Ovules W

The MADS Domain Protein DIANA Acts Together with AGAMOUS-LIKE80 to Specify the Central Cell in Arabidopsis Ovules W The Plant Cell, Vol. 20: 2088 2101, August 2008, www.plantcell.org ã 2008 American Society of Plant Biologists The MADS Domain Protein DIANA Acts Together with AGAMOUS-LIKE80 to Specify the Central Cell

More information

He called these new plants hybrids because they received different genetic information, or different alleles, for a trait from each parent.

He called these new plants hybrids because they received different genetic information, or different alleles, for a trait from each parent. /6/204 in a Garden Each time Mendel studied a trait, he crossed two plants with different expressions of the trait and found that the new plants all looked like one of the two parents. He called these

More information

Chapter 38: Angiosperm Reproduction and Biotechnology

Chapter 38: Angiosperm Reproduction and Biotechnology Name: Chapter 38: Angiosperm Reproduction and Biotechnology 38.1 Flowers, double fertilization, and fruits are unique features of the angiosperm life cycle This may be a good time for you to go back and

More information

Supplemental Data. Wu et al. (2010). Plant Cell /tpc

Supplemental Data. Wu et al. (2010). Plant Cell /tpc Supplemental Figure 1. FIM5 is preferentially expressed in stamen and mature pollen. The expression data of FIM5 was extracted from Arabidopsis efp browser (http://www.bar.utoronto.ca/efp/development/),

More information

Supplemental Data. Beck et al. (2010). Plant Cell /tpc

Supplemental Data. Beck et al. (2010). Plant Cell /tpc Supplemental Figure 1. Phenotypic comparison of the rosette leaves of four-week-old mpk4 and Col-0 plants. A mpk4 vs Col-0 plants grown in soil. Note the extreme dwarfism of the mpk4 plants (white arrows)

More information

The Rab GTPase RabA4d Regulates Pollen Tube Tip Growth in Arabidopsis thaliana W

The Rab GTPase RabA4d Regulates Pollen Tube Tip Growth in Arabidopsis thaliana W The Plant Cell, Vol. 21: 526 544, February 2009, www.plantcell.org ã 2009 American Society of Plant Biologists The Rab GTPase RabA4d Regulates Pollen Tube Tip Growth in Arabidopsis thaliana W Amy L. Szumlanski

More information

Genetics & The Work of Mendel. AP Biology

Genetics & The Work of Mendel. AP Biology Genetics & The Work of Mendel Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas u used experimental method u used

More information

A role for LORELEI, a putative glycosylphosphatidylinositolanchored protein, in Arabidopsis thaliana double fertilization and early seed development

A role for LORELEI, a putative glycosylphosphatidylinositolanchored protein, in Arabidopsis thaliana double fertilization and early seed development The Plant Journal (2010) 62, 571 588 doi: 10.1111/j.1365-313X.2010.04177.x A role for LORELEI, a putative glycosylphosphatidylinositolanchored protein, in Arabidopsis thaliana double fertilization and

More information

Reproduction 19/02/2016. Asexual Reproduction. Budding: Types of asexual reproduction: SEXUAL VS. ASEXUAL

Reproduction 19/02/2016. Asexual Reproduction. Budding: Types of asexual reproduction: SEXUAL VS. ASEXUAL Asexual Reproduction Reproduction SEXUAL VS. ASEXUAL One parent cell divides by mitosis to produce 2 daughter cells which are clones of the parent Types of asexual reproduction: Budding: 1. Budding 2.

More information

Introduction to Genetics and Heredity

Introduction to Genetics and Heredity Introduction to Genetics and Heredity Although these dogs have similar characteristics they are each unique! I. Early Ideas About Heredity A. The Theory of Blending Inheritance Each parent contributes

More information

1.3 - Sexually Reproduction What is Sexual Reproduction?

1.3 - Sexually Reproduction What is Sexual Reproduction? 1.3 - Sexually Reproduction What is Sexual Reproduction? Sexual Reproduction - Genetic information from two cells is combined to produce a new genetically unique organism. Sexual reproduction occurs when

More information

Genetics & The Work of Mendel

Genetics & The Work of Mendel Genetics & The Work of Mendel 2006-2007 Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas used experimental method

More information

Chapter 38. Plant Reproduction. AP Biology

Chapter 38. Plant Reproduction. AP Biology Chapter 38. Plant Reproduction 1 Animal vs. Plant life cycle Animal multicellular 2n Plant multicellular sporophyte 2n gametes 1n spores 1n unicellular gametes 1n multicellular gametophyte 1n 2 Alternation

More information

Ontwikkeling; bevruchting

Ontwikkeling; bevruchting Ontwikkeling; bevruchting http://www.lima.ohiostate.edu/biology/archive/flowers. html Young Lily anther x40. Four pollen sacs and a cross section of the fillament are visible. Diploid (2N chromosomes)

More information

Chapter 38. Plant Reproduction. AP Biology

Chapter 38. Plant Reproduction. AP Biology Chapter 38. Plant Reproduction 1 Animal vs. Plant life cycle Animal multicellular 2n Plant multicellular sporophyte 2n gametes 1n spores 1n unicellular gametes 1n multicellular gametophyte 1n 2 Alternation

More information

Gregor Mendel Father of Genetics

Gregor Mendel Father of Genetics Genetics and Mendel Gregor Mendel Father of Genetics Gregor Mendel First person to trace characteristics of living things Augustinian Monk Lived and worked in an Austrian monastery in the mid-1800s Parents

More information

Johnny Johnny Saichuk Rice Specialist

Johnny Johnny Saichuk Rice Specialist Johnny Saichuk Rice Specialist Rice Spikelets Medium Grain Long Grain lemma palea bracts Stamen Filament Anther Stigma Filaments of stamens Anthers of stamens Stigma of pistil Style of pistil Rice Spikelet

More information

Supplementary Figures

Supplementary Figures Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion

More information

plant reproduction Alternation of Generations chapter 38

plant reproduction Alternation of Generations chapter 38 Alternation of Generations Haploid (n) plant reproduction chapter 38 Diploid (2n) Sporangium Spore dispersal Spore (n) Young Mature (n) ARCHEGONIUM ANTHERIDIUM Sperm Mature Sorus Sporangium sporophyte

More information

Mitochondrial GCD1 Dysfunction Reveals Reciprocal Cell-to-Cell Signaling during the Maturation of Arabidopsis Female Gametes

Mitochondrial GCD1 Dysfunction Reveals Reciprocal Cell-to-Cell Signaling during the Maturation of Arabidopsis Female Gametes Article Mitochondrial GCD1 Dysfunction Reveals Reciprocal Cell-to-Cell Signaling during the Maturation of Arabidopsis Female Gametes Jian-Jun Wu, 1,3 Xiong-Bo Peng, 1,3 Wen-Wei Li, 1 Rui He, 1 Hai-Ping

More information

Genetics & The Work of Mendel

Genetics & The Work of Mendel Genetics & The Work of Mendel 2006-2007 Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas used experimental method

More information

SEXUAL REPRODUCTION IN FLOWERING PLANTS

SEXUAL REPRODUCTION IN FLOWERING PLANTS SEXUAL REPRODUCTION IN FLOWERING PLANTS 9 CHAPTER 2 SEXUAL REPRODUCTION IN FLOWERING PLANTS MULTIPLE-CHOICE QUESTIONS 1. Among the terms listed below, those that of are not technically correct names for

More information

Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal

Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,

More information

Chapter 38 Angiosperm Reproduction and Biotechnology

Chapter 38 Angiosperm Reproduction and Biotechnology Chapter 38 Angiosperm Reproduction and Biotechnology Concept 38.1 Pollination enables gametes to come together within a flower Diploid (2n) sporophytes produce spores by meiosis; these grow into haploid

More information

Sexual Reproduction in Flowering Plants

Sexual Reproduction in Flowering Plants Sexual Reproduction in Flowering Plants Question 1: Name the parts of an angiosperm flower in which development of male and female gametophyte take place. Answer :- The male gametophyte or the pollen grain

More information

2014 Pearson Education, Inc. 1

2014 Pearson Education, Inc. 1 1 Stamen Anther Filament Stigma Carpel Style Ovary Petal Sepal Ovule 2 A B Sepals Petals Stamens Carpels C A + B gene activity B + C gene activity C gene activity Carpel Petal (a) A schematic diagram of

More information

plant reproduction chapter 40 Alternation of Generations

plant reproduction chapter 40 Alternation of Generations Alternation of Generations plant reproduction chapter 40 Haploid (n) Diploid (2n) Sporangium Spore dispersal Spore (n) Young Mature (n) Archegonium Antheridium Sperm Sporangium Mature sporophyte (2n) New

More information

Unit 2: Multicellular Organisms

Unit 2: Multicellular Organisms Unit 2: Multicellular Organisms Sub Topic 2.3 Reproduction On completion of the sub topic I will be able to state that: Gametes are sex cells. Gametes are haploid. Haploid cells contain one set of chromosomes.

More information

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without

More information

Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish

Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish Developmental Cell, Volume 44 Supplemental Information Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish Juan Manuel González-Rosa, Michka Sharpe, Dorothy Field, Mark H.

More information

PMP ) Plant reproduction. d) Formation of gametes e) Mutations in the development of gametophyte f) Pollination, fertilization

PMP ) Plant reproduction. d) Formation of gametes e) Mutations in the development of gametophyte f) Pollination, fertilization 2015 3) Plant reproduction 1 d) Formation of gametes e) Mutations in the development of gametophyte f) Pollination, fertilization 2 d) Formation of gametes Plant life cycle Microsporogenesis Megasporogenesis

More information

Name Hour. Section 11-1 The Work of Gregor Mendel (pages )

Name Hour. Section 11-1 The Work of Gregor Mendel (pages ) Name Hour Section 11-1 The Work of Gregor Mendel (pages 263-266) Introduction (page 263) 1. The scientific study of heredity is called. Gregor Mendel's Peas (pages 263-264) 2. Circle the letter of each

More information

For a long time, people have observed that offspring look like their parents.

For a long time, people have observed that offspring look like their parents. Chapter 10 For a long time, people have observed that offspring look like their parents. Even before we knew about genes, people were breeding livestock to get certain traits in the offspring. They knew

More information

Writing the Rules of Heredity

Writing the Rules of Heredity Contents 1 Writing the Rules of Heredity 1.1 Mendel s Rules of Segregation and Dominance 2 The Single Trait Cross (Monohybrid Cross) 2.1 Corn Coloration in an F2 Population (activity) Writing the Rules

More information

Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration

Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration Alison A. Staton, Holger Knaut, and Antonio J. Giraldez Supplementary Note Materials and

More information

8.1 Genes Are Particulate and Are Inherited According to Mendel s Laws 8.2 Alleles and Genes Interact to Produce Phenotypes 8.3 Genes Are Carried on

8.1 Genes Are Particulate and Are Inherited According to Mendel s Laws 8.2 Alleles and Genes Interact to Produce Phenotypes 8.3 Genes Are Carried on Chapter 8 8.1 Genes Are Particulate and Are Inherited According to Mendel s Laws 8.2 Alleles and Genes Interact to Produce Phenotypes 8.3 Genes Are Carried on Chromosomes 8.4 Prokaryotes Can Exchange Genetic

More information

The Work of Gregor Mendel. Guided Reading

The Work of Gregor Mendel. Guided Reading The Work of Gregor Mendel Guided Reading Gregor Mendel 25 min Mendel (pearson) 6 min The Experiments of Gregor Mendel 1. What is Heredity? The delivery of characteristics from parents to offspring 2. What

More information

Flower Morphology. Flower Structure

Flower Morphology. Flower Structure wrong 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 right 84 83 82 81 80 79 78 77 76 75 74 73 72 71 70 69 68 67 66 65 64 score 100 98.8 97.6 96.4 95.2 94.0 92.9 91.7 90.5 89.3 88.1 86.9 85.7 84.5

More information

.the science that studies how genes are transmitted from one generation to the next.

.the science that studies how genes are transmitted from one generation to the next. Genetics .the science that studies how genes are transmitted from one generation to the next. The chromosomes are contained in the nucleus of the cell. Genes and Chromosomes Chromosomes are made of: Gene:

More information

Introduction. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings

Introduction. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings Introduction It has been said that an oak is an acorn s way of making more acorns. In a Darwinian view of life, the fitness of an organism is measured only by its ability to replace itself with healthy,

More information

Writing the Rules of Heredity. 23. Genetics I

Writing the Rules of Heredity. 23. Genetics I 1. 2. 3. 4. 5. 6. 7. Describe the general aspects of Mendel s experimental method, and explain why his work is considered so important. Define the following terms: gene, F 1 generation, F 2 generation,

More information

EOG Practice:,Evolution & Genetics [126663]

EOG Practice:,Evolution & Genetics [126663] EOG Practice:,Evolution & Genetics [126663] Student Class Date 1. A particular peach tree produces peaches that are more resistant to disease than other peaches. What method would reproduce these EXACT

More information

When Mendel crossed 2 plants that were different in a single trait, he called that a monohybrid cross. The resulting offspring were called the F1

When Mendel crossed 2 plants that were different in a single trait, he called that a monohybrid cross. The resulting offspring were called the F1 Genetics Gregor Mendel The father of Genetics Genetics- the study of heredity Heredity- the passing of characteristics or traits from parents to offspring Mendel chose pea plants to research. Pea plants

More information

Mastery. Sexual Reproduction and Meiosis. Chapter Content CHAPTER 3 LESSON 1. Directions: Study the diagram. Then answer the following questions.

Mastery. Sexual Reproduction and Meiosis. Chapter Content CHAPTER 3 LESSON 1. Directions: Study the diagram. Then answer the following questions. Chapter Content Mastery Sexual Reproduction and Meiosis Directions: Study the diagram. Then answer the following questions. LESSON 1 Interphase Prophase I Metaphase I Anaphase I Telophase I Meiosis II

More information

NOTES: CH 38 Plant Reproduction

NOTES: CH 38 Plant Reproduction NOTES: CH 38 Plant Reproduction *Modifications in reproduction were key adaptations enabling plants to spread into a variety of terrestrial habitats. * Water has been replaced by wind and animals as a

More information

Plant Science 1203L Laboratory 5 - Sexual Reproduction (Pollination and Double Fertilization)

Plant Science 1203L Laboratory 5 - Sexual Reproduction (Pollination and Double Fertilization) Plant Science 1203L Laboratory 5 - Sexual Reproduction (Pollination and Double Fertilization) Today s lab is about sexual reproduction in plants. As with stem or root structure there are numerous definitions

More information

Plant Reproduction fertilization

Plant Reproduction fertilization Plant Reproduction In the plant kingdom, both sexual and asexual reproduction occur. Recall from Chapter 3 that plants reproduce sexually by sporic reproduction, which is also called alternation of generations.

More information

Mendelian Genetics. You are who you are due to the interaction of HEREDITY and ENVIRONMENT. ENVIRONMENT: all outside forces that act on an organism.

Mendelian Genetics. You are who you are due to the interaction of HEREDITY and ENVIRONMENT. ENVIRONMENT: all outside forces that act on an organism. Heredity Chapter 3 3:1 Genetics Mendelian Genetics You are who you are due to the interaction of HEREDITY and ENVIRONMENT. ENVIRONMENT: all outside forces that act on an organism. HEREDITY: traits that

More information

NCERT Solutions for Class 12 Biology Chapter 2

NCERT Solutions for Class 12 Biology Chapter 2 NCERT Solutions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants Class 12 Chapter 2 Sexual Reproduction in Flowering Plants Exercise Solutions Exercise : Solutions of Questions on

More information

Genetics: Mendel and Beyond

Genetics: Mendel and Beyond Genetics: Mendel and Beyond 10 Genetics: Mendel and Beyond Put the following words in their correct location in the sentences below. crossing over fertilization meiosis zygote 4 haploid prophase I diploid

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms.

Nature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms. Supplementary Figure 1 Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms. IF images of wild-type (wt) and met-2 set-25 worms showing the loss of H3K9me2/me3 at the indicated developmental

More information

Gregor Mendel. What is Genetics? the study of heredity

Gregor Mendel. What is Genetics? the study of heredity Gregor Mendel What is Genetics? the study of heredity Gregor Mendel s Peas Pollen: plant s sperm Egg Cells: plants reproductive cells Fertilization: joining of pollen + egg cells develops into embryo in

More information

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1. Supplementary Figures Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

More information

You are who you are because of a combination of HEREDITY and ENVIRONMENT. ENVIRONMENT: all outside forces that act on an organism.

You are who you are because of a combination of HEREDITY and ENVIRONMENT. ENVIRONMENT: all outside forces that act on an organism. Unit 6 Genetics 6.1 Genetics You are who you are because of a combination of HEREDITY and ENVIRONMENT. ENVIRONMENT: all outside forces that act on an organism. HEREDITY: traits that are passed from parents

More information

TEST NAME:review TEST ID: GRADE:07 Seventh Grade SUBJECT:Life and Physical Sciences TEST CATEGORY: My Classroom

TEST NAME:review TEST ID: GRADE:07 Seventh Grade SUBJECT:Life and Physical Sciences TEST CATEGORY: My Classroom TEST NAME:review TEST ID:1070005 GRADE:07 Seventh Grade SUBJECT:Life and Physical Sciences TEST CATEGORY: My Classroom review Page 1 of 18 Student: Class: Date: 1. There are four blood types: A, B, AB,

More information

Name Date Per. Vocabulary Crossword - Chapter 6: Genetics and Heredity M 2 3 D S 11 L P Y 30 L 38 E 45

Name Date Per. Vocabulary Crossword - Chapter 6: Genetics and Heredity M 2 3 D S 11 L P Y 30 L 38 E 45 Name Date Per. Vocabulary Crossword - Chapter 6: enetics and Heredity 1 2 3 D 5 6 7 4 8 9 10 S 11 12 D 13 16 19 20 21 14 X 17 18 15 P E 22 H D 23 24 25 N 31 32 33 29 26 C B Z 28 I P Y 30 34 V 27 38 T 41

More information

Name Period. Keystone Vocabulary: genetics fertilization trait hybrid gene allele Principle of dominance segregation gamete probability

Name Period. Keystone Vocabulary: genetics fertilization trait hybrid gene allele Principle of dominance segregation gamete probability Name Period BIO B2 GENETICS (Chapter 11) You should be able to: 1. Describe and/or predict observed patterns of inheritance (dominant, recessive, co- dominant, incomplete dominance, sex- linked, polygenic

More information

ANGIOSPERM L.S. POLLEN GRAIN

ANGIOSPERM L.S. POLLEN GRAIN ANGIOSPERM 2 L.S. POLLEN GRAIN ANGIOSPERM T 2 CELLS L.S. POLLEN GRAIN ANGIOSPERM TUBE CELL G L.S. POLLEN GRAIN ANGIOSPERM TUBE CELL > L.S. GENERATIVE CELL POLLEN GRAIN ANGIOSPERM TUBE CELL GENERATIVE CELL

More information

UNIT 1 GENETIC PROCESSES WHAT IS GENETICS? GENETICS VIEWPOINTS THROUGH TIME

UNIT 1 GENETIC PROCESSES WHAT IS GENETICS? GENETICS VIEWPOINTS THROUGH TIME G01 Introduction to Mendelian Genetics.notebook UNIT 1 GENETIC PROCESSES INTRODUCTION TO GENETICS Why do we not all look alike? What is it about people that make one person look different from another?

More information

Mendel s Law of Heredity. Page 254

Mendel s Law of Heredity. Page 254 Mendel s Law of Heredity Page 254 Define pollination The transfer of pollen grains from a male reproductive organ to a female reproductive organ in a plant is called pollination. Define cross pollination.

More information

Objectives. ! Describe the contributions of Gregor Mendel to the science of genetics. ! Explain the Law of Segregation.

Objectives. ! Describe the contributions of Gregor Mendel to the science of genetics. ! Explain the Law of Segregation. Objectives! Describe the contributions of Gregor Mendel to the science of genetics.! Explain the Law of Segregation.! Explain the Law of Independent Assortment.! Explain the concept of dominance.! Define

More information

Class XII Chapter 5 Principles of Inheritance and Variation Biology

Class XII Chapter 5 Principles of Inheritance and Variation Biology Question 1: Mention the advantages of selecting pea plant for experiment by Mendel. Mendel selected pea plants to carry out his study on the inheritance of characters from parents to offspring. He selected

More information

Introduction. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings

Introduction. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings Introduction It has been said that an oak is an acorn s way of making more acorns. In a Darwinian view of life, the fitness of an organism is measured only by its ability to replace itself with healthy,

More information

Principles of Inheritance and Variation

Principles of Inheritance and Variation Principles of Inheritance and Variation Question 1: Mention the advantages of selecting pea plant for experiment by Mendel. Answer Mendel selected pea plants to carry out his study on the inheritance of

More information

Supplementary Figures

Supplementary Figures Supplementary Figures 9 10 11 Supplementary Figure 1. Old plants are more resistant to insect herbivores than young plants. (a) Image of young (1-day-old, 1D) and old (-day-old, D) plants of Arabidopsis

More information

Supplemental Information. Spatial Auxin Signaling. Controls Leaf Flattening in Arabidopsis

Supplemental Information. Spatial Auxin Signaling. Controls Leaf Flattening in Arabidopsis Current Biology, Volume 27 Supplemental Information Spatial Auxin Signaling Controls Leaf Flattening in Arabidopsis Chunmei Guan, Binbin Wu, Ting Yu, Qingqing Wang, Naden T. Krogan, Xigang Liu, and Yuling

More information

A novel class of MYB factors controls sperm

A novel class of MYB factors controls sperm A novel class of MYB factors controls sperm cell formation in plants Nicolas Rotman 1, Anjusha Durbarry 2, Anthony Wardle 2, Wei Cai Yang 3, Annie Chaboud 1, Jean-Emmanuel Faure 1,4, Frédéric Berger 1,5*

More information

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to

More information

A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus

A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus Supplementary figures for: A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus officinalis Daisuke Tsugama, Kohei Matsuyama, Mayui Ide, Masato Hayashi, Kaien Fujino, and

More information

Supplemental Data. Müller-Xing et al. (2014). Plant Cell /tpc

Supplemental Data. Müller-Xing et al. (2014). Plant Cell /tpc Supplemental Figure 1. Phenotypes of iclf (clf-28 swn-7 CLF pro :CLF-GR) plants. A, Late rescue of iclf plants by renewed DEX treatment; senescent inflorescence with elongated siliques (arrow; 90 DAG,

More information

Mitosis and Meiosis. Shui-zhang Fei Department of Horticulture Iowa State University

Mitosis and Meiosis. Shui-zhang Fei Department of Horticulture Iowa State University Mitosis and Meiosis Shui-zhang Fei Department of Horticulture Iowa State University Different types of cultivars Vegetative cultivars clonal cultivars such as potato, ornamentals. Seed cultivars Soybean

More information

Modes of reproduction Types of cultivar

Modes of reproduction Types of cultivar Modes of reproduction Types of cultivar 2012 What is a Cultivar? Distinctness:.. Shall be clearly distinguishable, by one or more important characteristic, from any other plant variety Uniformity:.. Similar

More information

Unit 4: Reproduction Chapter 6. Meiosis is the basis of sexual reproduction.

Unit 4: Reproduction Chapter 6. Meiosis is the basis of sexual reproduction. Unit 4: Reproduction Chapter 6 Meiosis is the basis of sexual reproduction. Mitosis Recap https://www.youtube.com/watch?v= JayldCyv5eQ Sexual Reproduction Section 6.1: Meiosis Sexual Reproduction: a method

More information

Genetics PPT Part 1 Biology-Mrs. Flannery

Genetics PPT Part 1 Biology-Mrs. Flannery Genetics PPT Part Biology-Mrs. Flannery In an Abbey Garden Mendel studied garden peas because they were easy to grow, came in many readily distinguishable varieties, had easily visible traits are easily

More information

REPRODUCTION IN FLOWERING PLANTS

REPRODUCTION IN FLOWERING PLANTS QUESTIONSHEET 1 Read through the following passage about reproduction in flowering plants and then complete it by filling the spaces with the most appropriate word or words. The male reproductive organs

More information

Supplemental Data. Deinlein et al. Plant Cell. (2012) /tpc

Supplemental Data. Deinlein et al. Plant Cell. (2012) /tpc µm Zn 2+ 15 µm Zn 2+ Growth (% of control) empty vector NS1 NS2 NS3 NS4 S. pombe zhfδ Supplemental Figure 1. Functional characterization of. halleri NS genes in Zn 2+ hypersensitive S. pombe Δzhf mutant

More information

UNIT 4. REPRODUCTION

UNIT 4. REPRODUCTION UNIT 4. REPRODUCTION ACTIVITIES: 1. What is the life cycle? Explain the main stages in a living being s life cycle 2. What is reproduction? 3. What is the main difference between sexual and asexual reproduction?

More information

Angiosperm Reproduction

Angiosperm Reproduction Name Angiosperm Reproduction Today you will examine closely the reproductive aspects of the Anthophyta (aka Magnoliophyta aka Angiosperms) to finish your phylogenetic study of reproduction and evolution

More information

Plant Reproduction. In a nutshell

Plant Reproduction. In a nutshell Plant Reproduction In a nutshell 2007-2008 Plant Diversity mosses ferns conifers flowering plants Bryophytes non-vascular land plants Pteridophytes seedless vascular plants Gymnosperm pollen & naked seeds

More information

Genetics & Heredity 11/16/2017

Genetics & Heredity 11/16/2017 Genetics & Heredity Biology I Turner College & Career High School 2017 Fertilization is the fusion of an egg and a sperm. Purebred (True breeding plants) are plants that were allowed to selfpollinate and

More information

Mendelian Genetics Chapter 11

Mendelian Genetics Chapter 11 Mendelian Genetics Chapter 11 Starts on page 308 Roots, Prefixes & Suffixes: homo = hetero = geno = pheno = zyg = co = poly = Section 11-1: Mendel & His Peas I. Vocabulary Words: A. Gene - a small section

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Chapter 11 Introduction to Genetics

Chapter 11 Introduction to Genetics Chapter 11 Introduction to Genetics 11.1 Gregor Mendel Genetics is the scientific study of heredity How traits are passed from one generation to the next Mendel Austrian monk (1822) Used Pea Plants (crossed

More information

Past Questions on Plant Reproduction

Past Questions on Plant Reproduction Past Questions on Plant Reproduction Name the parts labelled A, B, C, D in figure 1 State one function for each A and B. Figure 1 Name the parts labelled A, B, C, D,E and F in figure 2 What is the function

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*

More information

Capu and Spire Assemble a Cytoplasmic Actin Mesh

Capu and Spire Assemble a Cytoplasmic Actin Mesh Developmental Cell 13 Supplemental Data Capu and Spire Assemble a Cytoplasmic Actin Mesh that Maintains Microtubule Organization in the Drosophila Oocyte Katja Dahlgaard, Alexandre A.S.F. Raposo, Teresa

More information

BIO-BOTANY important questions to discuss for NEET 2018/Matric Exam HOPE ACADEMY HOSUR

BIO-BOTANY important questions to discuss for NEET 2018/Matric Exam HOPE ACADEMY HOSUR Questions = 45 REPRODUCTION IN FLOWERING PLANTS 1 1. Which is the characteristics for ornithophily (1) Scented flowers (2) Bright red colored flowers and infloresnce (3) White colored funnel shaped large

More information

Section 11 1 The Work of Gregor Mendel (pages )

Section 11 1 The Work of Gregor Mendel (pages ) Chapter 11 Introduction to Genetics Section 11 1 The Work of Gregor Mendel (pages 263 266) This section describes how Gregor Mendel studied the inheritance of traits in garden peas and what his conclusions

More information

Supplementary Information

Supplementary Information Supplementary Information The fate of W chromosomes in hybrids between wild silkmoths, Samia cynthia ssp.: no role in sex determination and reproduction Atsuo Yoshido, Frantisek Marec, Ken Sahara Supplementary

More information

Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis

Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato

More information

11.1 The Work of Mendel

11.1 The Work of Mendel 11.1 The Work of Mendel Originally prepared by Kim B. Foglia Revised and adapted by Nhan A. Pham Objectives Describe Mendel s classic garden pea experiment. Summarize Mendel s conclusion about inheritance.

More information

POLYGONUM EMBRYO SAC CHALAZAL END ANTIPODAL CELL EMBRYO SAC OVULE L.S.

POLYGONUM EMBRYO SAC CHALAZAL END ANTIPODAL CELL EMBRYO SAC OVULE L.S. POLYGONUM EMBRYO SAC? CHALAZAL END ANTIPODAL CELL EMBRYO SAC OVULE L.S. POLYGONUM EMBRYO SAC C CHALAZAL END ANTIPODAL CELL? EMBRYO SAC OVULE L.S. POLYGONUM EMBRYO SAC? CHALAZAL END ANTIPODAL CELL CENTRAL

More information

INTRODUCTION TO MENDELIAN GENETICS

INTRODUCTION TO MENDELIAN GENETICS NAME: DATE: HOUR: Biology INTRODUCTION TO MENDELIAN GENETICS Read the following article describing Gregor Mendel s contributions to the science known as genetics. Answer the questions along with the reading

More information

BIOLOGY 3201 REPRODUCTION

BIOLOGY 3201 REPRODUCTION BIOLOGY 3201 REPRODUCTION Asexual vs. Sexual Reproduction MODES OF REPRODUCTION (1) Asexual one parent cell divides into two by mitosis to produce 2 identical cells which are clones of the parent (2) Sexual

More information