Abstract AIM: To analyze the clinical features of druginduced liver injury (DILI), and discuss the risk factors affecting its prognosis.

Size: px
Start display at page:

Download "Abstract AIM: To analyze the clinical features of druginduced liver injury (DILI), and discuss the risk factors affecting its prognosis."

Transcription

1 : : DOI: /wcjd.v24.i ; 24(8): ISSN (print) ISSN (online) 2016 CLINICAL PRACTICE Multidisciplinary expert consensus on clinical features and prognosis of drug-induced liver injury Zhang-Qing Ren, Jin-Hai Wang, Hao Li, Yu-Ru Bai, Long-Bao Yang Zhang-Qing Ren, Jin-Hai Wang, Yu-Ru Bai, Long- Bao Yang, Department of Gastroenterology, the Second Affiliated Hospital of Xi an Jiaotong University, Xi an , Shaanxi Province, China Zhang-Qing Ren, Jin-Hai Wang, Yu-Ru Bai, Long- Bao Yang, Clinical Medical Research Center for Gastrointestinal Diseases in Shaanxi Province, Xi an , Shaanxi Province, China Hao Li, the Center for Disease Control and Prevention in Xi an, Xi an , Shaanxi Province, China Correspondence to: Jin-Hai Wang, Professor, Department of Gastroenterology, the Second Affiliated Hospital of Xi an Jiaotong University, 157 Xiwu Road, Xi an , Shaanxi Province, China. jinhaiwang@hotmail.com Received: Revised: Accepted: Published online: Abstract AIM: To analyze the clinical features of druginduced liver injury (DILI), and discuss the risk factors affecting its prognosis. METHODS: Clinical data for 572 patients with DILI hospitalized at the First Affiliated Hospital of Xi an Jiaotong University, the Second Affiliated Hospital of Xi an Jiaotong University and Xijing Hospital from 2010 to 2014 were retrospectively analyzed. Gender, age, underlying disease, medication time, clinical manifestation, clinical classification, type of drugs, laboratory tests, ways of medication, treatments and prognosis were analyzed to explore the risk factors affecting the prognosis. RESULTS: A total of 572 patients were involved, including 280 (48.95%) males and 292 (51.05%) females, and their average age was ± years. Most cases of DILI occurred in less than 8 weeks of medication. Main clinical manifestations were jaundice (59.44%), fatigue (57.52%), and poor appetite (55.54%). Four hundred and two (70.28%) cases were classified as hepatocellular type, 62 (10.84%) cases as cholestasis type and 53 (9.27%) as mixed type. The top three most common types of drugs that induced DILI were Chinese herbs, antituberculotics and antimicrobials., 1000, (drug-induced liver injury, DILI) 13%, 25%. DILI,.,, ;,, WCJD

2 DILI, 0.46%-1.08%, 10%-15%. DILI,,. As for the prognosis, 194 cases were cured, 323 cases improved well, 39 cases showed no significant improvement, and 16 cases died. Factors influencing prognosis of DILI were medication time, clinical classification, type of drugs and index of total bilirubin, with total bilirubin being an independent risk factor for DILI. CONCLUSION: Clinical manifestations of drug-induced liver injury are non-specific. The most common cause is Chinese medicine. There are many factors influencing DILI, with total bilirubin being the independent risk factor Baishideng Publishing Group Inc. All rights reserved. Key Words: Drug-induced liver injury; Clinical features; Prognostic analysis; Risk factors Ren ZQ, Wang JH, Li H, Bai YR, Yang LB. Multidisciplinary expert consensus on clinical features and prognosis of drug-induced liver injury. Shijie Huaren Xiaohua Zazhi 2016; 24(8): URL: com/ /24/1257.asp DOI: org/ /wcjd.v24.i (drug-induced liver injury, DILI), 5 572,,. (1) DILI 572, 280 (48.95%), 292 (51.05%), ; (2) 226, 205, 115, 155 ; <8 wk, 490 ; 59.44%, 57.52%, 55.42%; 402, 62, 53 ; DILI ; 533, 20, 14 ; 194, 323, 39, 16 ; (3). DILI.,,, DILI, 2016 (drug-induced liver injury, DILI), DILI 3 DILI. URL: asp DOI: (drug-induced liver injury, DILI),,.,,, 30000, DILI 1000, [1]., DILI 0.01%-0.15% [2],., 5572 DILI, DILI,,,, WCJD

3 / , 5 DILI. [3],,,,, 2 DILI, :,, (total bilirubin, TBIL) (direct bilirubin, DBIL) (alanine transaminase, ALT) (aspartate transaminase, AST) (total protein, TP) (alkaline phosphatase, ALP) (glutamyl transpeptidase, GGT) (prothrombin time, PT) PT%, DBIL ALT AST PT, : (CLOMS) 3 [4] : (1) : ALT>2, R 5(R = ALT ALP ); (2): ALP>2, R 2; (3) : ALT ALP>2 2<R<5. DILI : DILI 6 mo, : : (1) :, - ; (2) :,, 2 ; (3) :,, ; (4) : Excel, SPSS20.0, mean SD, t, ;, 2 Fisher, P <0.05. Logistic Logistic DILI 2, 161, 116, 295, (48.95%), 292 (51.05%), , 85, DILI : %, 23 ; , 32.52%; %, 251 ; 60112, 19.58% (39.51%); 205 (35.84%); 115 (20.10%), ( ) ; ( ) 155 (27.10%); 2.3 <8 wk, DILI 4-8 wk, 253, 44.23%; <4 wk, 237, 41.43%; >8 wk 66, 11.54%; 16 (2.80%) 46 (hepatitis B surface antigen, HBsAg) DILI, HBsAg DILD 46 WCJD

4 3 5 DILI,,,, 2.4 DILI 340 (59.44%) 329 (57.52%) 317 (55.42%), 209 (36.54%) 158 (27.62%) 99 (17.31%) 74 (12.94%) 71 (12.41%) 59 (10.31%) 106 (18.53%), , 402 (70.28%), 62 (10.84%), 53 (9.27%), 11 (1.92%) DILI, 44 (7.69%). 2.6 ( 17 ) [5],,,. DILI( 1)., DILI 5 7 DILI (93.18%), 20 (3.50%), 14 (2.45%), 2 (0.35%), 1 (0.17%), : TBIL: mol/l mol/l, DBIL: 113 mol/l mol/l, ALT: U/L U/L, AST: U/L U/L, ALP: U/L U/L, GGT: U/L U/L, TP: g/l 8.51 g/l, PT 122 (21.29%), 40.4 s, PT% 83 (14.46%), 20.4%. : TBIL: mol/l mol/l, ALT: U/L U/L, AST: U/L U/L, ALP: U/L U/L, PT 9 (1.57%) , 81 (14.16%). : (89.9%) (87.8%)(76.1%) (72.9%) (69.12%) (50.9%) (43.8%)(31.3%) (31.3%)(20.7%) (16.1%) (2.1%) (33.88%), 323 (56.48%), 39 (6.81%), 16 (2.83%). A,, B, 17, DILI, DILI (P <0.05)( 2, 3). Logistic ( 4), DILI(P <0.05),, WCJD

5 DILI, ( ) DILI DILI,. 2 DILI, 2 [6]. DILI DILI [7],, 3 mo,. ;,,, DILI, [8] [1]. DILI [9], DILI [10]., [11]. DILI 3, 52.27%., DILI,,. DILI. DILI : (1), 2 ; (2),,, ALT [12] ; (3) :, ALT ALP, [13]., DILI. ALF DILI,, WCJD

6 (DILI):,, DILI, [6]. CT MRI DILI. DILI, DILIN 300, <50% [14]. DILI, DILIN DILI [15].,, DILI, DILI : (1) :, ( ),,, ; (2) :,, ; (3) :, [16]. TBIL DILI [17].,, [18]. TBIL,, DILI. WCJD

7 DILD, DILD, [19]., DILI.. 1 David S, Hamilton JP. Drug-induced Liver Injury. US Gastroenterol Hepatol Rev 2010; 6: [PMID: ] 2 Rangnekar AS, Fontana RJ. An update on drug induced liver injury. Minerva Gastroenterol Dietol 2011; 57: [PMID: ] 3 ( ) 2007; 27: ; 12: ( 17 ) 2011: ; 31: Wu S, Xia Y, Lv X, Tang S, Yang Z, Zhang Y, Wang X, Hu D, Liu F, Yuan Y, Tu D, Sun F, Zhou L, Zhan S. Preventive use of hepatoprotectors yields limited efficacy on the liver toxicity of antituberculosis agents in a large cohort of Chinese patients. J Gastroenterol Hepatol 2015; 30: [PMID: DOI: /jgh.12717] Zyoud SH, Awang R, Sulaiman SA. Reliability of the reported ingested dose of acetaminophen for predicting the risk of toxicity in acetaminophen overdose patients. Pharmacoepidemiol Drug Saf 2012; 21: [PMID: DOI: / pds.2218] ; 15: ; 20: Lammert F, Matern S. [Hepatic diseases caused by drugs]. Praxis (Bern 1994) 1997; 86: [PMID: ] 13 Kaplowitz N. Drug-induced liver disorders: Introduction and overview. Drug-induced liver disease. Elsevier Inc, 2013: 3-14 [DOI: / B ] 14 Chalasani N, Fontana RJ, Bonkovsky HL, Watkins PB, Davern T, Serrano J, Yang H, Rochon J. Causes, clinical features, and outcomes from a prospective study of drug-induced liver injury in the United States. Gastroenterology 2008; 135: , e1-e4 [PMID: DOI: /j.gastro ] 15 Kleiner DE, Chalasani NP, Lee WM, Fontana RJ, Bonkovsky HL, Watkins PB, Hayashi PH, Davern TJ, Navarro V, Reddy R, Talwalkar JA, Stolz A, Gu J, Barnhart H, Hoofnagle JH. Hepatic histological findings in suspected drug-induced liver injury: systematic evaluation and clinical associations. Hepatology 2014; 59: [PMID: DOI: /hep.26709] ; 16: Mori N, Suzuki F, Kawamura Y, Sezaki H, Hosaka T, Akuta N, Kobayashi M, Saito S, Suzuki Y, Arase Y, Ikeda K, Kobayashi M, Kumada H. Determinants of the clinical outcome of patients with severe acute exacerbation of chronic hepatitis B virus infection. J Gastroenterol 2012; 47: [PMID: DOI: / s ] ; 17: ; 22: ,, WCJD

Chronic Liver Disease after Acute Hepatocellular DILI

Chronic Liver Disease after Acute Hepatocellular DILI Chronic Liver Disease after Acute Hepatocellular DILI Robert J. Fontana, MD University of Michigan Medical Center DILI Natural history of acute DILI Transplant/ death Chronic DILI Chronic DILI Incidence

More information

Overview of Causality Assessment in Drug-Induced Liver Injury

Overview of Causality Assessment in Drug-Induced Liver Injury REVIEW Overview of Causality Assessment in Drug-Induced Liver Injury Paul H. Hayashi, M.D., M.P.H. The diagnosis of drug-induced (or herbal/dietary supplement induced) liver injury (DILI) remains largely

More information

Evaluation of prognostic markers in severe drug-induced liver disease

Evaluation of prognostic markers in severe drug-induced liver disease PO Box 2345, Beijing 100023, China World J Gastroenterol 2007 January 28; 13(4): 628-632 World Journal of Gastroenterology ISSN 1007-9327 wjg@wjgnet.com 2007 The WJG Press. All rights reserved. RAPID COMMUNICATION

More information

Woman, 35, With Jaundice and Altered Mental Status Lauren Kemph, NP

Woman, 35, With Jaundice and Altered Mental Status Lauren Kemph, NP Woman, 35, With Jaundice and Altered Mental Status Lauren Kemph, NP IN THIS ARTICLE Results of case patient s initial laboratory work-up, page 39 Top 10 prescription medications associated with idiosyncratic

More information

Role of Hepatitis B Virus Genotypes in Chronic Hepatitis B Exacerbation

Role of Hepatitis B Virus Genotypes in Chronic Hepatitis B Exacerbation BRIEF REPORT Role of Hepatitis B Virus Genotypes in Chronic Hepatitis B Exacerbation Man-Fung Yuen, 1 Erwin Sablon, 2 Danny Ka-Ho Wong, 1 He-Jun Yuan, 1 Benjamin Chun-Yu Wong, 1 Annie On-On Chan, 1 and

More information

HHS Public Access Author manuscript Hepatology. Author manuscript; available in PMC 2017 March 01.

HHS Public Access Author manuscript Hepatology. Author manuscript; available in PMC 2017 March 01. Febuxostat-Induced Acute Liver Injury Matt Bohm, DO, Raj Vuppalanchi, MD, Naga Chalasani, MD, and Drug Induced Liver Injury Network (DILIN) Department of Medicine, Indiana University School of Medicine,

More information

Effect of Prophylactic Use of Silymarin on Anti-tuberculosis Drugs Induced Hepatotoxicity

Effect of Prophylactic Use of Silymarin on Anti-tuberculosis Drugs Induced Hepatotoxicity ORIGINAL ARTICLE https://doi.org/.446/trd.217.8.3.26 ISSN: 1738-336(Print)/2-6184(Online) Tuberc Respir Dis 217;8:26-269 Effect of Prophylactic Use of Silymarin on Anti-tuberculosis Drugs Induced Hepatotoxicity

More information

ORIGINAL ARTICLE. Jun Zheng 1, Rong-chun Xing 1, Wei-hong Zheng 2, Wei Liu 1, Ru-cheng Yao 1, Xiao-song Li 1, Jian-ping Du 1, Lin Li 1.

ORIGINAL ARTICLE. Jun Zheng 1, Rong-chun Xing 1, Wei-hong Zheng 2, Wei Liu 1, Ru-cheng Yao 1, Xiao-song Li 1, Jian-ping Du 1, Lin Li 1. JBUON 2017; 22(3): 709-713 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE A comparative study on postoperative mortality prediction of SFLI scoring

More information

Albumin-to-bilirubin score for assessing the in-hospital death in cirrhosis

Albumin-to-bilirubin score for assessing the in-hospital death in cirrhosis Original Article Albumin-to-bilirubin score for assessing the in-hospital death in cirrhosis Lichun Shao 1 *, Bing Han 1 *, Shu An 2, Jiaxin Ma 1, Xiaozhong Guo 3, Fernando Gomes Romeiro 4, Andrea Mancuso

More information

Xiao-Ling Chi, Mei-Jie Shi, Huan-Ming Xiao, Yu-Bao Xie, and Gao-Shu Cai. Correspondence should be addressed to Xiao-Ling Chi;

Xiao-Ling Chi, Mei-Jie Shi, Huan-Ming Xiao, Yu-Bao Xie, and Gao-Shu Cai. Correspondence should be addressed to Xiao-Ling Chi; Evidence-Based Complementary and Alternative Medicine Volume 2016, Article ID 3743427, 6 pages http://dx.doi.org/10.1155/2016/3743427 Research Article The Score Model Containing Chinese Medicine Syndrome

More information

Reliability of causality assessment for drug, herbal and dietary supplement hepatotoxicity in the Drug-Induced Liver Injury Network (DILIN)

Reliability of causality assessment for drug, herbal and dietary supplement hepatotoxicity in the Drug-Induced Liver Injury Network (DILIN) Liver International ISSN 1478-3223 DRUG-INDUCED LIVER INJURY Reliability of causality assessment for drug, herbal and dietary supplement hepatotoxicity in the Drug-Induced Liver Injury Network (DILIN)

More information

A Severe Hepatotoxicity by Antituberculosis Drug, and its Recovery in Oriental Hospital

A Severe Hepatotoxicity by Antituberculosis Drug, and its Recovery in Oriental Hospital J Korean Med. 2016;37(2):119-124 pissn 1010-0695 eissn 2288-3339 Case Report A Severe Hepatotoxicity by Antituberculosis Drug, and its Recovery in Oriental Hospital Chang-Gue Son Liver and Immunology Research

More information

Hepatitis C Virus Infection in Diabetes Mellitus Patients

Hepatitis C Virus Infection in Diabetes Mellitus Patients 599 Hepatitis C Virus Infection in Diabetes Mellitus Patients Han Ni*, Soe Moe, Aung Htet 1 Assistant Professor, Department of Medicine, Melaka Manipal Medical College, Malaysia 2 Associate Professor,

More information

Drug Induced Liver Injury: A Clinical Perspective. Robert J. Fontana, MD

Drug Induced Liver Injury: A Clinical Perspective. Robert J. Fontana, MD Drug Induced Liver Injury: A Clinical Perspective Robert J. Fontana, MD Drug induced liver injury (DILI) is an uncommon cause of acute and chronic liver injury of increasing importance to patients, clinicians,

More information

Diabetes mellitus may affect the long-term survival of hepatitis B virus-related hepatocellular carcinoma patients after liver transplantation

Diabetes mellitus may affect the long-term survival of hepatitis B virus-related hepatocellular carcinoma patients after liver transplantation Submit a Manuscript: http://www.wjgnet.com/esps/ Help Desk: http://www.wjgnet.com/esps/helpdesk.aspx DOI: 10.3748/wjg.v22.i43.9571 World J Gastroenterol 2016 November 21; 22(43): 9571-9585 ISSN 1007-9327

More information

Diagnostic evaluation of suspected Drug-Induced Liver Injury

Diagnostic evaluation of suspected Drug-Induced Liver Injury Diagnostic evaluation of suspected Drug-Induced Liver Injury Ynto de Boer, MD Department of Gastroenterology and Hepatology Disclosure No disclosures Drug-induced liver injury? Outline What is DILI? What,

More information

Drug-induced liver injury due to varenicline: a case report

Drug-induced liver injury due to varenicline: a case report Sprague and Bambha BMC Gastroenterology 2012, 12:65 CASE REPORT Drug-induced liver injury due to varenicline: a case report David Sprague 1 and Kiran Bambha 2* Open Access Abstract Background: Liver injury

More information

Drug- induced Liver Injury. Guruprasad P. Aithal

Drug- induced Liver Injury. Guruprasad P. Aithal Drug- induced Liver Injury Guruprasad P. Aithal Characterising DILI Deriving case defini=ons Phenotypes and outcomes Manifesta=ons PaBerns Liver histology Cholestasis Terminology Drug- induced Liver disease:

More information

A Case of Cold Medicine-Induced Hepatitis Treated with Herbal Medicine

A Case of Cold Medicine-Induced Hepatitis Treated with Herbal Medicine 2011. Vol.32. No.6. 112-116 The Journal of Korean Oriental Medicine Case Report A Case of Cold Medicine-Induced Hepatitis Treated with Herbal Medicine Chang-Gue Son Liver and Immunology Research Center,

More information

Hepatotoxicity due to Isoniazide in a Patient with Crohn s Disease: Case Report and Literature Review

Hepatotoxicity due to Isoniazide in a Patient with Crohn s Disease: Case Report and Literature Review Case report Hepatotoxicity due to Isoniazide in a Patient with Crohn s Disease: Case Report and Literature Review Gustavo Adolfo Reyes M., MD, 1 Germán David Carvajal P., MD, 2 Mónica Lorena Tapias M.,

More information

OPEN.

OPEN. www.nature.com/scientificreports Received: 9 February 2017 Accepted: 14 August 2017 Published: xx xx xxxx OPEN Prognostic Significance of Elevated Cholestatic Enzymes for Fibrosis and Hepatocellular Carcinoma

More information

Risk factors for 5-day bleeding after endoscopic treatments for gastroesophageal varices in liver cirrhosis

Risk factors for 5-day bleeding after endoscopic treatments for gastroesophageal varices in liver cirrhosis Original Article Page 1 of 9 Risk factors for 5-day bleeding after endoscopic treatments for gastroesophageal varices in liver cirrhosis Rui Sun*, Xingshun Qi* #, Deli Zou, Xiaodong Shao, Hongyu Li, Xiaozhong

More information

The Burden of Drug Induced Liver Injury

The Burden of Drug Induced Liver Injury The Burden of Drug Induced Liver Injury Victor J. Navarro, MD Chairman, Division of Hepatology Einstein Healthcare Network Professor of Medicine Jefferson Medical College Philadelphia, PA, USA Victor J.

More information

Drug induced liver injury: accuracy of diagnosis in published reports

Drug induced liver injury: accuracy of diagnosis in published reports 248 Teschke R, et al., 2014; 13 (2): 248-255 ORIGINAL ARTICLE March-April, Vol. 13 No. 2, 2014: 248-255 Drug induced liver injury: accuracy of diagnosis in published reports Rolf Teschke,* Christian Frenzel,**

More information

Pediatric PSC A children s tale

Pediatric PSC A children s tale Pediatric PSC A children s tale September 8 th PSC Partners seeking a cure Tamir Miloh Assistant Professor Pediatric Hepatology Mount Sinai Hospital, NY Incidence Primary Sclerosing Cholangitis (PSC) ;

More information

Aspartate aminotransferase-to-platelet ratio index in children with cholestatic liver diseases to assess liver fibrosis

Aspartate aminotransferase-to-platelet ratio index in children with cholestatic liver diseases to assess liver fibrosis The Turkish Journal of Pediatrics 2015; 57: 492-497 Original Aspartate aminotransferase-to-platelet ratio index in children with cholestatic liver diseases to assess liver fibrosis Aysel Ünlüsoy-Aksu 1,

More information

Leonard B. Seeff, M.D. Consultant Einstein Healthcare Network. Click to view Biosketch and Presentation Abstract or page down to review presentation

Leonard B. Seeff, M.D. Consultant Einstein Healthcare Network. Click to view Biosketch and Presentation Abstract or page down to review presentation Leonard B. Seeff, M.D. Consultant Einstein Healthcare Network Click to view Biosketch and Presentation Abstract or page down to review presentation ALT as a Biomarker for Drug-Induced Liver Injury Leonard

More information

A Drug-Induced Liver Injury by Western Medication

A Drug-Induced Liver Injury by Western Medication 대한한방내과학회지제 36 권 1 호 (2015 년 3 월 ) J. Int. Korean Med. 2015:36(1)69-75 A Drug-Induced Liver Injury by Western Medication Chang-gue Son Liver and Immunology Research Center, Oriental Medical College in Dae-Jeon

More information

Rui-qing Liu 1,2, Shu-jing Shen 1, Xiu-feng Hu 3, Jie Liu 3, Li-juan Chen 3 and Xing-ya Li 1*

Rui-qing Liu 1,2, Shu-jing Shen 1, Xiu-feng Hu 3, Jie Liu 3, Li-juan Chen 3 and Xing-ya Li 1* Liu et al. Cancer Cell International 2013, 13:99 PRIMARY RESEARCH Open Access Prognosis of the intrahepatic cholangiocarcinoma after resection: hepatitis B virus infection and adjuvant chemotherapy are

More information

Relative predictive factors for hepatocellular carcinoma after HBeAg seroconversion in HBV infection

Relative predictive factors for hepatocellular carcinoma after HBeAg seroconversion in HBV infection PO Box 2345, Beijing 123, China World J Gastroenterol 25;11(43):6848-6852 www.wjgnet.com World Journal of Gastroenterology ISSN 17-9327 wjg@wjgnet.com E L S E V I E R 25 The WJG Press and Elsevier Inc.

More information

VIRAL HEPATITIS. Definitions. Acute Liver Disease (Hepatitis A &E, Alcoholic hepatitis, DILI and ALF) Acute Viral Hepatitis Symptoms

VIRAL HEPATITIS. Definitions. Acute Liver Disease (Hepatitis A &E, Alcoholic hepatitis, DILI and ALF) Acute Viral Hepatitis Symptoms Acute Liver Disease (Hepatitis A &E, Alcoholic hepatitis, DILI and ALF) Definitions AST and ALT Markers of hepatocellular injury Ryan M. Ford, MD Assistant Professor of Medicine Director of Viral Hepatitis

More information

Flavocoxid is a proprietary blend of purified, plantderived

Flavocoxid is a proprietary blend of purified, plantderived Annals of Internal Medicine Original Research Acute Liver Injury due to Flavocoxid (Limbrel), a Medical Food for Osteoarthritis A Case Series Naga Chalasani, MD; Raj Vuppalanchi, MD; Victor Navarro, MD;

More information

The HMG-CoA reductase inhibitors (statins) are. Spectrum of Statin Hepatotoxicity: Experience of the Drug-Induced Liver Injury Network

The HMG-CoA reductase inhibitors (statins) are. Spectrum of Statin Hepatotoxicity: Experience of the Drug-Induced Liver Injury Network Spectrum of Statin Hepatotoxicity: Experience of the Drug-Induced Liver Injury Network Mark W. Russo, 1 Jay H. Hoofnagle, 2 Jiezhun Gu, 3 Robert J. Fontana, 4 Huiman Barnhart, 3 David E. Kleiner, 5 Naga

More information

'The efficacy of extracorporeal liver support with molecular adsorbent recirculating system in severe drug-induced liver injury'.

'The efficacy of extracorporeal liver support with molecular adsorbent recirculating system in severe drug-induced liver injury'. 'The efficacy of extracorporeal liver support with molecular adsorbent recirculating system in severe drug-induced liver injury'. Jaishvi Eapen, New York University Rotimi Ayoola, New York University Ram

More information

Randomized clinical trial: Nucleos(t)ide analogues improved survival of CHB-related HCC patients via reducing severity and progression of malignancy

Randomized clinical trial: Nucleos(t)ide analogues improved survival of CHB-related HCC patients via reducing severity and progression of malignancy /, Vol. 7, No. 36 Randomized clinical trial: Nucleos(t)ide analogues improved survival of CHB-related HCC patients via reducing severity and progression of malignancy Yun Wang 1,*, Xiaogang Xiang 1,*,

More information

Monitoring Hepatitis C

Monitoring Hepatitis C Monitoring Hepatitis C Section Six Monitoring Hepatitis C Screening for hepatitis C is not routinely done, so you may have to request a test from your medical provider. This usually involves an antibody

More information

Evaluation of liver enzymes in asymptomatic chronic hepatitis B virus infected pregnant women

Evaluation of liver enzymes in asymptomatic chronic hepatitis B virus infected pregnant women ORIGINAL ARTICLE Annals of Gastroenterology (2013) 26, 59-65 Evaluation of liver enzymes in asymptomatic chronic hepatitis B virus infected pregnant women Ioannis S. Elefsiniotis a, Hero Brokalaki a, Evangelos

More information

Does Viral Cure Prevent HCC Development

Does Viral Cure Prevent HCC Development Does Viral Cure Prevent HCC Development Prof. Henry LY Chan Head, Division of Gastroenterology and Hepatology Director, Institute of Digestive Disease Director, Center for Liver Health Assistant Dean,

More information

HBV Forum 2 April 18 th 2017 Hilton Amsterdam.

HBV Forum 2 April 18 th 2017 Hilton Amsterdam. HBV Forum 2 April 18 th 2017 Hilton Amsterdam www.forumresearch.org Detection, Assessment and Management of DILI During Drug Development for HBV: The IQ DILI Initiative. Arie Regev, MD Global Patient Safety

More information

Risk stratification in PBC

Risk stratification in PBC Risk stratification in PBC Christophe Corpechot Reference Center for Inflammatory Biliary Diseases Saint-Antoine hospital, Paris, France What is currently known (background) PBC : chronic, progressive

More information

: TP6.3 g dl, Alb4.3 g dl, GOT17 IU l, GPT26 IU l,

: TP6.3 g dl, Alb4.3 g dl, GOT17 IU l, GPT26 IU l, 5 Vol. 34, pp. 5 23, 2006 C IFN 0 2 : 8 4 20 63 986 990 C 993 S7 C A F2 IFN IFNa2a 9MIU 24W HCV-RNA 995 2 F HCV-RNA IFN 0 2004 5 S8 20 mm CT SPIO-MRI 6 TP6.3 g dl, Alb4.3 g dl, GOT7 IU l, GPT26 IU l, g-gtp40

More information

Drug Induced Liver Injury (DILI)

Drug Induced Liver Injury (DILI) Drug Induced Liver Injury (DILI) Aisling Considine- Consultant Hepatology Pharmacist. King s College Hospital NHS Foundation Trust aislingconsidine@nhs.net Drug Induced Liver Injury /Disease Acute Liver

More information

Efficacy of Prophylactic Entecavir for Hepatitis B Virus- Related Hepatocellular Carcinoma Receiving Transcatheter Arterial Chemoembolization

Efficacy of Prophylactic Entecavir for Hepatitis B Virus- Related Hepatocellular Carcinoma Receiving Transcatheter Arterial Chemoembolization DOI:http://dx.doi.org/10.7314/APJCP.2015.16.18.8665 Efficacy of Prophylactic Entecavir for Hepatitis B Virus Related HCC Receiving Transcatheter Arterial Chemoembolization RESEARCH ARTICLE Efficacy of

More information

Primary biliary cirrhosis (PBC) is an autoimmune

Primary biliary cirrhosis (PBC) is an autoimmune Early Biochemical Response to Ursodeoxycholic Acid and Long-Term Prognosis of Primary Biliary Cirrhosis: Results of a 14-Year Cohort Study Li-Na Zhang, 1,2 * Tian-Yan Shi, 1,2 * Xu-Hua Shi, 1,2 Li Wang,

More information

Pathological Features and Prognosis in Chronic Hepatitis B Virus Carriers

Pathological Features and Prognosis in Chronic Hepatitis B Virus Carriers The Journal of International Medical Research 2011; 39: 71 77 Pathological Features and Prognosis in Chronic Hepatitis B Virus Carriers ZH LU, W CHEN, ZC JU, H PEI, XJ YANG, XB GU AND LH HUANG Department

More information

A Rational Evidence-based Approach to Abnormal Liver Tests

A Rational Evidence-based Approach to Abnormal Liver Tests A Rational Evidence-based Approach to Abnormal Liver Tests Jane D. Ricaforte-Campos, MD FPCP, FPSG, FPSDE 2013 HSP Post-graduate Course Radisson Blu Hotel, Cebu City misnomer Liver Function Tests Does

More information

CITY AND HACKNEY CCG ABNORMAL LIVER FUNCTION TESTS (LFTs) in ADULTS

CITY AND HACKNEY CCG ABNORMAL LIVER FUNCTION TESTS (LFTs) in ADULTS CITY AND HACKNEY CCG ABNORMAL LIVER FUNCTION TESTS (LFTs) in ADULTS Interpreting abnormal liver function tests (LFTs) and trying to diagnose any underlying liver disease is a common scenario in Primary

More information

Diagnosis and Management of PBC

Diagnosis and Management of PBC Diagnosis and Management of PBC Cynthia Levy, MD, FAASLD University of Miami Miller School of Medicine Miami, Florida 1 Primary Biliary Cholangitis (PBC) Chronic cholestatic liver disease Autoimmune in

More information

Drug-, herb- and dietary supplement-induced liver injury

Drug-, herb- and dietary supplement-induced liver injury Special article Arch Argent Pediatr 2017;115(6):e397-e403 / e397 Drug-, herb- and dietary supplement-induced liver injury María L. Cavalieri, M.D. a and Daniel D Agostino, M.D. a a. Department of Pediatric

More information

The role of non-invasivemethods in evaluating liver fibrosis of patients with non-alcoholic steatohepatitis

The role of non-invasivemethods in evaluating liver fibrosis of patients with non-alcoholic steatohepatitis The role of non-invasivemethods in evaluating liver fibrosis of patients with non-alcoholic steatohepatitis Objectives: Liver biopsy is the gold standard for diagnosing the extent of fibrosis in NAFLD/NASH;

More information

Prognosis of untreated Primary Sclerosing Cholangitis (PSC) Erik Christensen Copenhagen, Denmark

Prognosis of untreated Primary Sclerosing Cholangitis (PSC) Erik Christensen Copenhagen, Denmark Prognosis of untreated Primary Sclerosing Cholangitis (PSC) Erik Christensen Copenhagen, Denmark Study of Prognosis of PSC Difficulties: Disease is rare The duration of the course of disease may be very

More information

Hepatitis B virus (HBV) has a high prevalence

Hepatitis B virus (HBV) has a high prevalence Plasma Original exchange Article to / Liver treat ACLF in China Plasma exchange-centered artificial liver support system in hepatitis B virus-related acute-onchronic liver failure: a nationwide prospective

More information

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr. 5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:

More information

Drug-induced liver injury (DILI) is an important

Drug-induced liver injury (DILI) is an important Hepatic Histological Findings in Suspected Drug-Induced Liver Injury: Systematic Evaluation and Clinical Associations David E. Kleiner, 1 Naga P. Chalasani, 2 William M. Lee, 3 Robert J. Fontana, 4 Herbert

More information

Drug Induced Liver Injury at a Tertiary Hospital in India: Etiology, Clinical Features and Predictors of Mortality

Drug Induced Liver Injury at a Tertiary Hospital in India: Etiology, Clinical Features and Predictors of Mortality 442 ORIGINAL ARTICLE May-June, Vol. 16 No. 3, 2017: 442-450 The Official Journal of the Mexican Association of Hepatology, the Latin-American Association for Study of the Liver and the Canadian Association

More information

EVALUATION OF ABNORMAL LIVER TESTS

EVALUATION OF ABNORMAL LIVER TESTS EVALUATION OF ABNORMAL LIVER TESTS MIA MANABAT DO PGY6 MOA 119 TH ANNUAL SPRING SCIENTIFIC CONVENTION MAY 19, 2018 EVALUATION OF ABNORMAL LIVER TESTS Review of liver enzymes vs liver function tests Clinical

More information

Xi Yang, Ri-Bao Wei, Ping Li, Yue Yang, Ting-Yu Su, Yu-Wei Gao, Qing-Ping Li, Xue-Guang Zhang, Xiang-Mei Chen

Xi Yang, Ri-Bao Wei, Ping Li, Yue Yang, Ting-Yu Su, Yu-Wei Gao, Qing-Ping Li, Xue-Guang Zhang, Xiang-Mei Chen Int J Clin Exp Pathol 2016;9(9):9401-9407 www.ijcep.com /ISSN:1936-2625/IJCEP0028098 Original Article Correlation between serum hepatitis B virus DNA replication level and clinicopathology in 235 patients

More information

Y. Xiang*, P. Chen*, J.R Xia and L.P. Zhang

Y. Xiang*, P. Chen*, J.R Xia and L.P. Zhang A large-scale analysis study on the clinical and viral characteristics of hepatitis B infection with concurrence of hepatitis B surface or E antigens and their corresponding antibodies Y. Xiang*, P. Chen*,

More information

Approach to the Patient with Liver Disease

Approach to the Patient with Liver Disease Approach to the Patient with Liver Disease Diagnosis of liver disease Careful history taking Physical examination Laboratory tests Radiologic examination and imaging studies Liver biopsy Liver diseases

More information

CYP1A2 polymorphism in Chinese patients with acute liver injury induced by Polygonum multiflorum

CYP1A2 polymorphism in Chinese patients with acute liver injury induced by Polygonum multiflorum CYP1A2 polymorphism in Chinese patients with acute liver injury induced by Polygonum multiflorum K.F. Ma, X.G. Zhang and H.Y. Jia The First Affiliated Hospital, Zhejiang University, Hangzhou, China Corresponding

More information

Interpreting Liver Function Tests

Interpreting Liver Function Tests PSH Clinical Guidelines Statement 2017 Interpreting Liver Function Tests Dr. Asad A Chaudhry Consultant Hepatologist, Chaudhry Hospital, Gujranwala, Pakistan. Liver function tests (LFTs) generally refer

More information

Supplementary materials: Predictors of response to pegylated interferon in chronic hepatitis B: a

Supplementary materials: Predictors of response to pegylated interferon in chronic hepatitis B: a Supplementary materials: Predictors of response to pegylated interferon in chronic hepatitis B: a real-world hospital-based analysis Yin-Chen Wang 1, Sien-Sing Yang 2*, Chien-Wei Su 1, Yuan-Jen Wang 3,

More information

Effect of hepatitis B virus DNA replication level and anti-hbv therapy on microvascular invasion of hepatocellular carcinoma

Effect of hepatitis B virus DNA replication level and anti-hbv therapy on microvascular invasion of hepatocellular carcinoma Qu et al. Infectious Agents and Cancer (2019) 14:2 https://doi.org/10.1186/s13027-019-0219-8 RESEARCH ARTICLE Open Access Effect of hepatitis B virus DNA replication level and anti-hbv therapy on microvascular

More information

Autoimmune Hepatitis. Dr. Stefania Casu Hepatology, UVCM, Inselspital Bern. November 14th, 2018

Autoimmune Hepatitis. Dr. Stefania Casu Hepatology, UVCM, Inselspital Bern. November 14th, 2018 Autoimmune Hepatitis Dr. Stefania Casu Hepatology, UVCM, Inselspital Bern November 14th, 2018 AIH - Definition Manns MP J Hepatol 2015, vol 62, P 100-111 AIH - Definition Autoimmune hepatitis (AIH) is

More information

Natural History of HBV Infection

Natural History of HBV Infection Natural History of HBV Infection Joseph JY Sung MD PhD Institute of Digestive Disease Department of Medicine & Therapeutics Prince of Wales Hospital The Chinese University of Hong Kong HBV Infection 2

More information

Case Report Successful diagnosis of hyperpyrexia induced by isoniazid in a child with suspected extra-pulmonary tuberculosis

Case Report Successful diagnosis of hyperpyrexia induced by isoniazid in a child with suspected extra-pulmonary tuberculosis Int J Clin Exp Med 2015;8(5):8249-8253 www.ijcem.com /ISSN:1940-5901/IJCEM0005890 Case Report Successful diagnosis of hyperpyrexia induced by isoniazid in a child with suspected extra-pulmonary tuberculosis

More information

RESEARCH ARTICLE. Hepatitis B Virus DNA Negativity Acts as a Favorable Prognostic Factor in Hepatocellular Carcinoma Patients

RESEARCH ARTICLE. Hepatitis B Virus DNA Negativity Acts as a Favorable Prognostic Factor in Hepatocellular Carcinoma Patients DOI:http://dx.doi.org/10.7314/APJCP.2014.15.22.9635 RESEARCH ARTICLE Hepatitis B Virus DNA Negativity Acts as a Favorable Prognostic Factor in Hepatocellular Carcinoma Patients Xing Li 1&, Xiang Zhong

More information

The predictive value of serum alanine transaminase activity on first presentation to hospital in patients with paracetamol poisoning

The predictive value of serum alanine transaminase activity on first presentation to hospital in patients with paracetamol poisoning The predictive value of serum alanine transaminase activity on first presentation to hospital in patients with paracetamol poisoning Khalid Al-Hourani, Rachel Mansi, Janice Pettie, Margaret Dow, Nick Bateman

More information

Prognostic factors in patients with hepatitis B virus related hepatocellular carcinoma undergoing nucleoside analog antiviral therapy

Prognostic factors in patients with hepatitis B virus related hepatocellular carcinoma undergoing nucleoside analog antiviral therapy ONCOLOGY LETTERS 6: 1213-1218, 2013 Prognostic factors in patients with hepatitis B virus related hepatocellular carcinoma undergoing nucleoside analog antiviral therapy HIROKI NISHIKAWA 1, NORIHIRO NISHIJIMA

More information

EMPEROR'S COLLEGE MTOM COURSE SYLLABUS HERB FORMULAE I

EMPEROR'S COLLEGE MTOM COURSE SYLLABUS HERB FORMULAE I COURSE DESCRIPTION The first of three courses in the Herb Formulae series. These courses can be taken in any order. The Herb Formulae series analyzes the functions, ingredients, and properties of approximately

More information

HEPETIC SYSTEMS BIOCHEMICAL HEPATOCYTIC SYSTEM HEPATOBILIARY SYSTEM RETICULOENDOTHELIAL SYSTEM

HEPETIC SYSTEMS BIOCHEMICAL HEPATOCYTIC SYSTEM HEPATOBILIARY SYSTEM RETICULOENDOTHELIAL SYSTEM EVALUATION OF LIVER FUNCTION R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty HEPETIC SYSTEMS BIOCHEMICAL HEPATOCYTIC SYSTEM HEPATOBILIARY SYSTEM RETICULOENDOTHELIAL SYSTEM METABOLIC FUNCTION

More information

Ammonia level at admission predicts in-hospital mortality for patients with alcoholic hepatitis

Ammonia level at admission predicts in-hospital mortality for patients with alcoholic hepatitis Gastroenterology Report, 5(3), 2017, 232 236 doi: 10.1093/gastro/gow010 Advance Access Publication Date: 1 May 2016 Original article ORIGINAL ARTICLE Ammonia level at admission predicts in-hospital mortality

More information

Hepatocellular carcinoma is the most common liver-related complication in patients with histopathologically-confirmed NAFLD in Japan

Hepatocellular carcinoma is the most common liver-related complication in patients with histopathologically-confirmed NAFLD in Japan Akuta et al. BMC Gastroenterology (2018) 18:165 https://doi.org/10.1186/s12876-018-0900-1 RESEARCH ARTICLE Open Access Hepatocellular carcinoma is the most common liver-related complication in patients

More information

IN THE NAME OF GOD. D r. MANIJE DEZFULI AZAD UNIVERCITY OF TEHRAN BOOALI HOSPITAL INFECTIOUS DISEASES SPECIALIST

IN THE NAME OF GOD. D r. MANIJE DEZFULI AZAD UNIVERCITY OF TEHRAN BOOALI HOSPITAL INFECTIOUS DISEASES SPECIALIST IN THE NAME OF GOD AZAD UNIVERCITY OF TEHRAN BOOALI HOSPITAL D r. MANIJE DEZFULI INFECTIOUS DISEASES SPECIALIST Acute Viral Hepatitis The Anatomy of the Liver Hepatic Physiology Liver: Largest solid organ

More information

Original Article Autoimmune hepatitis in patients with primary Sjögren s syndrome: a series of two-hundred and two patients

Original Article Autoimmune hepatitis in patients with primary Sjögren s syndrome: a series of two-hundred and two patients Int J Clin Exp Pathol 2010;3(6):582-586 www.ijcep.com /IJCEP1004002 Original Article Autoimmune hepatitis in patients with primary Sjögren s syndrome: a series of two-hundred and two patients Julie K.

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

CIRROSI E IPERTENSIONE PORTALE NELLA DONNA

CIRROSI E IPERTENSIONE PORTALE NELLA DONNA Cagliari, 16 settembre 2017 CIRROSI E IPERTENSIONE PORTALE NELLA DONNA Vincenza Calvaruso, MD, PhD Ricercatore di Gastroenterologia Gastroenterologia & Epatologia, Di.Bi.M.I.S. Università degli Studi di

More information

Biochemical Investigations in Liver Disease. Dr Roshitha de Silva Department of Pathology Faculty of Medicine University of Kelaniya

Biochemical Investigations in Liver Disease. Dr Roshitha de Silva Department of Pathology Faculty of Medicine University of Kelaniya Biochemical Investigations in Liver Disease Dr Roshitha de Silva Department of Pathology Faculty of Medicine University of Kelaniya Biochemical markers Albumin ALP ALT, AST Gamma-glutamyl transpeptidase

More information

Who to Treat? Consider biopsy Treat. > 2 ULN Treat Treat Treat Treat CIRRHOTIC PATIENTS Compensated Treat HBV DNA detectable treat

Who to Treat? Consider biopsy Treat. > 2 ULN Treat Treat Treat Treat CIRRHOTIC PATIENTS Compensated Treat HBV DNA detectable treat Who to Treat? Parameter AASLD US Algorithm EASL APASL HBV DNA CRITERIA HBeAg+ >, IU/mL > 2, IU/mL > 2, IU/mL >, IU/mL HBeAg- > 2, IU/mL > 2, IU/mL > 2, IU/mL > 2, IU/mL ALT CRITERIA PNALT 1-2 ULN Monitor

More information

Drug-Induced Liver Injury and Individual Cell Models

Drug-Induced Liver Injury and Individual Cell Models Dealing with DILI in Drug Development Dig Dis 2015;33:486 491 Drug-Induced Liver Injury and Individual Cell Models Andreas Benesic a, b Alexander L. Gerbes a a Liver Center Munich, Department of Medicine

More information

2. Liver blood tests and what they mean p2 Acute and chronic liver screen

2. Liver blood tests and what they mean p2 Acute and chronic liver screen Hepatology referral pathways for GP 1 Scope For use within hepatology Contents 2. Liver blood tests and what they mean p2 Acute and chronic liver screen p2 Common reasons for hepatology referral 3. Raised

More information

Accepted Manuscript. Unexpected high incidence of hepatocellular carcinoma in patients with hepatitis C in the era of DAAs: too alarming?

Accepted Manuscript. Unexpected high incidence of hepatocellular carcinoma in patients with hepatitis C in the era of DAAs: too alarming? Accepted Manuscript Unexpected high incidence of hepatocellular carcinoma in patients with hepatitis C in the era of DAAs: too alarming? Qing-Lei Zeng, Zhi-Qin Li, Hong-Xia Liang, Guang-Hua Xu, Chun-Xia

More information

Chronic hepatitis B virus (HBV) infection remains a major

Chronic hepatitis B virus (HBV) infection remains a major CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2010;8:541 545 Hepatitis B Virus DNA Level Predicts Hepatic Decompensation in Patients With Acute Exacerbation of Chronic Hepatitis B WEN JUEI JENG, I SHYAN SHEEN,

More information

Prognostic Factors of Cholangiocarcinoma After Surgical Resection: A Retrospective Study of 293 Patients

Prognostic Factors of Cholangiocarcinoma After Surgical Resection: A Retrospective Study of 293 Patients e-issn 1643-3750 DOI: 10.12659/MSM.893586 Received: 2015.01.16 Accepted: 2015.03.23 Published: 2015.08.13 Prognostic Factors of Cholangiocarcinoma After Surgical Resection: A Retrospective Study of 293

More information

HEP DART 2017, Kona, Hawaii

HEP DART 2017, Kona, Hawaii HEP DART 2017, Kona, Hawaii Rong Yu 1, Ke Xu 1, Jing Li 1, Tong Sun 1, Shengjiang Zhang 2, Jinhua Shao 2, Jin Sun 2, Qiong He 3, Jianwen Luo 3, Cheng Wang 4, Yudong Wang 4, Jing Chen 4, Vanessa Wu 4, George

More information

Noninvasive Diagnosis and Staging of Liver Disease. Naveen Gara, MD

Noninvasive Diagnosis and Staging of Liver Disease. Naveen Gara, MD Noninvasive Diagnosis and Staging of Liver Disease Naveen Gara, MD Outline Brief overview of the anatomy of liver Liver-related lab tests Chronic liver disease progression Estimation of liver fibrosis

More information

WEEK. MPharm Programme. Liver Biochemistry. Slide 1 of 49 MPHM14 Liver Biochemistry

WEEK. MPharm Programme. Liver Biochemistry. Slide 1 of 49 MPHM14 Liver Biochemistry MPharm Programme Liver Biochemistry Slide 1 of 49 MPHM Liver Biochemistry Learning Outcomes Assess and evaluate the signs and symptoms of illness Assess and critically appraise a patients medication regimen,

More information

Long-term Clinical Outcomes and Risk of Hepatocellular Carcinoma in Chronic Hepatitis B Patients with HBsAg Seroclearance

Long-term Clinical Outcomes and Risk of Hepatocellular Carcinoma in Chronic Hepatitis B Patients with HBsAg Seroclearance Long-term Clinical Outcomes and Risk of Hepatocellular Carcinoma in Chronic Hepatitis B Patients with HBsAg Seroclearance Gi-Ae Kim, Han Chu Lee *, Danbi Lee, Ju Hyun Shim, Kang Mo Kim, Young-Suk Lim,

More information

Early entecavir treatment for chronic hepatitis B with severe acute exacerbation

Early entecavir treatment for chronic hepatitis B with severe acute exacerbation AAC Accepts, published online ahead of print on 13 January 2014 Antimicrob. Agents Chemother. doi:10.1128/aac.02400-13 Copyright 2014, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5

More information

Comparison of clinical characteristics and outcomes of pyogenic liver abscess patients < 65 years of age versus 65 years of age

Comparison of clinical characteristics and outcomes of pyogenic liver abscess patients < 65 years of age versus 65 years of age Zhang et al. BMC Infectious Diseases (2019) 19:233 https://doi.org/10.1186/s12879-019-3837-2 RESEARCH ARTICLE Open Access Comparison of clinical characteristics and outcomes of pyogenic liver abscess patients

More information

King s College Hospital NHS Foundation Trust. Acute Liver Disease: what you really need to know.

King s College Hospital NHS Foundation Trust. Acute Liver Disease: what you really need to know. King s College Hospital NHS Foundation Trust Acute Liver Disease: what you really need to know. William Bernal Professor of Liver Critical Care Liver Intensive Therapy Unit Institute of Liver Studies Kings

More information

Liver Biopsy in Chronic Viral Hepatitis (B And C) and Autoimmune Hepatitis Referred to Shahid Sadoughi Hospital Yazd, Iran

Liver Biopsy in Chronic Viral Hepatitis (B And C) and Autoimmune Hepatitis Referred to Shahid Sadoughi Hospital Yazd, Iran Original Article Liver Biopsy in Chronic Viral Hepatitis (B And C) and Autoimmune Hepatitis Referred to Shahid Sadoughi Hospital Yazd, Iran * Shokouh Taghipour Zahir,** Jamshid Ayatollahi From Department

More information

Acute liver failure. Authors: Laura Blackmore A and William Bernal B ABSTRACT. Aetiology. Introduction. Presentation

Acute liver failure. Authors: Laura Blackmore A and William Bernal B ABSTRACT. Aetiology. Introduction. Presentation CME EMERGENCIES IN GASTROENTEROLOGY Clinical Medicine 5 Vol 5, No 5: 6 7 Acute liver failure Authors: Laura Blackmore A and William Bernal B ABSTRACT Acute liver failure (ALF) is a rare critical illness

More information

HHS Public Access Author manuscript Gastroenterology. Author manuscript; available in PMC 2016 June 01.

HHS Public Access Author manuscript Gastroenterology. Author manuscript; available in PMC 2016 June 01. Features and Outcomes of 899 Patients with Drug-induced Liver Injury: The DILIN Prospective Study N Chalasani 1, HL Bonkovsky 2, R Fontana 3, W Lee 4, A Stolz 5, J Talwalkar 6, KR Reddy 7, PB Watkins 8,

More information

Int J Clin Exp Med 2018;11(12): /ISSN: /IJCEM Haifeng Zhang *, Yidi Han *, He Wang, Wei Gou

Int J Clin Exp Med 2018;11(12): /ISSN: /IJCEM Haifeng Zhang *, Yidi Han *, He Wang, Wei Gou Int J Clin Exp Med 2018;11(12):13541-13546 www.ijcem.com /ISSN:1940-5901/IJCEM0080076 Original Article Correlation of chronic hepatitis B complicated with or without diabetes mellitus, in patients with

More information

Antiviral therapy for hepatitis B virus-related hepatocellular carcinoma after radical hepatectomy

Antiviral therapy for hepatitis B virus-related hepatocellular carcinoma after radical hepatectomy Cancer Biol Med 2013;10:158-164. doi: 10.7497/j.issn.2095-3941.2013.03.006 ORIGINAL ARTICLE Antiviral therapy for hepatitis B virus-related hepatocellular carcinoma after radical hepatectomy Yang Ke*,

More information

Drug Induced Liver Injury (DILI) Sumita Verma Senior Lecturer Medicine, Hon Consultant Hepatologist Brighton and Sussex Medical School

Drug Induced Liver Injury (DILI) Sumita Verma Senior Lecturer Medicine, Hon Consultant Hepatologist Brighton and Sussex Medical School Drug Induced Liver Injury (DILI) Sumita Verma Senior Lecturer Medicine, Hon Consultant Hepatologist Brighton and Sussex Medical School Disclosures None pertaining to current talk Research grants from Gilead,

More information

Tenofovir decrease hepatocellular carcinoma recurrence in chronic hepatitis B patients after liver resection

Tenofovir decrease hepatocellular carcinoma recurrence in chronic hepatitis B patients after liver resection Zhang et al. Infectious Agents and Cancer (2018) 13:19 https://doi.org/10.1186/s13027-018-0191-8 RESEARCH ARTICLE Open Access Tenofovir decrease hepatocellular carcinoma recurrence in chronic hepatitis

More information

CDHNF & NASPGHAN A Partnership for Research and Education for Children s Digestive and Nutritional Health

CDHNF & NASPGHAN A Partnership for Research and Education for Children s Digestive and Nutritional Health CDHNF & NASPGHAN A Partnership for Research and Education for Children s Digestive and Nutritional Health Obesity and NAFLD Definitions: Nonalcoholic steatohepatitis (NASH) and nonalcoholic fatty liver

More information

Disclosure. Evaluation of Abnormal Hepatic Enzymes

Disclosure. Evaluation of Abnormal Hepatic Enzymes Evaluation of Abnormal Hepatic Enzymes Bruce D. Askey, MS, ANP-BC Associate Lecturer North Andover, MA Adult Nurse Practitioner Dept. of Hepatology/Gastroenterology Guthrie Clinic Sayre, Pa Disclosure

More information