Supplemental Information. Figures. Figure S1
|
|
- Melanie Lang
- 6 years ago
- Views:
Transcription
1 Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the exon, the yellow boxes represent the untranslated regions and the black lines represent non-coding regions. jagger1 is the RIKEN pst20518 line and jagger2 is the GABI-Kat 134A10 line. The arrows represent the primers used for genotyping the plants (1: LP-GK-134A10; 2: DS34; 3: 0849; 4: RP-GK-134A10). B. Amplification of the Ds transposon insert in homozygous jagger1-/-, heterozygous jagger1+/- mutant lines and wild-type. C. Amplification of the T-DNA insert in homozygous jagger2-/- and heterozygous jagger2+/- mutant lines. f: LP-GK-134A10; r: RP-GK-134A10; wt: wild-type; mut: mutant; m: DNA ladder. 1
2 Figure S2 Seed set analysis in wild-typle and jagger-/- ethanol-fixed siliques. jagger1-1-/- (B) and jagger1-2-/- (D) siliques reveal no differences with the corresponding wild-type siliques, wild-type Nossen (A) and wild-type Col-0 (C), respectively. 2
3 Figure S3 jagger-/- crossed with synergids, central cell and egg cell GFP marker lines. A. jagger-/- crossed with the synergid marker line MYB98prom:GFP. The synergids express this gene correctly. B. Wild-Type ovules expressing the construct MYB98 prom:gfp normally. The green GFP signal is present in the synergids as expected. C. jagger-/- crossed with the central cell marker line At2g20595prom:GFP. The central cell express the gene properly. D. Wild-Type ovules expressing the 3
4 construct At2g20595prom:GFP normally. The green GFP signal is present in the central cell as expected. E. jagger-/- crossed with the egg cell marker line EC1.2 prom:gfp. The egg cell express the gene as expected. F. Wild-Type ovules expressing the construct EC1.2 prom:gfp normally. The green GFP signal is present in the egg cell as expected. CC central cell; EC Egg cell; SY synergids. Bars: 20 μm. 4
5 Figure S4 Relative expression of JAGGER in wild-type and 35sprom:JAGGER mutant flowers. Plants 1, 2 and 3 were the only 3 independent lines containing the 35sprom:JAGGER constructs that survived the BASTA treatment. From these plants, only plants 1 and 2 were overexpressing JAGGER relative to the wild type plants. The relative gene expression was measured using stably expressed reference genes (RUB1 and ACT8) in three biological samples with similar results. The data correspond to the ratio of the expression in wild type or 35sprom:JAGGER lines compared to the wild-type and are the mean ± sd of three technical replicates of a biological sample. Wt wild type. 5
6 Figure S5 Analysis of zygote and embryo development in jagger-/- crossed with the egg cell marker line EC1.2 prom:gfp. A. Wild-Type seeds expressing the construct EC1.2 prom:gfp normally in the zygote. The green GFP signal is present in the zygote as expected. B. jagger1-2-/- crossed with the egg cell marker line EC1.2 prom:gfp. The zygote expresses the gene as expected. D. jagger1-2-/- crossed with the egg cell marker line EC1.2 prom:gfp. The zygote expresses the gene as expected, and, as in B, only one zygote is observed. E. Wild-Type seeds expressing the construct EC1.2 prom:gfp normally. The green GFP signal is present in the embryo as expected. E. jagger1-1-/- crossed with the egg cell marker line EC1.2 prom:gfp. The embryo express the gene as expected. F. jagger1-2-/- crossed with the egg cell marker line EC1.2 prom:gfp. The embryo expresses the gene as expected, and, as in E, only one embryo is observed. Differential interference contrast (DIC) and fluorescence images are overlaid. All pistils were observed hours after pollination. E embryo; Z zygote. Bars: 50 μm. 6
7 Figure S6 Analysis of persistent synergid nucleus in seeds from jagger-/- pistils pollinated with AGL62:GFP pollen. A. Four nuclei endosperm stage ovule from wild-type plants containing the AGL62:GFP construct. B. Four nuclei endosperm stage ovule from jagger-/- plants cross-pollinated with AGL62:GFP wild-type pollen. The white arrow points a persistent synergid nucleus with expressing GFP. In both figures the 4 endosperm nuclei are highlighted by white arrowheads. Bars: 50 μm. 7
8 Tables Table S1 - Primer list used in the different experiments. Primers used for jagger1 and jagger 2 genotyping LP-GK-134A10 RP-GK-134A10 TGTCTCCCCACATTTGCCAT ACAACCATATGAAGCCCTTCC DS34 CCGTCCCGCAAGTTAAATATG ATATTGACCATCATACTCATTGC Primers used for obtaining JAGGER different constructs AtP_4390 GGGGACAAGTTTGTACAAAAAAGCAGGCTCTTTTTCCATTGTCTCAATTTG * AtP_4391 GGGGACCACTTTGTACAAGAAAGCTGGGTATGCTTCTTCTTCTTTTGGTGTT * AtP_4486 GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGGTTCCAAGATTGTCCAAG * AtP_4487 GGGGACAAGTTTGTACAAAAAAGCAGGCTGAATATTTATAGGACAAGTTTATG * AtP_4339 GGGGACAAGTTTGTACAAAAAAGCAGGCTCCTCTCCACCAGCACCGG * AtP_4340 GGGGACCACTTTGTACAAGAAAGCTGGGTAAATCAAATTCTCACATTAACACC * AtP_590 AtP_591 CTCAGAATTCGTTGGGTATGTTCTCACTTTC GTCACTCGAGTCCCATCCTTCATTTTAAACAT * attb1 and attb2 adaptor sequences for recombination are underlined. Primers used in Real Time RT-PCR experiments RUB1-fw RUB1-rv CTGTTCACGGAACCCAATTC TGTCGGTCAGACCTTTTTCC ACT8-fw CTCAGGTATTGCAGACCGTATGAG 8
9 ACT8-rv CAGAGTATGATGAAGCAGGTCCAG AGP4-RT-fw TCGCCACTTCAGCACTCGCTC AGP4-RT-rv CGGGAGCACTGCTTGGGCTC Primers used to obtain in situ hybridization probes AGP4insitufw GGCTCTATTCGCCACTTCAG AGP4insitufwT7 TAATACGACTCACTATAGGGGGCTCTATTCGCCACTTCAG * AGP4insiturv AACGGCGGCGTACATAATAG AGP4insiturvT7 TAATACGACTCACTATAGGGAACGGCGGCGTACATAATAG * *T7 adaptors underlined. 9
Cell-FateSwitchofSynergidtoEggCellinArabidopsis eostre Mutant Embryo Sacs Arises from Misexpression of the BEL1-Like Homeodomain Gene BLH1 W
The Plant Cell, Vol. 19: 3578 3592, November 2007, www.plantcell.org ª 2007 American Society of Plant Biologists Cell-FateSwitchofSynergidtoEggCellinArabidopsis eostre Mutant Embryo Sacs Arises from Misexpression
More informationOpen Flower. Juvenile leaf Flowerbud. Carpel 35 NA NA NA NA 61 NA 95 NA NA 15 NA 41 3 NA
PaxDB Root Juvenile leaf Flowerbud Open Flower Carpel Mature Pollen Silique Seed Sec3a Sec3b Sec5a Sec5b Sec6 Sec8 Sec10a/b Sec15a Sec15b Exo84a Exo84b Exo84c Exo70A1 Exo70A2 Exo70A3 49 47 8 75 104 79
More informationSupplemental Data. Di Giorgio et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Synteny analysis of NIP4;1 and NIP4;2. Examination of the NIP4;1-NIP4;2 region in rabidopsis thaliana and equivalent evolutionary regions in other dicot genomes are shown on the
More informationBIOLOGY CLASS: VIII TOPIC: Life Processes: Growth, Reproduction & Development (plants) Difference between self-pollination & cross pollination
BIOLOGY CLASS: VIII TOPIC: Life Processes: Growth, Reproduction & Development (plants) Difference between self-pollination & cross pollination Self -Pollination 1. It is transfer of pollen grains from
More informationUnit E: Plant Propagation. Lesson 1: Understanding Sexual Reproduction
Unit E: Plant Propagation Lesson 1: Understanding Sexual Reproduction 1 Vocabulary Cross-pollination Diploid Endosperm Fertilization Gametes Genes Haploid Hybrids Pollination Seed Self-pollination Sexual
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures
SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure 1: Characterization of CerTN-L15 expressed in Arabidopsis roots. a. Ratiometric images of CerTN-L15 in roots under osmotic stress Ratiometric
More informationThe MADS Domain Protein DIANA Acts Together with AGAMOUS-LIKE80 to Specify the Central Cell in Arabidopsis Ovules W
The Plant Cell, Vol. 20: 2088 2101, August 2008, www.plantcell.org ã 2008 American Society of Plant Biologists The MADS Domain Protein DIANA Acts Together with AGAMOUS-LIKE80 to Specify the Central Cell
More informationHe called these new plants hybrids because they received different genetic information, or different alleles, for a trait from each parent.
/6/204 in a Garden Each time Mendel studied a trait, he crossed two plants with different expressions of the trait and found that the new plants all looked like one of the two parents. He called these
More informationChapter 38: Angiosperm Reproduction and Biotechnology
Name: Chapter 38: Angiosperm Reproduction and Biotechnology 38.1 Flowers, double fertilization, and fruits are unique features of the angiosperm life cycle This may be a good time for you to go back and
More informationSupplemental Data. Wu et al. (2010). Plant Cell /tpc
Supplemental Figure 1. FIM5 is preferentially expressed in stamen and mature pollen. The expression data of FIM5 was extracted from Arabidopsis efp browser (http://www.bar.utoronto.ca/efp/development/),
More informationSupplemental Data. Beck et al. (2010). Plant Cell /tpc
Supplemental Figure 1. Phenotypic comparison of the rosette leaves of four-week-old mpk4 and Col-0 plants. A mpk4 vs Col-0 plants grown in soil. Note the extreme dwarfism of the mpk4 plants (white arrows)
More informationThe Rab GTPase RabA4d Regulates Pollen Tube Tip Growth in Arabidopsis thaliana W
The Plant Cell, Vol. 21: 526 544, February 2009, www.plantcell.org ã 2009 American Society of Plant Biologists The Rab GTPase RabA4d Regulates Pollen Tube Tip Growth in Arabidopsis thaliana W Amy L. Szumlanski
More informationGenetics & The Work of Mendel. AP Biology
Genetics & The Work of Mendel Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas u used experimental method u used
More informationA role for LORELEI, a putative glycosylphosphatidylinositolanchored protein, in Arabidopsis thaliana double fertilization and early seed development
The Plant Journal (2010) 62, 571 588 doi: 10.1111/j.1365-313X.2010.04177.x A role for LORELEI, a putative glycosylphosphatidylinositolanchored protein, in Arabidopsis thaliana double fertilization and
More informationReproduction 19/02/2016. Asexual Reproduction. Budding: Types of asexual reproduction: SEXUAL VS. ASEXUAL
Asexual Reproduction Reproduction SEXUAL VS. ASEXUAL One parent cell divides by mitosis to produce 2 daughter cells which are clones of the parent Types of asexual reproduction: Budding: 1. Budding 2.
More informationIntroduction to Genetics and Heredity
Introduction to Genetics and Heredity Although these dogs have similar characteristics they are each unique! I. Early Ideas About Heredity A. The Theory of Blending Inheritance Each parent contributes
More information1.3 - Sexually Reproduction What is Sexual Reproduction?
1.3 - Sexually Reproduction What is Sexual Reproduction? Sexual Reproduction - Genetic information from two cells is combined to produce a new genetically unique organism. Sexual reproduction occurs when
More informationGenetics & The Work of Mendel
Genetics & The Work of Mendel 2006-2007 Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas used experimental method
More informationChapter 38. Plant Reproduction. AP Biology
Chapter 38. Plant Reproduction 1 Animal vs. Plant life cycle Animal multicellular 2n Plant multicellular sporophyte 2n gametes 1n spores 1n unicellular gametes 1n multicellular gametophyte 1n 2 Alternation
More informationOntwikkeling; bevruchting
Ontwikkeling; bevruchting http://www.lima.ohiostate.edu/biology/archive/flowers. html Young Lily anther x40. Four pollen sacs and a cross section of the fillament are visible. Diploid (2N chromosomes)
More informationChapter 38. Plant Reproduction. AP Biology
Chapter 38. Plant Reproduction 1 Animal vs. Plant life cycle Animal multicellular 2n Plant multicellular sporophyte 2n gametes 1n spores 1n unicellular gametes 1n multicellular gametophyte 1n 2 Alternation
More informationGregor Mendel Father of Genetics
Genetics and Mendel Gregor Mendel Father of Genetics Gregor Mendel First person to trace characteristics of living things Augustinian Monk Lived and worked in an Austrian monastery in the mid-1800s Parents
More informationJohnny Johnny Saichuk Rice Specialist
Johnny Saichuk Rice Specialist Rice Spikelets Medium Grain Long Grain lemma palea bracts Stamen Filament Anther Stigma Filaments of stamens Anthers of stamens Stigma of pistil Style of pistil Rice Spikelet
More informationSupplementary Figures
Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion
More informationplant reproduction Alternation of Generations chapter 38
Alternation of Generations Haploid (n) plant reproduction chapter 38 Diploid (2n) Sporangium Spore dispersal Spore (n) Young Mature (n) ARCHEGONIUM ANTHERIDIUM Sperm Mature Sorus Sporangium sporophyte
More informationMitochondrial GCD1 Dysfunction Reveals Reciprocal Cell-to-Cell Signaling during the Maturation of Arabidopsis Female Gametes
Article Mitochondrial GCD1 Dysfunction Reveals Reciprocal Cell-to-Cell Signaling during the Maturation of Arabidopsis Female Gametes Jian-Jun Wu, 1,3 Xiong-Bo Peng, 1,3 Wen-Wei Li, 1 Rui He, 1 Hai-Ping
More informationGenetics & The Work of Mendel
Genetics & The Work of Mendel 2006-2007 Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas used experimental method
More informationSEXUAL REPRODUCTION IN FLOWERING PLANTS
SEXUAL REPRODUCTION IN FLOWERING PLANTS 9 CHAPTER 2 SEXUAL REPRODUCTION IN FLOWERING PLANTS MULTIPLE-CHOICE QUESTIONS 1. Among the terms listed below, those that of are not technically correct names for
More informationLack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,
More informationChapter 38 Angiosperm Reproduction and Biotechnology
Chapter 38 Angiosperm Reproduction and Biotechnology Concept 38.1 Pollination enables gametes to come together within a flower Diploid (2n) sporophytes produce spores by meiosis; these grow into haploid
More informationSexual Reproduction in Flowering Plants
Sexual Reproduction in Flowering Plants Question 1: Name the parts of an angiosperm flower in which development of male and female gametophyte take place. Answer :- The male gametophyte or the pollen grain
More information2014 Pearson Education, Inc. 1
1 Stamen Anther Filament Stigma Carpel Style Ovary Petal Sepal Ovule 2 A B Sepals Petals Stamens Carpels C A + B gene activity B + C gene activity C gene activity Carpel Petal (a) A schematic diagram of
More informationplant reproduction chapter 40 Alternation of Generations
Alternation of Generations plant reproduction chapter 40 Haploid (n) Diploid (2n) Sporangium Spore dispersal Spore (n) Young Mature (n) Archegonium Antheridium Sperm Sporangium Mature sporophyte (2n) New
More informationUnit 2: Multicellular Organisms
Unit 2: Multicellular Organisms Sub Topic 2.3 Reproduction On completion of the sub topic I will be able to state that: Gametes are sex cells. Gametes are haploid. Haploid cells contain one set of chromosomes.
More informationSupplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
More informationSupplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish
Developmental Cell, Volume 44 Supplemental Information Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish Juan Manuel González-Rosa, Michka Sharpe, Dorothy Field, Mark H.
More informationPMP ) Plant reproduction. d) Formation of gametes e) Mutations in the development of gametophyte f) Pollination, fertilization
2015 3) Plant reproduction 1 d) Formation of gametes e) Mutations in the development of gametophyte f) Pollination, fertilization 2 d) Formation of gametes Plant life cycle Microsporogenesis Megasporogenesis
More informationName Hour. Section 11-1 The Work of Gregor Mendel (pages )
Name Hour Section 11-1 The Work of Gregor Mendel (pages 263-266) Introduction (page 263) 1. The scientific study of heredity is called. Gregor Mendel's Peas (pages 263-264) 2. Circle the letter of each
More informationFor a long time, people have observed that offspring look like their parents.
Chapter 10 For a long time, people have observed that offspring look like their parents. Even before we knew about genes, people were breeding livestock to get certain traits in the offspring. They knew
More informationWriting the Rules of Heredity
Contents 1 Writing the Rules of Heredity 1.1 Mendel s Rules of Segregation and Dominance 2 The Single Trait Cross (Monohybrid Cross) 2.1 Corn Coloration in an F2 Population (activity) Writing the Rules
More informationCorrespondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration
Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration Alison A. Staton, Holger Knaut, and Antonio J. Giraldez Supplementary Note Materials and
More information8.1 Genes Are Particulate and Are Inherited According to Mendel s Laws 8.2 Alleles and Genes Interact to Produce Phenotypes 8.3 Genes Are Carried on
Chapter 8 8.1 Genes Are Particulate and Are Inherited According to Mendel s Laws 8.2 Alleles and Genes Interact to Produce Phenotypes 8.3 Genes Are Carried on Chromosomes 8.4 Prokaryotes Can Exchange Genetic
More informationThe Work of Gregor Mendel. Guided Reading
The Work of Gregor Mendel Guided Reading Gregor Mendel 25 min Mendel (pearson) 6 min The Experiments of Gregor Mendel 1. What is Heredity? The delivery of characteristics from parents to offspring 2. What
More informationFlower Morphology. Flower Structure
wrong 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 right 84 83 82 81 80 79 78 77 76 75 74 73 72 71 70 69 68 67 66 65 64 score 100 98.8 97.6 96.4 95.2 94.0 92.9 91.7 90.5 89.3 88.1 86.9 85.7 84.5
More information.the science that studies how genes are transmitted from one generation to the next.
Genetics .the science that studies how genes are transmitted from one generation to the next. The chromosomes are contained in the nucleus of the cell. Genes and Chromosomes Chromosomes are made of: Gene:
More informationIntroduction. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Introduction It has been said that an oak is an acorn s way of making more acorns. In a Darwinian view of life, the fitness of an organism is measured only by its ability to replace itself with healthy,
More informationWriting the Rules of Heredity. 23. Genetics I
1. 2. 3. 4. 5. 6. 7. Describe the general aspects of Mendel s experimental method, and explain why his work is considered so important. Define the following terms: gene, F 1 generation, F 2 generation,
More informationEOG Practice:,Evolution & Genetics [126663]
EOG Practice:,Evolution & Genetics [126663] Student Class Date 1. A particular peach tree produces peaches that are more resistant to disease than other peaches. What method would reproduce these EXACT
More informationWhen Mendel crossed 2 plants that were different in a single trait, he called that a monohybrid cross. The resulting offspring were called the F1
Genetics Gregor Mendel The father of Genetics Genetics- the study of heredity Heredity- the passing of characteristics or traits from parents to offspring Mendel chose pea plants to research. Pea plants
More informationMastery. Sexual Reproduction and Meiosis. Chapter Content CHAPTER 3 LESSON 1. Directions: Study the diagram. Then answer the following questions.
Chapter Content Mastery Sexual Reproduction and Meiosis Directions: Study the diagram. Then answer the following questions. LESSON 1 Interphase Prophase I Metaphase I Anaphase I Telophase I Meiosis II
More informationNOTES: CH 38 Plant Reproduction
NOTES: CH 38 Plant Reproduction *Modifications in reproduction were key adaptations enabling plants to spread into a variety of terrestrial habitats. * Water has been replaced by wind and animals as a
More informationPlant Science 1203L Laboratory 5 - Sexual Reproduction (Pollination and Double Fertilization)
Plant Science 1203L Laboratory 5 - Sexual Reproduction (Pollination and Double Fertilization) Today s lab is about sexual reproduction in plants. As with stem or root structure there are numerous definitions
More informationPlant Reproduction fertilization
Plant Reproduction In the plant kingdom, both sexual and asexual reproduction occur. Recall from Chapter 3 that plants reproduce sexually by sporic reproduction, which is also called alternation of generations.
More informationMendelian Genetics. You are who you are due to the interaction of HEREDITY and ENVIRONMENT. ENVIRONMENT: all outside forces that act on an organism.
Heredity Chapter 3 3:1 Genetics Mendelian Genetics You are who you are due to the interaction of HEREDITY and ENVIRONMENT. ENVIRONMENT: all outside forces that act on an organism. HEREDITY: traits that
More informationNCERT Solutions for Class 12 Biology Chapter 2
NCERT Solutions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants Class 12 Chapter 2 Sexual Reproduction in Flowering Plants Exercise Solutions Exercise : Solutions of Questions on
More informationGenetics: Mendel and Beyond
Genetics: Mendel and Beyond 10 Genetics: Mendel and Beyond Put the following words in their correct location in the sentences below. crossing over fertilization meiosis zygote 4 haploid prophase I diploid
More informationNature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms.
Supplementary Figure 1 Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms. IF images of wild-type (wt) and met-2 set-25 worms showing the loss of H3K9me2/me3 at the indicated developmental
More informationGregor Mendel. What is Genetics? the study of heredity
Gregor Mendel What is Genetics? the study of heredity Gregor Mendel s Peas Pollen: plant s sperm Egg Cells: plants reproductive cells Fertilization: joining of pollen + egg cells develops into embryo in
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More informationYou are who you are because of a combination of HEREDITY and ENVIRONMENT. ENVIRONMENT: all outside forces that act on an organism.
Unit 6 Genetics 6.1 Genetics You are who you are because of a combination of HEREDITY and ENVIRONMENT. ENVIRONMENT: all outside forces that act on an organism. HEREDITY: traits that are passed from parents
More informationTEST NAME:review TEST ID: GRADE:07 Seventh Grade SUBJECT:Life and Physical Sciences TEST CATEGORY: My Classroom
TEST NAME:review TEST ID:1070005 GRADE:07 Seventh Grade SUBJECT:Life and Physical Sciences TEST CATEGORY: My Classroom review Page 1 of 18 Student: Class: Date: 1. There are four blood types: A, B, AB,
More informationName Date Per. Vocabulary Crossword - Chapter 6: Genetics and Heredity M 2 3 D S 11 L P Y 30 L 38 E 45
Name Date Per. Vocabulary Crossword - Chapter 6: enetics and Heredity 1 2 3 D 5 6 7 4 8 9 10 S 11 12 D 13 16 19 20 21 14 X 17 18 15 P E 22 H D 23 24 25 N 31 32 33 29 26 C B Z 28 I P Y 30 34 V 27 38 T 41
More informationName Period. Keystone Vocabulary: genetics fertilization trait hybrid gene allele Principle of dominance segregation gamete probability
Name Period BIO B2 GENETICS (Chapter 11) You should be able to: 1. Describe and/or predict observed patterns of inheritance (dominant, recessive, co- dominant, incomplete dominance, sex- linked, polygenic
More informationANGIOSPERM L.S. POLLEN GRAIN
ANGIOSPERM 2 L.S. POLLEN GRAIN ANGIOSPERM T 2 CELLS L.S. POLLEN GRAIN ANGIOSPERM TUBE CELL G L.S. POLLEN GRAIN ANGIOSPERM TUBE CELL > L.S. GENERATIVE CELL POLLEN GRAIN ANGIOSPERM TUBE CELL GENERATIVE CELL
More informationUNIT 1 GENETIC PROCESSES WHAT IS GENETICS? GENETICS VIEWPOINTS THROUGH TIME
G01 Introduction to Mendelian Genetics.notebook UNIT 1 GENETIC PROCESSES INTRODUCTION TO GENETICS Why do we not all look alike? What is it about people that make one person look different from another?
More informationMendel s Law of Heredity. Page 254
Mendel s Law of Heredity Page 254 Define pollination The transfer of pollen grains from a male reproductive organ to a female reproductive organ in a plant is called pollination. Define cross pollination.
More informationObjectives. ! Describe the contributions of Gregor Mendel to the science of genetics. ! Explain the Law of Segregation.
Objectives! Describe the contributions of Gregor Mendel to the science of genetics.! Explain the Law of Segregation.! Explain the Law of Independent Assortment.! Explain the concept of dominance.! Define
More informationClass XII Chapter 5 Principles of Inheritance and Variation Biology
Question 1: Mention the advantages of selecting pea plant for experiment by Mendel. Mendel selected pea plants to carry out his study on the inheritance of characters from parents to offspring. He selected
More informationIntroduction. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Introduction It has been said that an oak is an acorn s way of making more acorns. In a Darwinian view of life, the fitness of an organism is measured only by its ability to replace itself with healthy,
More informationPrinciples of Inheritance and Variation
Principles of Inheritance and Variation Question 1: Mention the advantages of selecting pea plant for experiment by Mendel. Answer Mendel selected pea plants to carry out his study on the inheritance of
More informationSupplementary Figures
Supplementary Figures 9 10 11 Supplementary Figure 1. Old plants are more resistant to insect herbivores than young plants. (a) Image of young (1-day-old, 1D) and old (-day-old, D) plants of Arabidopsis
More informationSupplemental Information. Spatial Auxin Signaling. Controls Leaf Flattening in Arabidopsis
Current Biology, Volume 27 Supplemental Information Spatial Auxin Signaling Controls Leaf Flattening in Arabidopsis Chunmei Guan, Binbin Wu, Ting Yu, Qingqing Wang, Naden T. Krogan, Xigang Liu, and Yuling
More informationA novel class of MYB factors controls sperm
A novel class of MYB factors controls sperm cell formation in plants Nicolas Rotman 1, Anjusha Durbarry 2, Anthony Wardle 2, Wei Cai Yang 3, Annie Chaboud 1, Jean-Emmanuel Faure 1,4, Frédéric Berger 1,5*
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationA putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus
Supplementary figures for: A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus officinalis Daisuke Tsugama, Kohei Matsuyama, Mayui Ide, Masato Hayashi, Kaien Fujino, and
More informationSupplemental Data. Müller-Xing et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Phenotypes of iclf (clf-28 swn-7 CLF pro :CLF-GR) plants. A, Late rescue of iclf plants by renewed DEX treatment; senescent inflorescence with elongated siliques (arrow; 90 DAG,
More informationMitosis and Meiosis. Shui-zhang Fei Department of Horticulture Iowa State University
Mitosis and Meiosis Shui-zhang Fei Department of Horticulture Iowa State University Different types of cultivars Vegetative cultivars clonal cultivars such as potato, ornamentals. Seed cultivars Soybean
More informationModes of reproduction Types of cultivar
Modes of reproduction Types of cultivar 2012 What is a Cultivar? Distinctness:.. Shall be clearly distinguishable, by one or more important characteristic, from any other plant variety Uniformity:.. Similar
More informationUnit 4: Reproduction Chapter 6. Meiosis is the basis of sexual reproduction.
Unit 4: Reproduction Chapter 6 Meiosis is the basis of sexual reproduction. Mitosis Recap https://www.youtube.com/watch?v= JayldCyv5eQ Sexual Reproduction Section 6.1: Meiosis Sexual Reproduction: a method
More informationGenetics PPT Part 1 Biology-Mrs. Flannery
Genetics PPT Part Biology-Mrs. Flannery In an Abbey Garden Mendel studied garden peas because they were easy to grow, came in many readily distinguishable varieties, had easily visible traits are easily
More informationREPRODUCTION IN FLOWERING PLANTS
QUESTIONSHEET 1 Read through the following passage about reproduction in flowering plants and then complete it by filling the spaces with the most appropriate word or words. The male reproductive organs
More informationSupplemental Data. Deinlein et al. Plant Cell. (2012) /tpc
µm Zn 2+ 15 µm Zn 2+ Growth (% of control) empty vector NS1 NS2 NS3 NS4 S. pombe zhfδ Supplemental Figure 1. Functional characterization of. halleri NS genes in Zn 2+ hypersensitive S. pombe Δzhf mutant
More informationUNIT 4. REPRODUCTION
UNIT 4. REPRODUCTION ACTIVITIES: 1. What is the life cycle? Explain the main stages in a living being s life cycle 2. What is reproduction? 3. What is the main difference between sexual and asexual reproduction?
More informationAngiosperm Reproduction
Name Angiosperm Reproduction Today you will examine closely the reproductive aspects of the Anthophyta (aka Magnoliophyta aka Angiosperms) to finish your phylogenetic study of reproduction and evolution
More informationPlant Reproduction. In a nutshell
Plant Reproduction In a nutshell 2007-2008 Plant Diversity mosses ferns conifers flowering plants Bryophytes non-vascular land plants Pteridophytes seedless vascular plants Gymnosperm pollen & naked seeds
More informationGenetics & Heredity 11/16/2017
Genetics & Heredity Biology I Turner College & Career High School 2017 Fertilization is the fusion of an egg and a sperm. Purebred (True breeding plants) are plants that were allowed to selfpollinate and
More informationMendelian Genetics Chapter 11
Mendelian Genetics Chapter 11 Starts on page 308 Roots, Prefixes & Suffixes: homo = hetero = geno = pheno = zyg = co = poly = Section 11-1: Mendel & His Peas I. Vocabulary Words: A. Gene - a small section
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationChapter 11 Introduction to Genetics
Chapter 11 Introduction to Genetics 11.1 Gregor Mendel Genetics is the scientific study of heredity How traits are passed from one generation to the next Mendel Austrian monk (1822) Used Pea Plants (crossed
More informationPast Questions on Plant Reproduction
Past Questions on Plant Reproduction Name the parts labelled A, B, C, D in figure 1 State one function for each A and B. Figure 1 Name the parts labelled A, B, C, D,E and F in figure 2 What is the function
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
More informationCapu and Spire Assemble a Cytoplasmic Actin Mesh
Developmental Cell 13 Supplemental Data Capu and Spire Assemble a Cytoplasmic Actin Mesh that Maintains Microtubule Organization in the Drosophila Oocyte Katja Dahlgaard, Alexandre A.S.F. Raposo, Teresa
More informationBIO-BOTANY important questions to discuss for NEET 2018/Matric Exam HOPE ACADEMY HOSUR
Questions = 45 REPRODUCTION IN FLOWERING PLANTS 1 1. Which is the characteristics for ornithophily (1) Scented flowers (2) Bright red colored flowers and infloresnce (3) White colored funnel shaped large
More informationSection 11 1 The Work of Gregor Mendel (pages )
Chapter 11 Introduction to Genetics Section 11 1 The Work of Gregor Mendel (pages 263 266) This section describes how Gregor Mendel studied the inheritance of traits in garden peas and what his conclusions
More informationSupplementary Information
Supplementary Information The fate of W chromosomes in hybrids between wild silkmoths, Samia cynthia ssp.: no role in sex determination and reproduction Atsuo Yoshido, Frantisek Marec, Ken Sahara Supplementary
More informationTyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis
Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato
More information11.1 The Work of Mendel
11.1 The Work of Mendel Originally prepared by Kim B. Foglia Revised and adapted by Nhan A. Pham Objectives Describe Mendel s classic garden pea experiment. Summarize Mendel s conclusion about inheritance.
More informationPOLYGONUM EMBRYO SAC CHALAZAL END ANTIPODAL CELL EMBRYO SAC OVULE L.S.
POLYGONUM EMBRYO SAC? CHALAZAL END ANTIPODAL CELL EMBRYO SAC OVULE L.S. POLYGONUM EMBRYO SAC C CHALAZAL END ANTIPODAL CELL? EMBRYO SAC OVULE L.S. POLYGONUM EMBRYO SAC? CHALAZAL END ANTIPODAL CELL CENTRAL
More informationINTRODUCTION TO MENDELIAN GENETICS
NAME: DATE: HOUR: Biology INTRODUCTION TO MENDELIAN GENETICS Read the following article describing Gregor Mendel s contributions to the science known as genetics. Answer the questions along with the reading
More informationBIOLOGY 3201 REPRODUCTION
BIOLOGY 3201 REPRODUCTION Asexual vs. Sexual Reproduction MODES OF REPRODUCTION (1) Asexual one parent cell divides into two by mitosis to produce 2 identical cells which are clones of the parent (2) Sexual
More information