MAJOR ARTICLE JID 2008:198 (1 December) Chen et al.
|
|
- Shanon Haynes
- 5 years ago
- Views:
Transcription
1 MAJOR ARTICLE Combined Mutations in Pre-S/Surface and Core Promoter/Precore Regions of Hepatitis B Virus Increase the Risk of Hepatocellular Carcinoma: A Case-Control Study Chien-Hung Chen, 1,2 Chi-Sin Changchien, 1 Chuan-Mo Lee, 1 Chao-Hung Hung, 1 Tsung-Hui Hu, 1 Jing-Houng Wang, 1 Jyh-Chwan Wang, 1 and Sheng-Nan Lu 1 1 Division of Hepatogastroenterology, Department of Internal Medicine, and 2 Graduate Institute of Clinical Medical Sciences, Chang Gung Memorial Hospital-Kaohsiung Medical Center, Chang Gung University College of Medicine, Kaohsiung, Taiwan Background. We sought to investigate the role of sequence variations in pre-s/surface and basal core promoter (BCP)/precore regions of the hepatitis B virus (HBV) in hepatocellular carcinoma (HCC). Methods. The direct sequencing in pre-s/surface and BCP/precore regions of HBV was determined for 80 patients with HCC and 160 control patients with HBV infection. Results. Compared with control patients, patients with HCC had higher frequencies of pre-s deletions and amino acid substitutions at codon 4, 7, and 81 in pre-s1 genes; at the start codon in pre-s2 genes; and at codon 68 in surface genes. Patients also had a lower frequency of amino acid substitution at codon 2 in pre-s2 genes, compared with control patients. In BCP/precore regions, patients with HCC had higher frequencies of C or G1753, A1762/T1764, T1846, and A1899. Multivariate analysis showed that pre-s deletions, I68T surface gene, T1762/A1764, and A1899 were independent factors associated with the development of HCC. The HBV strain with a complex mutation pattern rather than a single mutation was associated with HCC, and the HCC risks increased for patients having these factors in combination. Conclusions. Pre-S deletions, I68T in surface gene, T1762/A1764, and A1899 were independent risk factors for HCC. Combination of these viral mutations appeared to increase the risk of HCC. Chronic hepatitis B virus (HBV) infection is associated with a wide range of clinical manifestations, from asymptomatic carriage with normal histologic characteristics to severe chronic liver disease, including cirrhosis and hepatocellular carcinoma (HCC) [1 4]. The prevalence of HBV infection is high in Taiwan, where 60% 80% of chronic hepatitis and liver cirrhosis cases are HBV related [4] and the incidence of HCC is cases per 100,000 population [5]. Apart from the host Received 25 November 2007; accepted 12 June 2008; electronically published 21 October Potential conflicts of interest: none reported. Financial support: Chang Gung Memorial Hospital and National Council of Science, Taiwan (grants NMRPG T60011 [NSC B-182A-086] and NMRPD [NSC B ]). Reprints or correspondence: Dr. Chuan-Mo Lee, Div. of Hepatogastroenterology, Dept. of Internal Medicine, Kaohsiung Chang Gung Memorial Hospital, 123 Ta Pei Rd., Kaohsiung, Taiwan (chmolee@ms15.hinet.net). The Journal of Infectious Diseases 2008; 198: by the Infectious Diseases Society of America. All rights reserved /2008/ $15.00 DOI: / factors, virologic factors have been associated with a higher risk of HCC. These include HBV DNA levels, HBV genotypes, pre-s mutants, and basal core promoter (BCP) and precore mutations. HBV can be classified into 8 genotypic groups [6 8]. HBV genotypes B and C are more predominant in Asia, and the association between the genotype C variant and increased severity of liver disease is stronger than that for genotype B in this population [9 11]. However, studies of the relationships between HCC and these genotypes have yielded conflicting results. Studies from Taiwan, Japan, and Hong Kong support a higher risk of HCC in the presence of HBV genotype C, compared with HBV genotype B [12 15]. However, 2 recent studies demonstrated that the risk of HCC may not differ between genotypes B and C [16, 17]. Thus, the influence of HBV genotypes on HCC needs further clarification. Recently, several studies have suggested that BCP mutations (T1762/A1764) had higher risks of liver cirrhosis and HCC [10, 12, 18]. However, BCP mutations are also 1634 JID 2008:198 (1 December) Chen et al.
2 frequently found among patients with chronic hepatitis B and without HCC. In addition to these 2 common mutations, 2 other mutations, C-to-T at 1653 in the enhancer II region and T-to- C/A/G (V) at 1753 in the BCP region, have recently been found to be associated with the development of HCC [19, 20]. The HBV envelope is composed of 3 forms of HBV surface antigen (HBsAg): large (coded for by the pre-s1/pre-s2/s gene), middle (the pres2/s gene), and small (the S gene) protein. The pre-s1 and pre-s2 regions play an essential role in the interaction with immune responses because they contain several epitopes for T or B cells [21]. The surface gene of HBV contains a dominant neutralizing epitope termed the a determinant (aa ) in the major hydrophilic region (MHR) [22]. Previous studies demonstrated that a number of pre-s1/s2 rearrangements, including deletions and initiation codon mutants, accumulated in patients at the later stage of chronic HBV infection and during fulminant hepatitis [23, 24]. Recent cross-sectional studies have also demonstrated that patients with HBV genotype C or progressive liver diseases have a higher frequency of pre-s deletions than those with genotype B or inactive carriage [25 27]. However, the effects of pre-s deletions on HCC are rarely investigated in case-control studies. Furthermore, current knowledge concerning the role of other HBV variations in pre-s or surface regions in HCC is limited. Because previous studies only focused on one of these viral factors (e.g., HBV genotype, pre-s deletions, or BCP/precore mutations), it is unclear whether these factors are confounding or have synergistic effects on the development of HCC. Moreover, most previous studies only focused on certain specific nucleotide variants (e.g., pre-s deletions, T1762/A1764, or A1896) and did not analyze other nucleotides or amino acid variations that may have important roles. Our previous longitudinal study found that a pre-s deletion was an independent factor for development of HCC. However, the number of persons who developed HCC during follow-up was limited [28]. Thus, we performed a case-control study of the influence of HBV nucleotides or amino acid variations in pre-s/surface and BCP/precore regions on the development of HCC. PATIENTS, MATERIALS, AND METHODS Study subjects. Between 2000 and 2001, 95 consecutive patients who were positive for hepatitis B surface antigen (HBsAg) and received a diagnosis of HCC at Kaohsiung Chang Gung Memorial Hospital (Kaohsiung, Taiwan) were analyzed. Of these 95 patients, 15 did not have complete polymerase chain reaction (PCR) amplification data for HBV genotypes or sequences of pre-s/surface and BCP/precore regions. The remaining 80 patients were recruited into the present study. Sixty-six were males and 14 were females, and the mean age ( SD) was years. Ten patients were positive and 70 were negative for HBeAg. To examine the role of viral factors on HCC, based on a 1:2 case-control design, 160 HBsAg-positive patients without ultrasonographic evidence of HCC (ultrasonography was repeated at least twice, with an interval of 6 months between analyses) who matched on the basis of age, sex, and HBeAg status with 80 patients with HCC were selected as control patients. Control patients were followed up during the same period of recruitment of the present study in the Division of Hepatogastroenterology at Kaohsiung Chang Gung Memorial Hospital. Of these 160 control patients, 48 underwent liver biopsy for diagnosis of inflammation or fibrosis. Forty-three (26.9%) had cirrhosis, which was diagnosed on the basis of histological analyses of liver biopsy specimens for 17. Patients were excluded if they had any evidence of autoimmune hepatitis or markers of hepatitis C virus, hepatitis D virus or human immunodeficiency virus. An ultrasonography scoring system for liver surface, parenchyma, vascular structure, and spleen size was used to describe the severity of hepatic parenchymal damage [29, 30]. Cirrhosis was diagnosed by histologic analysis of liver biopsy specimens or by findings of repeated ultrasonography (performed at least twice at intervals of 6 months) that were suggestive of cirrhosis, supplemented with clinical criteria indicating portal hypertension (i.e., the presence of ascites, thrombocytopenia, and esophageal varices). There were 2 diagnostic criteria for the diagnosis of HCC: (1) positive findings of cytologic or pathologic examinations or (2) typical images compatible with HCC plus an -feto protein level of 400 ng/ml. Serum samples from each subject were frozen at 70 C until use. For patients with HCC, serum samples were collected at the time when HCC was diagnosed. None of the patients received any antiviral treatment (i.e., interferon, lamivudine, adefovir, or entecavir) before or at the time of study entry. This study was approved by the ethical committee of Chang Gung Memorial Hospital. Serologic analysis. The presence of HBsAg, HBeAg, anti- HCV antibodies, and anti-hdv antibodies was determined using commercial assay kits (HBsAg was detected by EIA [Abbott], HBeAg was detected by EIA [Abbott], anti-hcv was detected by EIA 3.0 [Abbott], and anti-hdv was detected by RIA [Abbott]). HBV DNA was quantified using Amplicor HBV Monitor (Roche Diagnostic Systems) with a detection limit of 300 copies/ml. Dilution was performed if HBV DNA levels were 10 6 copies/ ml. PCR amplification and direct sequencing of core promoter/ precore and pre-s/surface genes. Nested PCR for amplification of BCP/precore genes was performed as previously described [18]. For pre-s sequence analysis, pre-s genes were amplified using respective primer pairs (table 1). First-round PCR was performed as follows: 95 C for 2 min; denaturation at 95 C for 50 s, primer annealing at 50 C for 50 s, and extension at 72 C for 2 min for 30 cycles; and a final extension step at 72 C for 7 min. After the first amplification, 5 L of the PCR products Pre-S/Surface and BCP/Precore in Hepatocellular Carcinoma JID 2008:198 (1 December) 1635
3 Table 1. Primer sequences for polymerase chain reaction of pre-s/surface and pre-core/ core promoter genes of hepatitis B virus. Primer Sequence, 5'33' Nucleotide position Enhancer II/core promoter/precore gene First round PC-1 CATAAGAGGACTCTTGGACT PC-2 AAAGAATTCAGAAGGCAAAAAAGA Second round PC-3 AATGTCAACTACCGACCTTG PC-4 TCCACAGAAGCTCCGAATTC Surface gene First round S-1 ACCAATCGGCAGTCAGGAA S-2 CCCAAAAGACCCAAATTC Second round S-3 TTCCTGCTGGTGGCTCCAG S-4 CCAATACATATCCCATGAACT Pre-S gene First round PS-1 AAAATTAATTATCCTGCTAGG PS-2 GAGAAGTCCACCACGAGTC Second round PS-3 TTTACAACTCTGTGGAAGGC PS-4 GAGTCTAGACTCTGTGGTATTGTG were reamplified for another 30 cycles with the same PCR condition as the first-round reaction. For surface sequence analysis, surface genes were amplified using respective primer pairs (table 1) under the same PCR condition described above. The sensitivity of the PCR assay was found to be 100 copies/ml, which was determined through a series of dilutions of plasmid with a known concentration that contained the HBV genome. All necessary precautions to prevent cross-contamination were taken, and negative controls were included in each assay. The nucleotide sequences of the amplified products were directly determined using fluorescent-labeled primers with an ABIPrism 377 Genetic Analyzer (Applied Biosystems). For comparisons of the nucleotide sequences and deduced amino acid sequence analysis, AB from Genbank was defined as a reference. HBV genotyping. HBV genotypes were determined from serum samples, using PCR restriction fragment length polymorphism genotyping based on analysis of the surface gene, as previously described [31]. Data analysis. Data are presented as means ( SD) or proportions. To compare the values between the 2 groups, 2 or Fisher exact tests were used for categorical variables. All amino acid or nucleotide variants in pre-s/surface and precore/core promoter regions were interpreted. Previous studies reported that HCC and pre-s deletions were more frequently in HBV carriers with genotype C [12 15, 25, 26], so the amino acid or nucleotide variants highly specific for HBV genotypes (B or C) ( 90% by the goodness-of-fit test) were excluded for analysis of HCC and pre-s deletions. Specific substitutions significantly associated with HCC or pre-s deletions after analysis were selected. Because previous studies have indicated that HBV carriers with T1762/A1764, A1896, and pre-s deletion mutations were at increased risk for HCC [12, 26, 28], these mutations were also included for analysis of HCC. Student t tests were used for analysis of continuous variables. Stepwise multiple logistic regression analysis was performed to assess the influence of various factors on the risk of HCC and pre-s deletions. All statistical tests were 2-sided. A P value of.05 was considered statistically significant. RESULTS Clinical features and virologic characteristics of patients with and patients without HCC. The clinical features and virologic characteristics for patients with and patients without HCC are presented in table 2. Ten amino acid or nucleotide variants in the pre-s/surface and precore/core promoter regions were significantly associated with HCC, and these variants along with A1896 and pre-s deletions were included for analysis of HCC (table 2). Compared with control patients, patients with HCC had higher frequencies of pre-s deletions and amino acid substitutions at codon 4, 7, and 81 in pre-s1 genes; at the start codon in pre-s2 genes; and at codon 68 in the surface genes. Patients also had a lower frequency of amino acid substitution at codon 2 in pre-s JID 2008:198 (1 December) Chen et al.
4 Table 2. Comparison of demographic and virologic characteristics for patients with hepatocellular carcinoma (HCC) and control patients with hepatitis B virus (HBV) infection. Total Control patients (n 160) Patients with HCC (n 80) P Age, years Sex (male: female).999 Male Female ALT, U/L Total bilirubin level, mg/dl HBeAg positivity HBV DNA level, log copies/ml Genotype.019 B C 45 (28.1) 34 (42.5) B and C 0 1 D 0 1 Pre-S deletions 27 (16.9) 28 (35).002 Pre-S1 gene W4P/R 7 (4.4) 10 (12.5).021 K7T/N 7 (4.4) 10 (12.5).021 A81T 7 (4.4) 11 (13.8).009 Pre-S2 gene M1V/I/A 24 (15) 23 (28.8).011 Q2K/R 15 (9.4) Surface gene(s) I68T 8 (5) 13 (16.3).004 BCP and precore genes(s) C or G (14.4) 21 (26.3).025 T1762/A (51.3) 63 (78.8).001 T (35.6) 42 (52.5).012 A (65.6) 58 (72.5).28 A (18.8) 27 (33.8).01 NOTE. Data are no. (%) of subjects or mean SD. ALT, alanine aminotransferase; BCP, basal core promoter. genes, compared with control patients. In BCP and precore genes, patients with HCC had higher frequencies of C or G1753, A1762/T1764, T1846, and A1899 mutants or variants than did control patients. Most of these pre-s variants contained T cell and B cell epitopes or important functional sites. The amino acid sequence at codon 81 in pre-s1 genes contained heat shock protein 70 (Hsc 70) binding site (aa ), cytosolic anchorage determinant (CAD) (aa ), and S-promoter (nt ). The amino acid sequence at start codon and codon 2 in pre-s2 genes contained B-epitope (aa ), nucleocapsid binding site (aa ), viral secretion (aa ), and the start codon of M protein (aa 120). Because of overlap of the HBV pre-s/surface and polymerase genes, these gene variants in pre- S/surface regions can result in amino acid changes in the polymerase region (table 3). Clinical features and virologic characteristics of patients infected with HBV genotypes B and/or C. Of the 240 patients, 159 were infected with genotype B, 79 with genotype C, 1 with mixed genotype B and C, and 1 with genotype D. Patients with genotype C infection had a higher rate of HBeAg positivity than those with genotype B infection (18 of 79 vs. 12 of 159; P.001). Patients with genotype B and/or C infection did not differ significantly in age, sex, alanine aminotransferase (ALT) and total bilirubin levels, or HBV DNA level. With regard to the 12 amino acids or sequence variants listed in table 2, compared with patients with genotype B infection, patients with genotype C infection had higher frequencies of pre-s deletions (31 of 79 vs. 23 of 159; P.001), amino acid substitutions at codon 4 (17 of 79 vs. 0 of 159; P.001), codon 7 (14 of 79 vs. 3 of 159; P.001), and codon 81 (16 of 79 vs. 2 of 159; P.001) in pre-s1 genes, at codon 68 (12 of 79 vs. 8 of 159; P.008) in surface genes, and C or G1753 (27 of 79 vs. 16 of 159; P.001) and T1762/A1764 (72 of 79 vs. 71 of 159; P.001) mutations. Patients with genotype C infection also had lower rates of T1864 Pre-S/Surface and BCP/Precore in Hepatocellular Carcinoma JID 2008:198 (1 December) 1637
5 Table 3. Sequence variants in pre-s and surface regions and their consequences for polymerase genes. Pre-S or surface regions, aa Pre-S1 W4P/R K7T/N A81T Pre-S2 M1V/I/A Q2K/R Surface I68T Polymerase region, aa L184S Q187H, N188H G261D H300R A301E, V302M A422 (no change) NOTE. Sequence variants in pre-s and surface regions are listed in listed in table 2. aa, amino acid. (24 of 79 vs. 73 of 159; P.022) and A1896 (46 of 79 vs. 115 of 159; P.029) than those with genotype B infection. Risk factors of pre-s deletions. Of the 240 patients, 55 were infected with pre-s deletion mutants. The baseline and virologic characteristics of patients with and patients without pre-s deletions are shown in table 4. Compared with patients without pre-s deletions, patients with pre-s deletions had higher rates of HBeAg positivity; HBV genotype C, K7T/N, and T68I/V in pre-s1 genes; C75Y in surface genes; and T1762/A1764 mutations. Multiple logistic regression analysis for factors associated with pre-s deletions was performed and included age, sex, ALT and total bilirubin levels, HBeAg status, HBV DNA levels, HBV genotype, and the 4 amino acid or sequence variants listed in table 4. Only HBV genotype C (odds ratio [OR], 3.79; 95% confidence interval [CI], ; P.001) was an independent factor associated with the development of pre-s deletions. The location and size of pre-s deletions are present in table 5. Of the 55 patients with pre-s deletions, the variants of pre-s deletion mutants could be categorized into 6 major types according to the deletion site: type I (9 with HCC and 6 without HCC; pre-s1 deletion [N-half predominant; range, aa 1 85]; type II (2 with HCC and 3 without HCC; pre-s1 deletion [C-half predominant; range, aa ]); type III (1 with HCC and 4 without HCC; border deletion between pre-s1 and pre-s2 region [range, aa ]); type IV (11 with HCC and 11 without HCC; pre-s2 deletion only [range, aa ]); type V (2 with HCC and 2 without HCC; deleted at 2 separated sites, one in the pre-s1 region, the other in the pre-s2 region); and type VI (4 patients; unclassified). The amino acid length of pre-s deletions varied from 1 to 174. Pre-S deletions were more often found between amino acids 120 and 142 of the pre-s2 domain (22 [40%] of 55). The same deletions were found in different patients (table 5). Most of the deletion regions encompassed T cell and B cell epitopes and important functional sites [26]. The location and size of pre-s deletions did not predict HCC development. Table 4. Comparison of baseline demographic and virologic characteristics for patients with and those without pre-s deletion. Variable No pre-s deletion (n 185) Pre-S deletion (n 55) P Age, years Sex.57 Male Female 33 8 ALT level, U/L Total bilirubin level, mg/dl HBeAg positivity 17 (9.2) 13 (23.6).004 HBV DNA level, log copies/ml HBV genotype.001 B C Pre-S1 genes K7T/N 9 (4.9) 8 (14.5).014 T68I/V 41 (22.2) 4 (7.3).011 Surface genes C75Y 23 (12.4) 1 (1.8).02 BCP/precore genes T1762/A (55.1) 43 (78.2).002 NOTE. Data are no. (%) of subjects or mean SD. ALT, alanine aminotransferase; BCP, basal core promoter; HBeAg, hepatitis B virus e antigen; HBV, hepatitis B virus; HCC, hepatocellular carcinoma JID 2008:198 (1 December) Chen et al.
6 Table 5. Characteristics of the pre-s deletions and their consequences to polymerase genes No. of subjects (study group) Pre-S region, aa Size of deletion, bp Region, nt Polymerase region, aa Deletion pattern a 1 (HCC) II 1 (HCC) III 1 (HCC) IV 3 (1 from HCC, 2 from control) IV 1 (HCC) 1 6, , , , V 1 (HCC) 3 13, , , , 300 V 3 (1 from HCC, 2 from control) IV 1 (HCC) II 1 (HCC) I 1 (HCC) I 1 (HCC) IV 1 (HCC) I 1 (HCC) VI 1 (HCC) I 1 (HCC) IV 1 (HCC) I 2 (1 from HCC, 1 from control) IV 1 (HCC) IV 1 (HCC) I 1 (HCC) I 1 (HCC) VI 1 (HCC) IV 1 (HCC) IV 1 (HCC) I 2 (1 from HCC, 1 from control) IV 2 (1 from HCC, 1 from control) I 1 (HCC) VI 1 (HCC) IV 1 (control) IV 1 (control) IV 1 (control) III 1 (control) III 1 (control) III 1 (control) II 1 (control) VI 1 (control) 12 49, , , , I 1 (control) III 1 (control) 2 8, , , , I 1 (control) I 1 (control) IV 1 (control) I 1 (control) 120, , , , V 1 (control) IV 1 (control) I 1 (control) 1 6, , , , V 1 (control) IV 1 (control) II 1 (control) II NOTE. aa, amino acid; bp, base pair; HCC, hepatocellular carcinoma; nt, nucleotide. a Deletion mutants are divided into the following 6 types: type I, pre-s1 deletion (N-half predominant; range, aa 1 85); type II, pre-s1 deletion (C-half predominant; range, aa ); type III, border between pre-s1 and pre-s2 region; type IV, pre-s2 deletion only; type V, deleted at 2 separated sites, one in the pre-s1 region, the other in the pre-s2 region; and type VI, unclassified.
7 Table 6. Association of predictive factors with the risk of hepatocellular carcinoma during chronic hepatitis B virus (HBV) infection. Factor OR a (95% CI) P I68T in surface gene 3.07 ( ).026 Pre-S deletion 2.17 ( ).021 T1762/A1764 mutations 2.81 ( ).002 A1899 mutation 2.03 ( ).033 NOTE. Variables for analysis included age (continuous variable), sex (male or female), alanine aminotransferase level ( 40 U/L or other), total bilirubin level ( 3 mg/dl or other), HBV e antigen (positivity or negativity), HBV DNA level ( 10 5 copies/ml or other), genotype (genotype C or other), pre-s deletions (presence or absence), and 11 amino acid or sequence variants listed in table 2. CI, confidence interval; OR, odds ratio. a Presence vs. absence of hepatocellular carcinoma. Multivariate analysis of factors potentially associated with HCC development. To determine the independent contribution of clinical features and each viral factor to the development of HCC, multiple logistic regression analysis was performed and included age, sex, ALT and total bilirubin levels, HBeAg status, HBV DNA levels, HBV genotype, pre-s deletions, and 11 amino acid or sequence variants listed in table 2. The significant factors associated with HCC development were pre-s deletions, I68T in surface genes, and T1762/A1764 and A1899 mutations (table 6). To further clarify the virologic factors of different HBV genotypes that contribute to HCC development, multiple logistic regression analyses were performed by subgroups (genotypes B and C). Patients infected with genotype B showed that T1762/ A1764 (OR, 3.22; 95% CI, ; P.002) and pre-s deletions (OR, 3.30; 95% CI, ; P.013) were significantly associated with a higher risk of HCC. In contrast, patients infected with genotype C revealed that A81T in pre-s1 genes (OR, 5.04; 95% CI, ; P.01) and C or G1753 (OR: 2.92, 95% CI: ; P.039) were significant risk factors associated with HCC. Multivariate analysis revealed 4 viral factors with a significant association with HCC development. However, the factor of I68T in surface genes was precluded from statistical analysis because certain groups had 5 patients. Thus, statistical analysis of the other 3 mutation combinations (pre-s deletions, T1762/A1764 mutations, and A1899 mutation) was performed in the analysis of the combined risk for HCC. Our data showed that any 2 or 3 combinations rather than a single mutation were significantly associated with the development of HCC (table 7). Furthermore, compared with patients with wild-type HBV at both or 3 genomic regions, patients with combined mutations of T1762/ A1764 and pre-s deletions (OR, 7.81; 95% CI, ), T1762/A1764 and A1899 (OR, 7.7; 95% CI, ), pre-s deletions and A1899 (OR, 7.0; 95% CI, ), and T1762/ A1764, pre-s deletions, and A1899 (OR, 16.88; 95% CI, ) had a higher risk of HCC. DISCUSSION In this study, T1762/A1764 mutations, pre-s deletions, I68T in surface gene, and the A1899 mutation were independent factors associated with HCC development. HBV genotype C was not an independent factor associated with the development of HCC. The results were compatible with those of 2 recent case-control studies, which suggested that HBV genotype C was not an independent factor for HCC after adjustment for T1762/A1764 mutations [32, 33]. Because HBV genotype C tends to have a higher frequency of T1762/A1764 mutations, the association between genotype C and HCC might in fact be due to the close association of HBV genotype C and T1762/A1764 mutations. Thus, the effect of the T1762/A1764 mutations on the development of HCC Table 7. Association between hepatocellular carcinoma (HCC) and specific mutation patterns of hepatitis B virus (HBV) among patients with HCC and control patients with HBV infection. HBV mutation pattern Patients with HCC (n 80) Control patients (n 160) P No mutation 8 (10) 60 (37.5).001 Any mutation 72 (90) 100 (62.5).001 T1762/A1764 alone or in any combination 63 (78.8) 82 (51.3).001 T1762/A1764 alone 29 (36.3) 48 (30).33 T1762/A1764 and A (26.3) 18 (11.3).003 A1899 alone or in any combination 27 (33.8) 30 (18.8).01 A1899 alone 3 (3.8) 11 (6.9).33 Pre-S deletions alone or in any combination 28 (35) 27 (16.9).002 Pre-S deletions alone 2 (2.5) 6 (3.8).72 Pre-S deletions and T1762/A (28.8) 20 (12.5).002 Pre-S deletions and A (15) 5 (3.1).002 Pre-S deletions and T1762/A1764 and A (11.3) 4 (2.5) JID 2008:198 (1 December) Chen et al.
8 might be strong enough to mask the effect of HBV genotype C. Moreover, HBV gene variants related to HCC were different between HBV genotypes B and C. In our study, although HBV genotype C had higher proportions of T1762/A1764 and pre-s deletion mutants, A81T in pre-s1 gene and G or C1753 variants were independent factors associated with HCC in HBV genotype C. In contrast, T1762/A1764 and pre-s deletion mutants were major determinants for HCC in HBV genotype B. Our study showed that T1762/A1764 was a strong predictor for HCC, which was similar to findings of previous studies [32, 33]. It has been proposed that T1762/A1764 mutations can increase viral replication by changing the pregenomic secondary structure [34]. In addition, this mutation increased the transcription of pregenomic RNA through the removal of the nuclear receptor-binding site and the creation of a binding site for hepatocyte nuclear factor-1 transcription factor [35]. In addition to T1762/A1764, the prevalences of C or G1753, T1846, and A1899 mutations in the BCP and precore regions were significantly higher among patients with HCC than among patients without HCC. Results of our study are compatible with those of a recent study that found T1653 and/or V1753 mutations were differently associated with HCC among HBV genotype C carriers [20]. One of the limitations of the present study is that the role of T1653 mutation in the enhancer II region has not been studied. Furthermore, previous studies showed that mutations at nucleotides 1846 and 1899 were found in tumorous and nontumorous tissues from patients with HCC [36, 37]. However, the real mechanism that underlies the interaction between both mutations and HCC remains unclear and merits further study. Previous studies showed that pre-s deletions were more frequent among carriers of HBV genotype C than among carriers of genotype B [25, 26]. Our findings were compatible with these previous reports. Our study found that pre-s deletion was an important risk factor for HCC, which was compatible with findings of recent studies [25, 26]. The pre-s regions play an essential role in the interaction with immune responses because they contain several epitopes for T or B cells [21]. In persistent HBV infection, immune epitope deletion mutants occur, escape the host immune surveillance, and lose important functional sites. These deletion mutants result in the intracellular retention of HBV envelope proteins and viral particles, as well as the formation of ground glass hepatocytes [38, 39]. The accumulation of pre-s mutants in the endoplasmic reticulum (ER) may subsequently induce ER stress. Through ER stress signaling pathways, the pre-s mutant large HBV surface antigens (LHBs) can induce oxidative stress and lead to oxidative DNA damage of HBVinfected hepatocytes. The oxidative DNA damage caused by pre-s mutant LHBs in turn lead to liver cell damage and genomic instability [40, 41] that may result in HCC. The influence of various types of mutations in pre-s and surface genes on HCC remains unclear. It has been reported that infection by pre-s2 defective HBV and mutations in the a-determinant of the surface gene were often associated with HCC or end-stage liver disease [24, 42, 43]. Pre-S2 defective HBV with point mutations in the pre-s2 ATG have also been isolated from patients with fulminant hepatitis [24]. However, the results of these studies are not consistent. In our study, there was a significant difference in amino acid substitutions at codons 4, 7, and 81 in pre-s1 genes, at the start codon and codon 2 in pre-s2 genes, and at codon 68 in surface genes between patients with and those without HCC. However, patients with and those without HCC did not significantly differ in mutations of the a-determinant regions. These amino acid substitutions in pre-s and surface genes related to HCC have rarely been reported. Thus, further studies are needed. Recent studies demonstrated that HBV with a complex mutation pattern was associated with the development of advanced liver diseases [26, 44]. Chen et al. [26] found that complex viral mutants of BCP/precore mutations and pre-s deletion seem to be associated with the development of advanced liver diseases. Preikschat et al. [44] reported that HBV-variant populations characterized by deletions/insertions in the core promoter plus deletions in the C gene and/or deletions in the pre-s region were more frequently found among patients who developed liver cirrhosis than among immunosuppressed renal transplant recipients. Our previous longitudinal study showed that HBV with a complex mutation (pre-s deletion, T1762/A1764, and T1766 and/or A1768 mutants) was associated with the development of liver cirrhosis; however, the number of persons who developed HCC during follow-up was limited [28]. In the current study, HBV with a complex mutation pattern (pre-s deletions, T1762/ A1764, and A1899 mutations) rather than a single mutation was associated with the development of HCC, and the risk of HCC was substantially increased among patients who had these HBV mutations in combination. Thus, detection of these combined mutations may aid in the identification of chronic HBV carriers at high risk for development of HCC. In summary, T1762/A1764 mutations, pre-s deletions, I68T in the surface gene, and the A1899 mutation were independent risk factors for the development of HCC. HBV with a complex mutation pattern was associated with the development of HCC, and the HCC risks increased in patients having these factors in combination. Furthermore, HBV variants or mutations related to HCC were different between HBV genotypes B and C. References 1. Lee WM: Hepatitis B virus infection. N Engl J Med 1997; 337: Chen DS. From hepatitis to hepatoma: lessons from type B viral hepatitis. Science 1993; 262: Chu CM, Liaw YF. Natural history of chronic hepatitis B virus infection: an immunopathological study. J Gastroenterol Hepatol 1997; 12:S Lee CM, Lu SN, Changchien CS, et al. Age, gender, and local geographic variations of viral etiology of hepatocellular carcinoma in a hyperendemic area for hepatitis B virus infection. Cancer 1999; 86: Pre-S/Surface and BCP/Precore in Hepatocellular Carcinoma JID 2008:198 (1 December) 1641
9 5. Chen DS. Hepatitis B virus infection, its sequelae, and prevention in Taiwan. In: Okuda K, Ishak KG, eds. Neoplasms of the liver. Tokyo, Japan: Springer-Verlag, 1987: Okamoto H, Tsuda F, Sakugawa H, et al. Typing hepatitis B virus by homology in nucleotide sequence: comparison of surface antigen subtypes. J Gen Virol 1988; 69: Norder H, Hammas B, Lofdahl S, Courouce AM, Magnius LO. Comparison of the amino acid sequences of nine different serotypes of hepatitis B surface antigen and genomic classification of the corresponding hepatitis B virus strains. J Gen Virol 1992; 73: Stuyver L, De Gendt S, Van Geyt C, et al. A new genotype of hepatitis B virus: complete genome and phylogenetic relatedness. J Gen Virol 2000; 81: Kao JH, Chen PJ, Lai MY, Chen DS. Hepatitis B genotypes correlate with clinical outcomes in patients with chronic hepatitis B. Gastroenterology 2000; 118: Lindh M, Hannoun C, Dhillon AP, Norkrans G, Horal P. Core promoter mutations and genotypes in relation to viral replication and liver damage in East Asian hepatitis B virus carriers. J Infect Dis 1999; 179: Lee CM, Chen CH, Lu SN, et al. Prevalence and clinical implications of hepatitis B virus genotypes in southern Taiwan. Scand J Gastroenterol 2003; 38: Kao JH, Chen PJ, Lai MY, Chen DS. Basal core promoter mutations of hepatitis B virus increase the risk of hepatocellular carcinoma in hepatitis B carriers. Gastroenterology 2003; 124: Yu MW, Yeh SH, Chen PJ, et al. Hepatitis B virus genotype and DNA level and hepatocellular carcinoma: a prospective study in men. J Natl Cancer Inst 2005; 97: Chan HL, Hui AY, Wong ML, et al. Genotype C hepatitis B virus infection is associated with increased risk of hepatocellular carcinoma. Gut 2004; 53: Fujie H, Moriya K, Shintani Y, Yotsuyanagi H, Iino S, Koike K. Hepatitis B virus genotypes and hepatocellular carcinoma in Japan. Gastroenterology 2001; 120: Yuen MF, Sablon E, Yuan HJ, et al. Significance of hepatitis B genotype in acute exacerbation, HBeAg seroconversion, cirrhosis-related complications, and hepatocellular carcinoma. Hepatology 2003; 37: Sumi H, Yokosuka O, Seki N, et al. Influence of hepatitis B virus genotypes on the progression of chronic type B liver disease. Hepatology 2003; 37: Chen CH, Lee CM, Lu SN, et al. Clinical significance of hepatitis B virus (HBV) genotypes and precore and core promoter mutations affecting HBV e antigen expression in Taiwan. J Clin Microbiol 2005; 43: Takahashi K, Ohta Y, Kanai K, et al. Clinical implications of mutations C-to-T1653 and T-to-C/A/G1753 of hepatitis B virus genotype C genome in chronic liver disease. Arch Virol 1999; 144: Tanaka Y, Mukaide M, Orito E, et al. Specific mutations in enhancer II/core promoter of hepatitis B virus subgenotypes C1/C2 increase the risk of hepatocellular carcinoma. J Hepatol 2006; 45: Chisari FV, Ferrari C. Hepatitis B immunopathogenesis. Annu Rev Immunol 1995; 13: Brown SE, Howard CR, Zuckerman AJ, Steward MW. Affinity of antibody responses in man to hepatitis B vaccine determined with synthetic peptides. Lancet 1984; 2: Fan YF, Lu CC, Chen WC, et al. Prevalence and significance of hepatitis B virus (HBV) pre-s mutants in serum and liver at different replicative stages of chronic HBV infection. Hepatology 2001; 33: Pollicino T, Zanetti AR, Cacciola I, et al. Pre-S2 defective hepatitis B virus infection in patients with fulminant hepatitis. Hepatology 1997; 26: Sugauchi F, Ohno T, Orito E, et al. Influence of hepatitis B virus genotypes on the development of pres deletions and advanced liver disease. J Med Virol 2003; 70: Chen BF, Liu CJ, Jow GM, Chen PJ, Kao JH, Chen DS. High prevalence and mapping of pre-s deletion in hepatitis B virus carriers with progressive liver diseases. Gastroenterology 2006; 130: Wang HC, Huang W, Lai MD, Su IJ. Hepatitis B virus pre-s mutants, endoplasmic reticulum stress and hepatocarcinogenesis. Cancer Sci 2006; 97: Chen CH, Hung CH, Lee CM, et al. Pre-S deletion and complex mutations of hepatitis B virus related to advanced liver disease in HBeAgnegative patients. Gastroenterology 2007; 133: Lin DY, Sheen IS, Chiu CT, Lin SM. Kuo YC. Liaw YF. Ultrasonographic changes of early liver cirrhosis in chronic hepatitis B: a longitudinal study. J Clin Ultrasound 1993; 21: Hung CH, Lu SN, Wang JH, et al. Correlation between ultrasonographic and pathologic diagnoses of hepatitis B and C virus-related cirrhosis. J Gastroenterol 2003; 38: Mizokami M, Nakano T, Orito E, et al. Hepatitis B virus genotype assignment using restriction fragment length polymorphism patterns. FEBS Lett 1999; 450: Liu CJ, Chen BF, Chen PJ, et al. Role of hepatitis B viral load and basal core promoter mutation in hepatocellular carcinoma in hepatitis B carriers. J Infect Dis 2006; 193: Yuen MF, Tanaka Y, Mizokami M, et al. Role of hepatitis B virus genotype Ba and C, core promoter and precore mutations on hepatocellular carcinoma: a case control study. Carcinogenesis 2004; 25: Kidd AH, Kidd-Ljunggren K. A revised secondary structure model for the 3 -end of hepatitis B virus pregenomic RNA. Nucleic Acid Res 1996; 24: Li J, Buckwold VE, Hon MW, Ou JH. Mechanism of suppression of hepatitis B virus precore RNA transcription by a frequent double mutation. J Virol 1999; 73: Zhong S, Chan JY, Yeo W, Tam JS, Johnson PJ. Frequent integration of precore/core mutants of hepatitis B virus in human hepatocellular carcinoma tissues. J Viral Hepat 2000; 7: Cho SW, Shin YJ, Hahm KB, et al. Analysis of the precore and core promoter DNA sequence in liver tissues from patients with hepatocellular carcinoma. J Korean Med Sci 1999; 14: Fan YF, Lu CC, Chen WC, et al. Prevalence and significance of hepatitis B virus (HBV) pre-s mutants in serum and liver at different replicative stages of chronic HBV infection. Hepatology 2001; 33: Wang HC, Wu HC, Chen CF, Lei HY, Su IJ. Different types of ground glass hepatocytes in chronic hepatitis B virus infection contain specific pre-s mutants that induce endoplasmic reticulum stress. Am J Path 2003; 163: Hsieh YH, Su IJ, Wang HC, et al. Pre-S mutant surface antigens in chronic hepatitis B virus infection induce oxidative stress and DNA damage. Carcinogenesis 2004; 25: Gunther S, Fischer L, Pult I, Sterneck M, Will H. Naturally occurring variants of hepatitis B virus. Adv Virus Res 1999; 52: Zhong S, Chan JY, Yeo W, Tam JS, Johnson PJ. Hepatitis B envelope protein mutants in human hepatocellular carcinoma tissue. J Viral Hepat 1999; 6: Liu CJ, Kao JH, Shau WY, Chen PJ, Lai MY, Chen DS. Naturally occurring hepatitis B surface gene variants in chronic hepatitis B virus infection: correlation with viral serotypes and clinical stages of liver disease. J Med Virol 2002; 68: Preikschat P, Gunther S, Reinhold S, et al. Complex HBV populations with mutations in core promoter, C gene, and pre-s region are associated with development of cirrhosis in long-term renal transplant recipients. Hepatology 2002; 35: JID 2008:198 (1 December) Chen et al.
Spontaneous hepatitis B e antigen (HBeAg) seroconversion
GASTROENTEROLOGY 2007;133:1466 1474 Pre-S Deletion and Complex Mutations of Hepatitis B Virus Related to Advanced Liver Disease in HBeAg-Negative Patients CHIEN HUNG CHEN,*, CHAO HUNG HUNG,* CHUAN MO LEE,*,,
More informationRole of Hepatitis B Virus Genotypes in Chronic Hepatitis B Exacerbation
BRIEF REPORT Role of Hepatitis B Virus Genotypes in Chronic Hepatitis B Exacerbation Man-Fung Yuen, 1 Erwin Sablon, 2 Danny Ka-Ho Wong, 1 He-Jun Yuan, 1 Benjamin Chun-Yu Wong, 1 Annie On-On Chan, 1 and
More informationNatural History of HBV Infection
Natural History of HBV Infection Joseph JY Sung MD PhD Institute of Digestive Disease Department of Medicine & Therapeutics Prince of Wales Hospital The Chinese University of Hong Kong HBV Infection 2
More informationJournal of Antimicrobial Chemotherapy Advance Access published April 25, 2013
Journal of Antimicrobial Chemotherapy Advance Access published April 25, 213 J Antimicrob Chemother doi:1.193/jac/dkt147 Virological response to entecavir reduces the risk of liver disease progression
More informationYuen, MF; Sablon, E; Yuan, HJ; Hui, CK; Wong, DKH; Doutreloigne, J; Wong, BCY; Chan, AOO; Lai, CL
Title Author(s) Relationship between the development of precore and core promoter mutations and hepatitis B e antigen seroconversion in patients with chronic hepatitis B virus Yuen, MF; Sablon, E; Yuan,
More informationReceived 30 May 2004/Returned for modification 6 August 2004/Accepted 12 August 2004
JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 2004, p. 5036 5040 Vol. 42, No. 11 0095-1137/04/$08.00 0 DOI: 10.1128/JCM.42.11.5036 5040.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved.
More informationChronic hepatitis B virus (HBV) infection remains a major
CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2010;8:541 545 Hepatitis B Virus DNA Level Predicts Hepatic Decompensation in Patients With Acute Exacerbation of Chronic Hepatitis B WEN JUEI JENG, I SHYAN SHEEN,
More informationGlobal Perspective on the Natural History of Chronic Hepatitis B: Role of Hepatitis B Virus Genotypes A to J
97 Global Perspective on the Natural History of Chronic Hepatitis B: Role of Hepatitis B Virus Genotypes A to J Chun-Jen Liu, MD, PhD 1,2,3 Jia-Horng Kao, MD, PhD 1,2,3,4 1 Graduate Institute of Clinical
More informationEstimation of Seroprevalence of Hepatitis B Virus and Hepatitis C Virus in Taiwan from a Large-scale Survey of Free Hepatitis Screening Participants
ORIGINAL ARTICLE Estimation of Seroprevalence of Hepatitis B Virus and Hepatitis C Virus in Taiwan from a Large-scale Survey of Free Hepatitis Screening Participants Chien-Hung Chen, 1 Pei-Ming Yang, 1
More informationHBV Core and Core-Related Antigen Quantitation in Chinese Patients with. Chronic Hepatitis B Genotype B and C Virus Infection
Title page HBV Core and Core-Related Antigen Quantitation in Chinese Patients with Chronic Hepatitis B Genotype B and C Virus Infection Short Title: Quantitation of HBc and HBcrAg in Chinese patients Akinori
More informationDuring the course of chronic hepatitis B virus. Long-Term Outcome After Spontaneous HBeAg Seroconversion in Patients With Chronic Hepatitis B
Long-Term Outcome After Spontaneous HBeAg Seroconversion in Patients With Chronic Hepatitis B Yao-Shih Hsu, 1 Rong-Nan Chien, 1 Chau-Ting Yeh, 1 I-Shyan Sheen, 1 Hung-Yi Chiou, 2 Chia-Ming Chu, 1 and Yun-Fan
More informationAn Update HBV Treatment
An Update HBV Treatment Epidemiology Natural history Treatment Daryl T.-Y. Lau, MD, MPH Associate Professor of Medicine Director of Translational Liver Research Division of Gastroenterology BIDMC, Harvard
More informationHepatitis B virus (HBV) infection is a global
VIRAL HEPATITIS Serum Hepatitis B Surface Antigen Levels Help Predict Disease Progression in Patients With Low Hepatitis B Virus Loads Tai-Chung Tseng, 1,3,8 Chun-Jen Liu, 2,3 Hung-Chih Yang, 2,6 Tung-Hung
More informationThe Impact of HBV Therapy on Fibrosis and Cirrhosis
The Impact of HBV Therapy on Fibrosis and Cirrhosis Jordan J. Feld, MD, MPH Associate Professor of Medicine University of Toronto Hepatologist Toronto Centre for Liver Disease Sandra Rotman Centre for
More informationCornerstones of Hepatitis B: Past, Present and Future
Cornerstones of Hepatitis B: Past, Present and Future Professor Man-Fung Yuen Queen Mary Hospital The University of Hong Kong Hong Kong 1 Outline Past Natural history studies Development of HBV-related
More informationSupplementary materials: Predictors of response to pegylated interferon in chronic hepatitis B: a
Supplementary materials: Predictors of response to pegylated interferon in chronic hepatitis B: a real-world hospital-based analysis Yin-Chen Wang 1, Sien-Sing Yang 2*, Chien-Wei Su 1, Yuan-Jen Wang 3,
More informationBasal Core Promoter Mutations of Hepatitis B Virus Increase the Risk of Hepatocellular Carcinoma in Hepatitis B Carriers
GASTROENTEROLOGY 2003;124:327 334 Basal Core Promoter Mutations of Hepatitis B Virus Increase the Risk of Hepatocellular Carcinoma in Hepatitis B Carriers JIA HORNG KAO,*, PEI JER CHEN,*, MING YANG LAI,*
More informationHepatitis B Virus Genotype B Is Associated With Earlier HBeAg Seroconversion Compared With Hepatitis B Virus Genotype C
GASTROENTEROLOGY 2002;122:1756 1762 Hepatitis B Virus Genotype B Is Associated With Earlier HBeAg Seroconversion Compared With Hepatitis B Virus Genotype C CHI JEN CHU, MUNIRA HUSSAIN, and ANNA S. F. LOK
More informationDiagnostic Methods of HBV and HDV infections
Diagnostic Methods of HBV and HDV infections Zohreh Sharifi,ph.D Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine Hepatitis B-laboratory diagnosis Detection
More informationVirion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics
Hepadnaviruses Virion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics Hepatitis viruses A group of unrelated pathogens termed hepatitis viruses cause the vast majority
More informationIndependent risk factors and predictive score for the development of hepatocellular carcinoma in chronic hepatitis B q
Journal of Hepatology (29) 8 88 www.elsevier.com/locate/jhep Independent risk factors and predictive score for the development of hepatocellular carcinoma in chronic hepatitis B q Man-Fung Yuen 1, *, Yasuhito
More informationE pidemiological studies have shown a strong association
1494 LIVER Genotype C hepatitis B virus infection is associated with an increased risk of hepatocellular carcinoma H L-Y Chan, A Y Hui, M L Wong, A M-L Tse, L C-T Hung, V W-S Wong, J J-Y Sung... See end
More informationMutants and HBV vaccination. Dr. Ulus Salih Akarca Ege University, Izmir, Turkey
Mutants and HBV vaccination Dr. Ulus Salih Akarca Ege University, Izmir, Turkey Geographic Distribution of Chronic HBV Infection 400 million people are carrier of HBV Leading cause of cirrhosis and HCC
More informationOccult Hepatitis B Infection: why, who and what to do?
Occult Hepatitis B Infection: why, who and what to do? MF Yuen, MD, PhD Chair of Gastroenterology and Hepatology Department of Medicine The University of Hong Kong Queen Mary Hospital, Hong Kong Who? Different
More informationNatural History of Chronic Hepatitis B
Natural History of Chronic Hepatitis B Anna SF Lok, MD Alice Lohrman Andrews Professor in Hepatology Director of Clinical Hepatology Assistant Dean for Clinical Research University of Michigan Ann Arbor,
More informationPhylogenetic, Virological, and Clinical Characteristics of Genotype C Hepatitis B Virus with TCC at Codon 15 of the Precore Region
JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 2006, p. 681 687 Vol. 44, No. 3 0095-1137/06/$08.00 0 doi:10.1128/jcm.44.3.681 687.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Phylogenetic,
More informationWhat have we learned from HBV clinical cohorts?
PHC 2015: Hepatitis B What have we learned from HBV clinical cohorts? Jia-Horng Kao MD, Ph D Graduate Institute of Clinical Medicine, Hepatitis Research Center, Department of Internal Medicine, National
More informationHepatitis B Virus Genotype C Is Associated With More Severe Liver Fibrosis Than Genotype B
CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2009;7:1361 1366 Hepatitis B Virus Is Associated With More Severe Liver Fibrosis Than HENRY LIK YUEN CHAN, GRACE LAI HUNG WONG, CHI HANG TSE, ANGEL MEI LING CHIM,
More informationPisit Tangkijvanich Pattaratida Sa-nguanmoo Varocha Mahachai Apiradee Theamboonlers Yong Poovorawan
Hepatol Int (2010) 4:577 584 DOI 10.1007/s12072-010-9197-z ORIGINAL ARTICLE A case control study on sequence variations in the enhancer II/core promoter/precore and X genes of hepatitis B virus in patients
More informationDiagnostic Methods of HBV infection. Zohreh Sharifi,ph.D of Virology Research center, Iranian Blood Transfusion Organization (IBTO)
Diagnostic Methods of HBV infection Zohreh Sharifi,ph.D of Virology Research center, Iranian Blood Transfusion Organization (IBTO) Hepatitis B-laboratory diagnosis Detection of HBV infection involves
More informationTo test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
More informationViral Hepatitis Diagnosis and Management
Viral Hepatitis Diagnosis and Management CLINICAL BACKGROUND Viral hepatitis is a relatively common disease (25 per 100,000 individuals in the United States) caused by a diverse group of hepatotropic agents
More informationDoes Viral Cure Prevent HCC Development
Does Viral Cure Prevent HCC Development Prof. Henry LY Chan Head, Division of Gastroenterology and Hepatology Director, Institute of Digestive Disease Director, Center for Liver Health Assistant Dean,
More informationChronic infection with hepatitis B virus (HBV) is still a
CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2012;10:527 534 Incidence and Determinants of Spontaneous Hepatitis B e Antigen and DNA in Patients With Chronic Hepatitis B HWAI I YANG,*,, HSIU LIAN HUNG, MEI
More informationMulticentre study of hepatitis B virus genotypes in France: correlation with liver fibrosis and hepatitis B e antigen status
Journal of Viral Hepatitis, 2006, 13, 329 335 doi:10.1111/j.1365-2893.2005.00692.x Multicentre study of hepatitis B virus genotypes in France: correlation with liver fibrosis and hepatitis B e antigen
More informationNATURAL HISTORY OF HEPATITIS B
NATURAL HISTORY OF HEPATITIS B AND DIAGNOSTIC: STATE OF THE ART O. BAHRI LABORATORY OF MEDICAL BIOLOGY AZIZA OTHMANA HOSPITAL TUNIS, TUNISIA The 2 nd Congress of The Federation of Arab Societies of Clinical
More informationCURRENT TREATMENT. Mitchell L Shiffman, MD Director Liver Institute of Virginia Bon Secours Health System Richmond and Newport News, Virginia
CURRENT TREATMENT OF HBV Mitchell L Shiffman, MD Director Liver Institute of Virginia Bon Secours Health System Richmond and Newport News, Virginia CHRONIC HBV INFECTION DEMOGRAPHICS IN THE USA Estimated
More informationManagement of Chronic Hepatitis B in Asian Americans
Management of Chronic Hepatitis B in Asian Americans Myron J Tong; UCLA, CA Calvin Q. Pan; Mount Sinai, NY Hie-Won Hann; Thomas Jefferson, PA Kris V. Kowdley; Virginia Mason, WA Steven Huy B Han; UCLA,
More informationHepatitis B Virus Basal Core Promoter Mutation and DNA Load Correlate with Expression of Hepatitis B Core Antigen in Patients with Chronic Hepatitis B
MAJOR ARTICLE Hepatitis B Virus Basal Core Promoter Mutation and DNA Load Correlate with Expression of Hepatitis B Core Antigen in Patients with Chronic Hepatitis B Chun-Jen Liu, 1,2,a Yung-Ming Jeng,
More informationAntiviral Therapy 14:
Antiviral Therapy 14:679 685 Original article Combination of baseline parameters and on-treatment hepatitis B virus DNA levels to start and continue patients with lamivudine therapy Man-Fung Yuen 1 *,
More informationViral hepatitis and Hepatocellular Carcinoma
Viral hepatitis and Hepatocellular Carcinoma Hashem B. El-Serag, MD, MPH Dan L. Duncan Professor of Medicine Chief, Gastroenterology and Hepatology Houston VA & Baylor College of Medicine Houston, TX Outline
More informationC hronic hepatitis B (CHB) virus infection affects more
161 HEPATITIS Prognostic determinants for chronic hepatitis B in Asians: therapeutic implications MF Yuen, HJ Yuan, D KH Wong, J CH Yuen, WM Wong, A OO Chan, B CY Wong, KC Lai, CL Lai... See end of article
More informationManagement of chronic hepatitis B : recent advance in the treatment of antiviral resistance
anagement of chronic hepatitis B : recent advance in the treatment of antiviral resistance / 김강모 연수강좌 anagement of chronic hepatitis B : recent advance in the treatment of antiviral resistance 김강모 울산대학교의과대학서울아산병원소화기내과
More informationT3098C and T53C Mutations of HBV Genotype C Is Associated with HBV Infection Progress 1
BIOMEDICAL AND ENVIRONMENTAL SCIENCES 22, 511 517 (2009) www.besjournal.com T3098C and T53C Mutations of HBV Genotype C Is Associated with HBV Infection Progress 1 SU ZHEN JIANG, ZHI YONG GAO, TONG LI,
More informationHepatitis B virus (HBV) infection is an important. Brief Communication
Brief Communication Hepatitis B Virus Infection in Children and Adolescents in a Hyperendemic Area: 15 Years after Mass Hepatitis B Vaccination Yen-Hsuan Ni, MD, PhD; Mei-Hwei Chang, MD; Li-Min Huang,
More informationDr David Rowbotham NHS. The Leeds Teaching Hospitals. NHS Trust
Dr David Rowbotham The Leeds Teaching Hospitals NHS Trust NHS Nurses Update June 2010 Chronic Hepatitis HBV / HCV David Rowbotham Clinical Director & Consultant Gastroenterologist Dept of Gastroenterology
More informationHepatitis Delta Virus and GBV-C Infection in Two Neighboring Hepatitis B Virus and Hepatitis C Virus Endemic Villages in Taiwan
Original Article 137 Hepatitis Delta Virus and GBV-C Infection in Two Neighboring Hepatitis B Virus and Hepatitis C Virus Endemic Villages in Taiwan Chang-Jung Chang 1, MD; Jui-Chin Chiang 1,2,6, MD; Sheng-Nan
More informationLong-term lamivudine therapy reduces the risk of long-term complications of chronic hepatitis B infection even in patients without advanced disease
Antiviral Therapy 12:1295 133 Long-term lamivudine therapy reduces the risk of long-term complications of chronic hepatitis B infection even in patients without advanced disease Man-Fung Yuen, Wai-Kay
More informationHepatitis B Virus Genotypes: Clinical Implications
Hepatitis B Virus Genotypes : Clinical Implications Subrat Kumar Acharya, Yogesh Batra Professor, Department of Gastroenterology, All India Institute of Medical Sciences, New Delhi 110 029 87 Introduction
More informationDetection Different of Genotypes of Hepatitis B virus by Using Genotype- Specific Primers and its Clinical Correlation
ORIGINAL ARTICLE Detection Different of Genotypes of Hepatitis B virus by Using Genotype- Specific Primers and its Clinical Correlation *RUBINA GHANI, HIRA JAVED, HAMZA ALI, MUHAMMAD USMAN, KANWAL SABA,
More informationChronic Hepatitis B: management update.
Chronic Hepatitis B: management update. E.O.Ogutu Department of clinical medicine & therapeutics, University of Nairobi. Physicians meeting,kisumu 2011. Background epidemiology Chronic hepatitis B (CHB)
More informationIdentification of hepatitis B virus DNA reverse transcriptase variants associated with partial response to entecavir
Title Identification of hepatitis B virus DNA reverse transcriptase variants associated with partial response to entecavir Author(s) Wong, DKH; Fung, JYY; Lai, CL; Yuen, RMF Citation Hong Kong Medical
More informationY. Xiang*, P. Chen*, J.R Xia and L.P. Zhang
A large-scale analysis study on the clinical and viral characteristics of hepatitis B infection with concurrence of hepatitis B surface or E antigens and their corresponding antibodies Y. Xiang*, P. Chen*,
More informationManagement of Decompensated Chronic Hepatitis B
Management of Decompensated Chronic Hepatitis B Dr James YY Fung, FRACP, MD Department of Medicine The University of Hong Kong Liver Transplant Center Queen Mary Hospital State Key Laboratory for Liver
More informationChoice of Oral Drug for Hepatitis B: Status Asokananda Konar
Choice of Oral Drug for Hepatitis B: Status 2011 Asokananda Konar Chronic hepatitis B (CHB) is a global public health challenge with an estimated 350 to 400 million people with chronic HBV infection, despite
More informationDevelopment of Hepatocellular Carcinoma After Seroclearance of Hepatitis B Surface Antigen
CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2009;7:889 893 Development of Hepatocellular Carcinoma After Seroclearance of Hepatitis B Surface Antigen MYRON JOHN TONG,*, MICHAEL ONG NGUYEN, LORI TERESE TONG,
More informationHepatitis B Virus therapy. Maria Buti Hospital Universitario Valle Hebron Barcelona Spain
Hepatitis B Virus therapy Maria Buti Hospital Universitario Valle Hebron Barcelona Spain Disclosures Advisor: AbbVie, Boehringer Ingelheim, Bristol-Myers Squibb, Gilead Sciences, Janssen, Merck Sharp &
More informationHepatitis B virus core-related antigen is a serum prediction marker for hepatocellular carcinoma
Editorial Hepatitis B virus core-related antigen is a serum prediction marker for hepatocellular carcinoma Kazunori Kawaguchi, Masao Honda, Shuichi Kaneko Department of Gastroenterology, Kanazawa University
More informationHepatitis B Update. Jorge L. Herrera, M.D. University of South Alabama Mobile, AL. Gastroenterology
Hepatitis B Update Jorge L. Herrera, M.D. University of South Alabama Mobile, AL Deciding Who to Treat Is hepatitis B a viral disease or a liver disease? Importance of HBV-DNA Levels in the Natural History
More informationNH2 N N N O N O O P O O O O O
N N NH 2 N N O O P O O O O O O James Watson and Francis Crick Double Helix 1953 Baruch Blumberg, MD, PhD 1925-2011 Australia Antigen 1965 Hepatitis B Virus (HBV) Hepadnaviridae member that primarily infects
More informationSerum Hepatitis B Surface Antigen Levels Help Predict Disease Progression in Patients With Low Hepatitis B Virus Loads. Hepatology Feb 2013
Serum Hepatitis B Surface Antigen Levels Help Predict Disease Progression in Patients With Low Hepatitis B Virus Loads Hepatology Feb 2013 Hepatitis B Surface Antigen HBsAg is the glycosylated envelope
More informationTreatment as a form of liver cancer prevention The clinical efficacy and cost effectiveness of treatment across Asia
Treatment as a form of liver cancer prevention The clinical efficacy and cost effectiveness of treatment across Asia Prof. Henry LY Chan Head, Division of Gastroenterology and Hepatology Director, Institute
More informationAlla ricerca del virus nascosto (quando il virus dell epatitie B si occulta )
Alla ricerca del virus nascosto (quando il virus dell epatitie B si occulta ) Giovanni Raimondo Epatologia Clinica e Biomolecolare Policlinico Universitario di Messina UI/ml pg/ml HBsAg HBeAg + anti-hbe
More informationClinical Management of Hepatitis B WAN-CHENG CHOW DEPARTMENT OF GASTROENTEROLOGY & HEPATOLOGY SINGAPORE GENERAL HOSPITAL
Clinical Management of Hepatitis B WAN-CHENG CHOW DEPARTMENT OF GASTROENTEROLOGY & HEPATOLOGY SINGAPORE GENERAL HOSPITAL The World Health Organisation recent initiatives on HBV infection Launching of the
More informationHepatitis B virus (HBV) is a significant cause of
Secular Trend of the Viral Genotype Distribution in Children With Chronic Hepatitis B Virus Infection After Universal Infant Immunization Wan-Hsin Wen, 1,6,7 Huey-Ling Chen, 1,2 Yen-Hsuan Ni, 1 Hong-Yuan
More informationHBV NATURAL HISTORY. Mitchell L. Shiffman, MD Director Liver Institute of Virginia Bon Secours Health System Richmond and Newport News, Virginia
HBV NATURAL HISTORY AND MANAGMENT Mitchell L. Shiffman, MD Director Liver Institute of Virginia Bon Secours Health System Richmond and Newport News, Virginia IVer Liver Institute of Virginia Education,
More informationBasics of hepatitis B diagnostics. Dr Emma Page MRCP MD(Res) Locum Consultant Sexual Health & Virology
Basics of hepatitis B diagnostics Dr Emma Page MRCP MD(Res) Locum Consultant Sexual Health & Virology Basics of hepatitis B diagnostics Background Epidemiology Morphology Life-cycle Diagnostic markers
More informationHepatitis B (HBV) infection is a major worldwide
Clearance of Hepatitis B Surface Antigen and Risk of Hepatocellular Carcinoma in a Cohort Chronically Infected with Hepatitis B Virus Josephine Simonetti, 1 Lisa Bulkow, 2 Brian J. McMahon, 1,2 Chriss
More information29th Viral Hepatitis Prevention Board Meeting
29th Viral Hepatitis Prevention Board Meeting Madrid, November 2006 Treatment of chronic hepatitis B José M. Sánchez-Tapias Liver Unit Hospital Clínic University of Barcelona Spain CHRONIC HBV INFECTION
More informationTreatment of chronic hepatitis B 2013 update
22 February 213 Treatment of chronic hepatitis B 213 update Pietro Lampertico 1st Gastroenterology Unit Fondazione IRCCS Cà Granda - Ospedale Maggiore Policlinico Università di Milano EASL 212 Clinical
More informationChronic hepatitis B - New goals, new treatment. New England Journal Of Medicine, 2008, v. 359 n. 23, p
Title Chronic hepatitis B - New goals, new treatment Author(s) Lai, CL; Yuen, MF Citation New England Journal Of Medicine, 2008, v. 359 n. 23, p. 2488-2491 Issued Date 2008 URL http://hdl.handle.net/10722/59270
More informationJ.C. WANG, L.L. HE, Q. CHEN 1. Introduction. Abstract. BACKGROUND: Either combination. European Review for Medical and Pharmacological Sciences
European Review for Medical and Pharmacological Sciences Comparison of re-treatment outcomes of lamivudine plus adefovir or entecavir in chronic hepatitis B patients with viral relapse after cessation
More informationHBV : Structure. HBx protein Transcription activator
Hepatitis B Virus 1 Hepatitis B Virus 2 Properties of HBV a member of the hepadnavirus group Enveloped, partially double-stranded DNA viruses, smallest DNA virus Replication involves a reverse transcriptase
More informationDurability Of Lamivudine Associated HBe Antigen Seroconversion in Chinese-Canadian Patients with Chronic Hepatitis B Virus Infection
ISPUB.COM The Internet Journal of Gastroenterology Volume 4 Number 2 Durability Of Lamivudine Associated HBe Antigen Seroconversion in Chinese-Canadian Patients with Chronic Hepatitis B Virus Infection
More informationViral Hepatitis. Dr Melissa Haines Gastroenterologist Waikato Hospital
Viral Hepatitis Dr Melissa Haines Gastroenterologist Waikato Hospital Viral Hepatitis HAV HBV HCV HDV HEV Other viral: CMV, EBV, HSV Unknown Hepatitis A Hepatitis A Transmitted via the faecal-oral route
More informationViral Hepatitis The Preventive Potential of Antiviral Therapy. Thomas Berg
Viral Hepatitis The Preventive Potential of Antiviral Therapy Thomas Berg Therapeutic and preventive strategies in patients with hepatitis virus infection Treatment of acute infection Treatment of chronic
More informationRelative predictive factors for hepatocellular carcinoma after HBeAg seroconversion in HBV infection
PO Box 2345, Beijing 123, China World J Gastroenterol 25;11(43):6848-6852 www.wjgnet.com World Journal of Gastroenterology ISSN 17-9327 wjg@wjgnet.com E L S E V I E R 25 The WJG Press and Elsevier Inc.
More informationART ICLEHepatitis B Virus Genotype and DNA Level and Hepatocellular Carcinoma: A Prospective Study in Men
ART ICLEHepatitis B Virus Genotype and DNA Level and Hepatocellular Carcinoma: A Prospective Study in Men Ming-Whei Yu, Shiou-Hwei Yeh, Pei-Jer Chen, Yun-Fan Liaw, Chih-Lin Lin, Chun-Jen Liu, Wei-Liang
More informationHepatocellular Carcinoma: Can We Slow the Rising Incidence?
Hepatocellular Carcinoma: Can We Slow the Rising Incidence? K.Rajender Reddy M.D. Professor of Medicine Director of Hepatology Medical Director of Liver Transplantation University of Pennsylvania Outline
More informationentecavir, 0.5mg and 1mg film-coated tablets and 0.05 mg/ml oral solution, Baraclude SMC No. (747/11) Bristol-Myers Squibb Pharmaceuticals Ltd
entecavir, 0.5mg and 1mg film-coated tablets and 0.05 mg/ml oral solution, Baraclude SMC No. (747/11) Bristol-Myers Squibb Pharmaceuticals Ltd 09 December 2011 The Scottish Medicines Consortium (SMC) has
More informationINTRODUCTION MATERIALS AND METHODS
J Korean Med Sci 2006; 21: 279-83 ISSN 1011-8934 Copyright The Korean Academy of Medical Sciences The Degrees of Hepatocyte Cytoplasmic Expression of Hepatitis B Core Antigen correlate with Histologic
More informationHepatitis B Virus therapy. Maria Buti Hospital Universitario Valle Hebron Barcelona Spain
Hepatitis B Virus therapy Maria Buti Hospital Universitario Valle Hebron Barcelona Spain Disclosures Advisor: AbbVie, Boehringer Ingelheim, Bristol-Myers Squibb, Gilead Sciences, Janssen, Merck Sharp &
More informationWho to Treat? Consider biopsy Treat. > 2 ULN Treat Treat Treat Treat CIRRHOTIC PATIENTS Compensated Treat HBV DNA detectable treat
Who to Treat? Parameter AASLD US Algorithm EASL APASL HBV DNA CRITERIA HBeAg+ >, IU/mL > 2, IU/mL > 2, IU/mL >, IU/mL HBeAg- > 2, IU/mL > 2, IU/mL > 2, IU/mL > 2, IU/mL ALT CRITERIA PNALT 1-2 ULN Monitor
More informationOriginally published as:
Originally published as: Ratsch, B.A., Bock, C.-T. Viral evolution in chronic hepatitis B: A branched way to HBeAg seroconversion and disease progression? (2013) Gut, 62 (9), pp. 1242-1243. DOI: 10.1136/gutjnl-2012-303681
More informationRama Nada. - Malik
- 2 - Rama Nada - - Malik 1 P a g e We talked about HAV in the previous lecture, now we ll continue the remaining types.. Hepatitis E It s similar to virus that infect swine, so its most likely infect
More informationViral hepatitis Blood Born hepatitis. Dr. MONA BADR Assistant Professor College of Medicine & KKUH
Viral hepatitis Blood Born hepatitis Dr. MONA BADR Assistant Professor College of Medicine & KKUH Outline Introduction to hepatitis Characteristics of viral hepatitis Mode of transmission Markers of hepatitis
More informationHepatitis B virus genotypes, precore and core promoter variants among predominantly Asian patients with chronic HBV infection in a Canadian center
Liver International 2006: 26: 796 804 r 2006 The Author Journal compilation r 2006 Blackwell Munksgaard Clinical Studies DOI: 10.1111/j.1478-3231.2006.01297.x Hepatitis B virus genotypes, precore and core
More informationHEPATITIS B: are escape mutants of concern?
VACCINATION: AN EVOLUTIONARY ENGINE FOR SPECIES? Fondation Mérieux Conference Centre Veyrier-du-Lac, France November 25-27, 2013 HEPATITIS B: are escape mutants of concern? Alessandro ZANETTI Department
More informationHBeAg-positve chronic hepatts B: Why do I treat my patent with a NA? Maria But
HBeAg-positve chronic hepatts B: Why do I treat my patent with a NA? Maria But Hospital Universitario Valle Hebron and Ciberehd del Insttuto Carlos III. Barcelona. Spain Disclosures Advisory board of,
More informationPrediction of HBsAg Loss by Quantitative HBsAg Kinetics during Long-Term 2015
THAI J 16 GASTROENTEROL Treatment with Nucleos(t)ide Original Analogues Article Prediction of HBsAg Loss by Quantitative HBsAg Kinetics during Long-Term Treatment with Nucleos(t)ide Analogues Sombutsook
More informationLong-term tracking of hepatitis B viral load and the relationship with risk for hepatocellular carcinoma in men
Carcinogenesis vol.29 no.1 pp.106 112, 2008 doi:10.1093/carcin/bgm252 Advance Access publication November 13, 2007 Long-term tracking of hepatitis B viral load and the relationship with risk for hepatocellular
More informationCharacterization of Hepatitis B Virus (HBV) Among Liver Patients in Kenya
Characterization of Hepatitis B Virus (HBV) Among Liver Patients in Kenya By MISSIANI OCHWOTO (Medical Research officer, KEMRI) Julius Oyugi 2, Dufton Mwaengo 2, James Kimotho 1 Carla Osiowy 3 and Elijah
More informationLong-term Clinical Outcomes and Risk of Hepatocellular Carcinoma in Chronic Hepatitis B Patients with HBsAg Seroclearance
Long-term Clinical Outcomes and Risk of Hepatocellular Carcinoma in Chronic Hepatitis B Patients with HBsAg Seroclearance Gi-Ae Kim, Han Chu Lee *, Danbi Lee, Ju Hyun Shim, Kang Mo Kim, Young-Suk Lim,
More informationChanges in Serum Levels of HBV DNA and Alanine Aminotransferase Determine Risk for Hepatocellular Carcinoma
GASTROENTEROLOGY 2011;141:1240 1248 Changes in Serum Levels of HBV DNA and Alanine Aminotransferase Determine Risk for Hepatocellular Carcinoma CHUEN FEI CHEN,*, WEN CHUNG LEE,* HWAI I YANG,, HUNG CHUEN
More informationHepatitis B Treatment Pearls. Agenda
Hepatitis B Treatment Pearls Fredric D. Gordon, MD Vice Chair Dept. of Transplantation and Hepatobiliary Diseases Lahey Hospital & Medical Center Associate Professor of Medicine Tufts Medical School Boston,
More informationChronic Hepatitis B Infection
Chronic Hepatitis B Infection Mohssen Nassiri Toosi, MD Imam Khomeinin Hospital Tehran University of Medical Sciences Chronic Hepatitis B Infection Virus : HBs Ag Positive Host Liver Health Chronic Hepatitis
More informationChronic hepatitis B virus (HBV) infection affects
GASTROENTEROLOGY 2009;136:505 512 Predictive Factors for Early HBeAg Seroconversion in Acute Exacerbation of Patients With HBeAg-Positive Chronic Hepatitis B HYOUNG SU KIM,* HA JUNG KIM, WOON GEON SHIN,*
More informationCaution: Reactivation of Hepatitis B during Hepatitis C Treatment with Direct-Acting Antiviral Therapy
Caution: Reactivation of Hepatitis B during Hepatitis C Treatment with Direct-Acting Antiviral Therapy Anjana A. Pillai, Emory University Frank A Anania, Emory University Brian L. Pearlman, Emory University
More informationHepatitis B. What's the impact on the risk? Dr Himanshu Bhatia, Asia Chief Medical Officer ALUCA, Brisbane, Sept 2013
Hepatitis B What's the impact on the risk? Dr Himanshu Bhatia, Asia Chief Medical Officer ALUCA, Brisbane, Sept 2013 Some quick facts about Hepatitis B Worldwide: 350-400 Million are chronic infections
More information