MAJOR ARTICLE JID 2008:198 (1 December) Chen et al.

Transcription

1 MAJOR ARTICLE Combined Mutations in Pre-S/Surface and Core Promoter/Precore Regions of Hepatitis B Virus Increase the Risk of Hepatocellular Carcinoma: A Case-Control Study Chien-Hung Chen, 1,2 Chi-Sin Changchien, 1 Chuan-Mo Lee, 1 Chao-Hung Hung, 1 Tsung-Hui Hu, 1 Jing-Houng Wang, 1 Jyh-Chwan Wang, 1 and Sheng-Nan Lu 1 1 Division of Hepatogastroenterology, Department of Internal Medicine, and 2 Graduate Institute of Clinical Medical Sciences, Chang Gung Memorial Hospital-Kaohsiung Medical Center, Chang Gung University College of Medicine, Kaohsiung, Taiwan Background. We sought to investigate the role of sequence variations in pre-s/surface and basal core promoter (BCP)/precore regions of the hepatitis B virus (HBV) in hepatocellular carcinoma (HCC). Methods. The direct sequencing in pre-s/surface and BCP/precore regions of HBV was determined for 80 patients with HCC and 160 control patients with HBV infection. Results. Compared with control patients, patients with HCC had higher frequencies of pre-s deletions and amino acid substitutions at codon 4, 7, and 81 in pre-s1 genes; at the start codon in pre-s2 genes; and at codon 68 in surface genes. Patients also had a lower frequency of amino acid substitution at codon 2 in pre-s2 genes, compared with control patients. In BCP/precore regions, patients with HCC had higher frequencies of C or G1753, A1762/T1764, T1846, and A1899. Multivariate analysis showed that pre-s deletions, I68T surface gene, T1762/A1764, and A1899 were independent factors associated with the development of HCC. The HBV strain with a complex mutation pattern rather than a single mutation was associated with HCC, and the HCC risks increased for patients having these factors in combination. Conclusions. Pre-S deletions, I68T in surface gene, T1762/A1764, and A1899 were independent risk factors for HCC. Combination of these viral mutations appeared to increase the risk of HCC. Chronic hepatitis B virus (HBV) infection is associated with a wide range of clinical manifestations, from asymptomatic carriage with normal histologic characteristics to severe chronic liver disease, including cirrhosis and hepatocellular carcinoma (HCC) [1 4]. The prevalence of HBV infection is high in Taiwan, where 60% 80% of chronic hepatitis and liver cirrhosis cases are HBV related [4] and the incidence of HCC is cases per 100,000 population [5]. Apart from the host Received 25 November 2007; accepted 12 June 2008; electronically published 21 October Potential conflicts of interest: none reported. Financial support: Chang Gung Memorial Hospital and National Council of Science, Taiwan (grants NMRPG T60011 [NSC B-182A-086] and NMRPD [NSC B ]). Reprints or correspondence: Dr. Chuan-Mo Lee, Div. of Hepatogastroenterology, Dept. of Internal Medicine, Kaohsiung Chang Gung Memorial Hospital, 123 Ta Pei Rd., Kaohsiung, Taiwan (chmolee@ms15.hinet.net). The Journal of Infectious Diseases 2008; 198: by the Infectious Diseases Society of America. All rights reserved /2008/ $15.00 DOI: / factors, virologic factors have been associated with a higher risk of HCC. These include HBV DNA levels, HBV genotypes, pre-s mutants, and basal core promoter (BCP) and precore mutations. HBV can be classified into 8 genotypic groups [6 8]. HBV genotypes B and C are more predominant in Asia, and the association between the genotype C variant and increased severity of liver disease is stronger than that for genotype B in this population [9 11]. However, studies of the relationships between HCC and these genotypes have yielded conflicting results. Studies from Taiwan, Japan, and Hong Kong support a higher risk of HCC in the presence of HBV genotype C, compared with HBV genotype B [12 15]. However, 2 recent studies demonstrated that the risk of HCC may not differ between genotypes B and C [16, 17]. Thus, the influence of HBV genotypes on HCC needs further clarification. Recently, several studies have suggested that BCP mutations (T1762/A1764) had higher risks of liver cirrhosis and HCC [10, 12, 18]. However, BCP mutations are also 1634 JID 2008:198 (1 December) Chen et al.

2 frequently found among patients with chronic hepatitis B and without HCC. In addition to these 2 common mutations, 2 other mutations, C-to-T at 1653 in the enhancer II region and T-to- C/A/G (V) at 1753 in the BCP region, have recently been found to be associated with the development of HCC [19, 20]. The HBV envelope is composed of 3 forms of HBV surface antigen (HBsAg): large (coded for by the pre-s1/pre-s2/s gene), middle (the pres2/s gene), and small (the S gene) protein. The pre-s1 and pre-s2 regions play an essential role in the interaction with immune responses because they contain several epitopes for T or B cells [21]. The surface gene of HBV contains a dominant neutralizing epitope termed the a determinant (aa ) in the major hydrophilic region (MHR) [22]. Previous studies demonstrated that a number of pre-s1/s2 rearrangements, including deletions and initiation codon mutants, accumulated in patients at the later stage of chronic HBV infection and during fulminant hepatitis [23, 24]. Recent cross-sectional studies have also demonstrated that patients with HBV genotype C or progressive liver diseases have a higher frequency of pre-s deletions than those with genotype B or inactive carriage [25 27]. However, the effects of pre-s deletions on HCC are rarely investigated in case-control studies. Furthermore, current knowledge concerning the role of other HBV variations in pre-s or surface regions in HCC is limited. Because previous studies only focused on one of these viral factors (e.g., HBV genotype, pre-s deletions, or BCP/precore mutations), it is unclear whether these factors are confounding or have synergistic effects on the development of HCC. Moreover, most previous studies only focused on certain specific nucleotide variants (e.g., pre-s deletions, T1762/A1764, or A1896) and did not analyze other nucleotides or amino acid variations that may have important roles. Our previous longitudinal study found that a pre-s deletion was an independent factor for development of HCC. However, the number of persons who developed HCC during follow-up was limited [28]. Thus, we performed a case-control study of the influence of HBV nucleotides or amino acid variations in pre-s/surface and BCP/precore regions on the development of HCC. PATIENTS, MATERIALS, AND METHODS Study subjects. Between 2000 and 2001, 95 consecutive patients who were positive for hepatitis B surface antigen (HBsAg) and received a diagnosis of HCC at Kaohsiung Chang Gung Memorial Hospital (Kaohsiung, Taiwan) were analyzed. Of these 95 patients, 15 did not have complete polymerase chain reaction (PCR) amplification data for HBV genotypes or sequences of pre-s/surface and BCP/precore regions. The remaining 80 patients were recruited into the present study. Sixty-six were males and 14 were females, and the mean age ( SD) was years. Ten patients were positive and 70 were negative for HBeAg. To examine the role of viral factors on HCC, based on a 1:2 case-control design, 160 HBsAg-positive patients without ultrasonographic evidence of HCC (ultrasonography was repeated at least twice, with an interval of 6 months between analyses) who matched on the basis of age, sex, and HBeAg status with 80 patients with HCC were selected as control patients. Control patients were followed up during the same period of recruitment of the present study in the Division of Hepatogastroenterology at Kaohsiung Chang Gung Memorial Hospital. Of these 160 control patients, 48 underwent liver biopsy for diagnosis of inflammation or fibrosis. Forty-three (26.9%) had cirrhosis, which was diagnosed on the basis of histological analyses of liver biopsy specimens for 17. Patients were excluded if they had any evidence of autoimmune hepatitis or markers of hepatitis C virus, hepatitis D virus or human immunodeficiency virus. An ultrasonography scoring system for liver surface, parenchyma, vascular structure, and spleen size was used to describe the severity of hepatic parenchymal damage [29, 30]. Cirrhosis was diagnosed by histologic analysis of liver biopsy specimens or by findings of repeated ultrasonography (performed at least twice at intervals of 6 months) that were suggestive of cirrhosis, supplemented with clinical criteria indicating portal hypertension (i.e., the presence of ascites, thrombocytopenia, and esophageal varices). There were 2 diagnostic criteria for the diagnosis of HCC: (1) positive findings of cytologic or pathologic examinations or (2) typical images compatible with HCC plus an -feto protein level of 400 ng/ml. Serum samples from each subject were frozen at 70 C until use. For patients with HCC, serum samples were collected at the time when HCC was diagnosed. None of the patients received any antiviral treatment (i.e., interferon, lamivudine, adefovir, or entecavir) before or at the time of study entry. This study was approved by the ethical committee of Chang Gung Memorial Hospital. Serologic analysis. The presence of HBsAg, HBeAg, anti- HCV antibodies, and anti-hdv antibodies was determined using commercial assay kits (HBsAg was detected by EIA [Abbott], HBeAg was detected by EIA [Abbott], anti-hcv was detected by EIA 3.0 [Abbott], and anti-hdv was detected by RIA [Abbott]). HBV DNA was quantified using Amplicor HBV Monitor (Roche Diagnostic Systems) with a detection limit of 300 copies/ml. Dilution was performed if HBV DNA levels were 10 6 copies/ ml. PCR amplification and direct sequencing of core promoter/ precore and pre-s/surface genes. Nested PCR for amplification of BCP/precore genes was performed as previously described [18]. For pre-s sequence analysis, pre-s genes were amplified using respective primer pairs (table 1). First-round PCR was performed as follows: 95 C for 2 min; denaturation at 95 C for 50 s, primer annealing at 50 C for 50 s, and extension at 72 C for 2 min for 30 cycles; and a final extension step at 72 C for 7 min. After the first amplification, 5 L of the PCR products Pre-S/Surface and BCP/Precore in Hepatocellular Carcinoma JID 2008:198 (1 December) 1635

3 Table 1. Primer sequences for polymerase chain reaction of pre-s/surface and pre-core/ core promoter genes of hepatitis B virus. Primer Sequence, 5'33' Nucleotide position Enhancer II/core promoter/precore gene First round PC-1 CATAAGAGGACTCTTGGACT PC-2 AAAGAATTCAGAAGGCAAAAAAGA Second round PC-3 AATGTCAACTACCGACCTTG PC-4 TCCACAGAAGCTCCGAATTC Surface gene First round S-1 ACCAATCGGCAGTCAGGAA S-2 CCCAAAAGACCCAAATTC Second round S-3 TTCCTGCTGGTGGCTCCAG S-4 CCAATACATATCCCATGAACT Pre-S gene First round PS-1 AAAATTAATTATCCTGCTAGG PS-2 GAGAAGTCCACCACGAGTC Second round PS-3 TTTACAACTCTGTGGAAGGC PS-4 GAGTCTAGACTCTGTGGTATTGTG were reamplified for another 30 cycles with the same PCR condition as the first-round reaction. For surface sequence analysis, surface genes were amplified using respective primer pairs (table 1) under the same PCR condition described above. The sensitivity of the PCR assay was found to be 100 copies/ml, which was determined through a series of dilutions of plasmid with a known concentration that contained the HBV genome. All necessary precautions to prevent cross-contamination were taken, and negative controls were included in each assay. The nucleotide sequences of the amplified products were directly determined using fluorescent-labeled primers with an ABIPrism 377 Genetic Analyzer (Applied Biosystems). For comparisons of the nucleotide sequences and deduced amino acid sequence analysis, AB from Genbank was defined as a reference. HBV genotyping. HBV genotypes were determined from serum samples, using PCR restriction fragment length polymorphism genotyping based on analysis of the surface gene, as previously described [31]. Data analysis. Data are presented as means ( SD) or proportions. To compare the values between the 2 groups, 2 or Fisher exact tests were used for categorical variables. All amino acid or nucleotide variants in pre-s/surface and precore/core promoter regions were interpreted. Previous studies reported that HCC and pre-s deletions were more frequently in HBV carriers with genotype C [12 15, 25, 26], so the amino acid or nucleotide variants highly specific for HBV genotypes (B or C) ( 90% by the goodness-of-fit test) were excluded for analysis of HCC and pre-s deletions. Specific substitutions significantly associated with HCC or pre-s deletions after analysis were selected. Because previous studies have indicated that HBV carriers with T1762/A1764, A1896, and pre-s deletion mutations were at increased risk for HCC [12, 26, 28], these mutations were also included for analysis of HCC. Student t tests were used for analysis of continuous variables. Stepwise multiple logistic regression analysis was performed to assess the influence of various factors on the risk of HCC and pre-s deletions. All statistical tests were 2-sided. A P value of.05 was considered statistically significant. RESULTS Clinical features and virologic characteristics of patients with and patients without HCC. The clinical features and virologic characteristics for patients with and patients without HCC are presented in table 2. Ten amino acid or nucleotide variants in the pre-s/surface and precore/core promoter regions were significantly associated with HCC, and these variants along with A1896 and pre-s deletions were included for analysis of HCC (table 2). Compared with control patients, patients with HCC had higher frequencies of pre-s deletions and amino acid substitutions at codon 4, 7, and 81 in pre-s1 genes; at the start codon in pre-s2 genes; and at codon 68 in the surface genes. Patients also had a lower frequency of amino acid substitution at codon 2 in pre-s JID 2008:198 (1 December) Chen et al.

4 Table 2. Comparison of demographic and virologic characteristics for patients with hepatocellular carcinoma (HCC) and control patients with hepatitis B virus (HBV) infection. Total Control patients (n 160) Patients with HCC (n 80) P Age, years Sex (male: female).999 Male Female ALT, U/L Total bilirubin level, mg/dl HBeAg positivity HBV DNA level, log copies/ml Genotype.019 B C 45 (28.1) 34 (42.5) B and C 0 1 D 0 1 Pre-S deletions 27 (16.9) 28 (35).002 Pre-S1 gene W4P/R 7 (4.4) 10 (12.5).021 K7T/N 7 (4.4) 10 (12.5).021 A81T 7 (4.4) 11 (13.8).009 Pre-S2 gene M1V/I/A 24 (15) 23 (28.8).011 Q2K/R 15 (9.4) Surface gene(s) I68T 8 (5) 13 (16.3).004 BCP and precore genes(s) C or G (14.4) 21 (26.3).025 T1762/A (51.3) 63 (78.8).001 T (35.6) 42 (52.5).012 A (65.6) 58 (72.5).28 A (18.8) 27 (33.8).01 NOTE. Data are no. (%) of subjects or mean SD. ALT, alanine aminotransferase; BCP, basal core promoter. genes, compared with control patients. In BCP and precore genes, patients with HCC had higher frequencies of C or G1753, A1762/T1764, T1846, and A1899 mutants or variants than did control patients. Most of these pre-s variants contained T cell and B cell epitopes or important functional sites. The amino acid sequence at codon 81 in pre-s1 genes contained heat shock protein 70 (Hsc 70) binding site (aa ), cytosolic anchorage determinant (CAD) (aa ), and S-promoter (nt ). The amino acid sequence at start codon and codon 2 in pre-s2 genes contained B-epitope (aa ), nucleocapsid binding site (aa ), viral secretion (aa ), and the start codon of M protein (aa 120). Because of overlap of the HBV pre-s/surface and polymerase genes, these gene variants in pre- S/surface regions can result in amino acid changes in the polymerase region (table 3). Clinical features and virologic characteristics of patients infected with HBV genotypes B and/or C. Of the 240 patients, 159 were infected with genotype B, 79 with genotype C, 1 with mixed genotype B and C, and 1 with genotype D. Patients with genotype C infection had a higher rate of HBeAg positivity than those with genotype B infection (18 of 79 vs. 12 of 159; P.001). Patients with genotype B and/or C infection did not differ significantly in age, sex, alanine aminotransferase (ALT) and total bilirubin levels, or HBV DNA level. With regard to the 12 amino acids or sequence variants listed in table 2, compared with patients with genotype B infection, patients with genotype C infection had higher frequencies of pre-s deletions (31 of 79 vs. 23 of 159; P.001), amino acid substitutions at codon 4 (17 of 79 vs. 0 of 159; P.001), codon 7 (14 of 79 vs. 3 of 159; P.001), and codon 81 (16 of 79 vs. 2 of 159; P.001) in pre-s1 genes, at codon 68 (12 of 79 vs. 8 of 159; P.008) in surface genes, and C or G1753 (27 of 79 vs. 16 of 159; P.001) and T1762/A1764 (72 of 79 vs. 71 of 159; P.001) mutations. Patients with genotype C infection also had lower rates of T1864 Pre-S/Surface and BCP/Precore in Hepatocellular Carcinoma JID 2008:198 (1 December) 1637

5 Table 3. Sequence variants in pre-s and surface regions and their consequences for polymerase genes. Pre-S or surface regions, aa Pre-S1 W4P/R K7T/N A81T Pre-S2 M1V/I/A Q2K/R Surface I68T Polymerase region, aa L184S Q187H, N188H G261D H300R A301E, V302M A422 (no change) NOTE. Sequence variants in pre-s and surface regions are listed in listed in table 2. aa, amino acid. (24 of 79 vs. 73 of 159; P.022) and A1896 (46 of 79 vs. 115 of 159; P.029) than those with genotype B infection. Risk factors of pre-s deletions. Of the 240 patients, 55 were infected with pre-s deletion mutants. The baseline and virologic characteristics of patients with and patients without pre-s deletions are shown in table 4. Compared with patients without pre-s deletions, patients with pre-s deletions had higher rates of HBeAg positivity; HBV genotype C, K7T/N, and T68I/V in pre-s1 genes; C75Y in surface genes; and T1762/A1764 mutations. Multiple logistic regression analysis for factors associated with pre-s deletions was performed and included age, sex, ALT and total bilirubin levels, HBeAg status, HBV DNA levels, HBV genotype, and the 4 amino acid or sequence variants listed in table 4. Only HBV genotype C (odds ratio [OR], 3.79; 95% confidence interval [CI], ; P.001) was an independent factor associated with the development of pre-s deletions. The location and size of pre-s deletions are present in table 5. Of the 55 patients with pre-s deletions, the variants of pre-s deletion mutants could be categorized into 6 major types according to the deletion site: type I (9 with HCC and 6 without HCC; pre-s1 deletion [N-half predominant; range, aa 1 85]; type II (2 with HCC and 3 without HCC; pre-s1 deletion [C-half predominant; range, aa ]); type III (1 with HCC and 4 without HCC; border deletion between pre-s1 and pre-s2 region [range, aa ]); type IV (11 with HCC and 11 without HCC; pre-s2 deletion only [range, aa ]); type V (2 with HCC and 2 without HCC; deleted at 2 separated sites, one in the pre-s1 region, the other in the pre-s2 region); and type VI (4 patients; unclassified). The amino acid length of pre-s deletions varied from 1 to 174. Pre-S deletions were more often found between amino acids 120 and 142 of the pre-s2 domain (22 [40%] of 55). The same deletions were found in different patients (table 5). Most of the deletion regions encompassed T cell and B cell epitopes and important functional sites [26]. The location and size of pre-s deletions did not predict HCC development. Table 4. Comparison of baseline demographic and virologic characteristics for patients with and those without pre-s deletion. Variable No pre-s deletion (n 185) Pre-S deletion (n 55) P Age, years Sex.57 Male Female 33 8 ALT level, U/L Total bilirubin level, mg/dl HBeAg positivity 17 (9.2) 13 (23.6).004 HBV DNA level, log copies/ml HBV genotype.001 B C Pre-S1 genes K7T/N 9 (4.9) 8 (14.5).014 T68I/V 41 (22.2) 4 (7.3).011 Surface genes C75Y 23 (12.4) 1 (1.8).02 BCP/precore genes T1762/A (55.1) 43 (78.2).002 NOTE. Data are no. (%) of subjects or mean SD. ALT, alanine aminotransferase; BCP, basal core promoter; HBeAg, hepatitis B virus e antigen; HBV, hepatitis B virus; HCC, hepatocellular carcinoma JID 2008:198 (1 December) Chen et al.

6 Table 5. Characteristics of the pre-s deletions and their consequences to polymerase genes No. of subjects (study group) Pre-S region, aa Size of deletion, bp Region, nt Polymerase region, aa Deletion pattern a 1 (HCC) II 1 (HCC) III 1 (HCC) IV 3 (1 from HCC, 2 from control) IV 1 (HCC) 1 6, , , , V 1 (HCC) 3 13, , , , 300 V 3 (1 from HCC, 2 from control) IV 1 (HCC) II 1 (HCC) I 1 (HCC) I 1 (HCC) IV 1 (HCC) I 1 (HCC) VI 1 (HCC) I 1 (HCC) IV 1 (HCC) I 2 (1 from HCC, 1 from control) IV 1 (HCC) IV 1 (HCC) I 1 (HCC) I 1 (HCC) VI 1 (HCC) IV 1 (HCC) IV 1 (HCC) I 2 (1 from HCC, 1 from control) IV 2 (1 from HCC, 1 from control) I 1 (HCC) VI 1 (HCC) IV 1 (control) IV 1 (control) IV 1 (control) III 1 (control) III 1 (control) III 1 (control) II 1 (control) VI 1 (control) 12 49, , , , I 1 (control) III 1 (control) 2 8, , , , I 1 (control) I 1 (control) IV 1 (control) I 1 (control) 120, , , , V 1 (control) IV 1 (control) I 1 (control) 1 6, , , , V 1 (control) IV 1 (control) II 1 (control) II NOTE. aa, amino acid; bp, base pair; HCC, hepatocellular carcinoma; nt, nucleotide. a Deletion mutants are divided into the following 6 types: type I, pre-s1 deletion (N-half predominant; range, aa 1 85); type II, pre-s1 deletion (C-half predominant; range, aa ); type III, border between pre-s1 and pre-s2 region; type IV, pre-s2 deletion only; type V, deleted at 2 separated sites, one in the pre-s1 region, the other in the pre-s2 region; and type VI, unclassified.

7 Table 6. Association of predictive factors with the risk of hepatocellular carcinoma during chronic hepatitis B virus (HBV) infection. Factor OR a (95% CI) P I68T in surface gene 3.07 ( ).026 Pre-S deletion 2.17 ( ).021 T1762/A1764 mutations 2.81 ( ).002 A1899 mutation 2.03 ( ).033 NOTE. Variables for analysis included age (continuous variable), sex (male or female), alanine aminotransferase level ( 40 U/L or other), total bilirubin level ( 3 mg/dl or other), HBV e antigen (positivity or negativity), HBV DNA level ( 10 5 copies/ml or other), genotype (genotype C or other), pre-s deletions (presence or absence), and 11 amino acid or sequence variants listed in table 2. CI, confidence interval; OR, odds ratio. a Presence vs. absence of hepatocellular carcinoma. Multivariate analysis of factors potentially associated with HCC development. To determine the independent contribution of clinical features and each viral factor to the development of HCC, multiple logistic regression analysis was performed and included age, sex, ALT and total bilirubin levels, HBeAg status, HBV DNA levels, HBV genotype, pre-s deletions, and 11 amino acid or sequence variants listed in table 2. The significant factors associated with HCC development were pre-s deletions, I68T in surface genes, and T1762/A1764 and A1899 mutations (table 6). To further clarify the virologic factors of different HBV genotypes that contribute to HCC development, multiple logistic regression analyses were performed by subgroups (genotypes B and C). Patients infected with genotype B showed that T1762/ A1764 (OR, 3.22; 95% CI, ; P.002) and pre-s deletions (OR, 3.30; 95% CI, ; P.013) were significantly associated with a higher risk of HCC. In contrast, patients infected with genotype C revealed that A81T in pre-s1 genes (OR, 5.04; 95% CI, ; P.01) and C or G1753 (OR: 2.92, 95% CI: ; P.039) were significant risk factors associated with HCC. Multivariate analysis revealed 4 viral factors with a significant association with HCC development. However, the factor of I68T in surface genes was precluded from statistical analysis because certain groups had 5 patients. Thus, statistical analysis of the other 3 mutation combinations (pre-s deletions, T1762/A1764 mutations, and A1899 mutation) was performed in the analysis of the combined risk for HCC. Our data showed that any 2 or 3 combinations rather than a single mutation were significantly associated with the development of HCC (table 7). Furthermore, compared with patients with wild-type HBV at both or 3 genomic regions, patients with combined mutations of T1762/ A1764 and pre-s deletions (OR, 7.81; 95% CI, ), T1762/A1764 and A1899 (OR, 7.7; 95% CI, ), pre-s deletions and A1899 (OR, 7.0; 95% CI, ), and T1762/ A1764, pre-s deletions, and A1899 (OR, 16.88; 95% CI, ) had a higher risk of HCC. DISCUSSION In this study, T1762/A1764 mutations, pre-s deletions, I68T in surface gene, and the A1899 mutation were independent factors associated with HCC development. HBV genotype C was not an independent factor associated with the development of HCC. The results were compatible with those of 2 recent case-control studies, which suggested that HBV genotype C was not an independent factor for HCC after adjustment for T1762/A1764 mutations [32, 33]. Because HBV genotype C tends to have a higher frequency of T1762/A1764 mutations, the association between genotype C and HCC might in fact be due to the close association of HBV genotype C and T1762/A1764 mutations. Thus, the effect of the T1762/A1764 mutations on the development of HCC Table 7. Association between hepatocellular carcinoma (HCC) and specific mutation patterns of hepatitis B virus (HBV) among patients with HCC and control patients with HBV infection. HBV mutation pattern Patients with HCC (n 80) Control patients (n 160) P No mutation 8 (10) 60 (37.5).001 Any mutation 72 (90) 100 (62.5).001 T1762/A1764 alone or in any combination 63 (78.8) 82 (51.3).001 T1762/A1764 alone 29 (36.3) 48 (30).33 T1762/A1764 and A (26.3) 18 (11.3).003 A1899 alone or in any combination 27 (33.8) 30 (18.8).01 A1899 alone 3 (3.8) 11 (6.9).33 Pre-S deletions alone or in any combination 28 (35) 27 (16.9).002 Pre-S deletions alone 2 (2.5) 6 (3.8).72 Pre-S deletions and T1762/A (28.8) 20 (12.5).002 Pre-S deletions and A (15) 5 (3.1).002 Pre-S deletions and T1762/A1764 and A (11.3) 4 (2.5) JID 2008:198 (1 December) Chen et al.

8 might be strong enough to mask the effect of HBV genotype C. Moreover, HBV gene variants related to HCC were different between HBV genotypes B and C. In our study, although HBV genotype C had higher proportions of T1762/A1764 and pre-s deletion mutants, A81T in pre-s1 gene and G or C1753 variants were independent factors associated with HCC in HBV genotype C. In contrast, T1762/A1764 and pre-s deletion mutants were major determinants for HCC in HBV genotype B. Our study showed that T1762/A1764 was a strong predictor for HCC, which was similar to findings of previous studies [32, 33]. It has been proposed that T1762/A1764 mutations can increase viral replication by changing the pregenomic secondary structure [34]. In addition, this mutation increased the transcription of pregenomic RNA through the removal of the nuclear receptor-binding site and the creation of a binding site for hepatocyte nuclear factor-1 transcription factor [35]. In addition to T1762/A1764, the prevalences of C or G1753, T1846, and A1899 mutations in the BCP and precore regions were significantly higher among patients with HCC than among patients without HCC. Results of our study are compatible with those of a recent study that found T1653 and/or V1753 mutations were differently associated with HCC among HBV genotype C carriers [20]. One of the limitations of the present study is that the role of T1653 mutation in the enhancer II region has not been studied. Furthermore, previous studies showed that mutations at nucleotides 1846 and 1899 were found in tumorous and nontumorous tissues from patients with HCC [36, 37]. However, the real mechanism that underlies the interaction between both mutations and HCC remains unclear and merits further study. Previous studies showed that pre-s deletions were more frequent among carriers of HBV genotype C than among carriers of genotype B [25, 26]. Our findings were compatible with these previous reports. Our study found that pre-s deletion was an important risk factor for HCC, which was compatible with findings of recent studies [25, 26]. The pre-s regions play an essential role in the interaction with immune responses because they contain several epitopes for T or B cells [21]. In persistent HBV infection, immune epitope deletion mutants occur, escape the host immune surveillance, and lose important functional sites. These deletion mutants result in the intracellular retention of HBV envelope proteins and viral particles, as well as the formation of ground glass hepatocytes [38, 39]. The accumulation of pre-s mutants in the endoplasmic reticulum (ER) may subsequently induce ER stress. Through ER stress signaling pathways, the pre-s mutant large HBV surface antigens (LHBs) can induce oxidative stress and lead to oxidative DNA damage of HBVinfected hepatocytes. The oxidative DNA damage caused by pre-s mutant LHBs in turn lead to liver cell damage and genomic instability [40, 41] that may result in HCC. The influence of various types of mutations in pre-s and surface genes on HCC remains unclear. It has been reported that infection by pre-s2 defective HBV and mutations in the a-determinant of the surface gene were often associated with HCC or end-stage liver disease [24, 42, 43]. Pre-S2 defective HBV with point mutations in the pre-s2 ATG have also been isolated from patients with fulminant hepatitis [24]. However, the results of these studies are not consistent. In our study, there was a significant difference in amino acid substitutions at codons 4, 7, and 81 in pre-s1 genes, at the start codon and codon 2 in pre-s2 genes, and at codon 68 in surface genes between patients with and those without HCC. However, patients with and those without HCC did not significantly differ in mutations of the a-determinant regions. These amino acid substitutions in pre-s and surface genes related to HCC have rarely been reported. Thus, further studies are needed. Recent studies demonstrated that HBV with a complex mutation pattern was associated with the development of advanced liver diseases [26, 44]. Chen et al. [26] found that complex viral mutants of BCP/precore mutations and pre-s deletion seem to be associated with the development of advanced liver diseases. Preikschat et al. [44] reported that HBV-variant populations characterized by deletions/insertions in the core promoter plus deletions in the C gene and/or deletions in the pre-s region were more frequently found among patients who developed liver cirrhosis than among immunosuppressed renal transplant recipients. Our previous longitudinal study showed that HBV with a complex mutation (pre-s deletion, T1762/A1764, and T1766 and/or A1768 mutants) was associated with the development of liver cirrhosis; however, the number of persons who developed HCC during follow-up was limited [28]. In the current study, HBV with a complex mutation pattern (pre-s deletions, T1762/ A1764, and A1899 mutations) rather than a single mutation was associated with the development of HCC, and the risk of HCC was substantially increased among patients who had these HBV mutations in combination. Thus, detection of these combined mutations may aid in the identification of chronic HBV carriers at high risk for development of HCC. In summary, T1762/A1764 mutations, pre-s deletions, I68T in the surface gene, and the A1899 mutation were independent risk factors for the development of HCC. HBV with a complex mutation pattern was associated with the development of HCC, and the HCC risks increased in patients having these factors in combination. Furthermore, HBV variants or mutations related to HCC were different between HBV genotypes B and C. References 1. Lee WM: Hepatitis B virus infection. N Engl J Med 1997; 337: Chen DS. From hepatitis to hepatoma: lessons from type B viral hepatitis. Science 1993; 262: Chu CM, Liaw YF. Natural history of chronic hepatitis B virus infection: an immunopathological study. J Gastroenterol Hepatol 1997; 12:S Lee CM, Lu SN, Changchien CS, et al. Age, gender, and local geographic variations of viral etiology of hepatocellular carcinoma in a hyperendemic area for hepatitis B virus infection. Cancer 1999; 86: Pre-S/Surface and BCP/Precore in Hepatocellular Carcinoma JID 2008:198 (1 December) 1641

9 5. Chen DS. Hepatitis B virus infection, its sequelae, and prevention in Taiwan. In: Okuda K, Ishak KG, eds. Neoplasms of the liver. Tokyo, Japan: Springer-Verlag, 1987: Okamoto H, Tsuda F, Sakugawa H, et al. Typing hepatitis B virus by homology in nucleotide sequence: comparison of surface antigen subtypes. J Gen Virol 1988; 69: Norder H, Hammas B, Lofdahl S, Courouce AM, Magnius LO. Comparison of the amino acid sequences of nine different serotypes of hepatitis B surface antigen and genomic classification of the corresponding hepatitis B virus strains. J Gen Virol 1992; 73: Stuyver L, De Gendt S, Van Geyt C, et al. A new genotype of hepatitis B virus: complete genome and phylogenetic relatedness. J Gen Virol 2000; 81: Kao JH, Chen PJ, Lai MY, Chen DS. Hepatitis B genotypes correlate with clinical outcomes in patients with chronic hepatitis B. Gastroenterology 2000; 118: Lindh M, Hannoun C, Dhillon AP, Norkrans G, Horal P. Core promoter mutations and genotypes in relation to viral replication and liver damage in East Asian hepatitis B virus carriers. J Infect Dis 1999; 179: Lee CM, Chen CH, Lu SN, et al. Prevalence and clinical implications of hepatitis B virus genotypes in southern Taiwan. Scand J Gastroenterol 2003; 38: Kao JH, Chen PJ, Lai MY, Chen DS. Basal core promoter mutations of hepatitis B virus increase the risk of hepatocellular carcinoma in hepatitis B carriers. Gastroenterology 2003; 124: Yu MW, Yeh SH, Chen PJ, et al. Hepatitis B virus genotype and DNA level and hepatocellular carcinoma: a prospective study in men. J Natl Cancer Inst 2005; 97: Chan HL, Hui AY, Wong ML, et al. Genotype C hepatitis B virus infection is associated with increased risk of hepatocellular carcinoma. Gut 2004; 53: Fujie H, Moriya K, Shintani Y, Yotsuyanagi H, Iino S, Koike K. Hepatitis B virus genotypes and hepatocellular carcinoma in Japan. Gastroenterology 2001; 120: Yuen MF, Sablon E, Yuan HJ, et al. Significance of hepatitis B genotype in acute exacerbation, HBeAg seroconversion, cirrhosis-related complications, and hepatocellular carcinoma. Hepatology 2003; 37: Sumi H, Yokosuka O, Seki N, et al. Influence of hepatitis B virus genotypes on the progression of chronic type B liver disease. Hepatology 2003; 37: Chen CH, Lee CM, Lu SN, et al. Clinical significance of hepatitis B virus (HBV) genotypes and precore and core promoter mutations affecting HBV e antigen expression in Taiwan. J Clin Microbiol 2005; 43: Takahashi K, Ohta Y, Kanai K, et al. Clinical implications of mutations C-to-T1653 and T-to-C/A/G1753 of hepatitis B virus genotype C genome in chronic liver disease. Arch Virol 1999; 144: Tanaka Y, Mukaide M, Orito E, et al. Specific mutations in enhancer II/core promoter of hepatitis B virus subgenotypes C1/C2 increase the risk of hepatocellular carcinoma. J Hepatol 2006; 45: Chisari FV, Ferrari C. Hepatitis B immunopathogenesis. Annu Rev Immunol 1995; 13: Brown SE, Howard CR, Zuckerman AJ, Steward MW. Affinity of antibody responses in man to hepatitis B vaccine determined with synthetic peptides. Lancet 1984; 2: Fan YF, Lu CC, Chen WC, et al. Prevalence and significance of hepatitis B virus (HBV) pre-s mutants in serum and liver at different replicative stages of chronic HBV infection. Hepatology 2001; 33: Pollicino T, Zanetti AR, Cacciola I, et al. Pre-S2 defective hepatitis B virus infection in patients with fulminant hepatitis. Hepatology 1997; 26: Sugauchi F, Ohno T, Orito E, et al. Influence of hepatitis B virus genotypes on the development of pres deletions and advanced liver disease. J Med Virol 2003; 70: Chen BF, Liu CJ, Jow GM, Chen PJ, Kao JH, Chen DS. High prevalence and mapping of pre-s deletion in hepatitis B virus carriers with progressive liver diseases. Gastroenterology 2006; 130: Wang HC, Huang W, Lai MD, Su IJ. Hepatitis B virus pre-s mutants, endoplasmic reticulum stress and hepatocarcinogenesis. Cancer Sci 2006; 97: Chen CH, Hung CH, Lee CM, et al. Pre-S deletion and complex mutations of hepatitis B virus related to advanced liver disease in HBeAgnegative patients. Gastroenterology 2007; 133: Lin DY, Sheen IS, Chiu CT, Lin SM. Kuo YC. Liaw YF. Ultrasonographic changes of early liver cirrhosis in chronic hepatitis B: a longitudinal study. J Clin Ultrasound 1993; 21: Hung CH, Lu SN, Wang JH, et al. Correlation between ultrasonographic and pathologic diagnoses of hepatitis B and C virus-related cirrhosis. J Gastroenterol 2003; 38: Mizokami M, Nakano T, Orito E, et al. Hepatitis B virus genotype assignment using restriction fragment length polymorphism patterns. FEBS Lett 1999; 450: Liu CJ, Chen BF, Chen PJ, et al. Role of hepatitis B viral load and basal core promoter mutation in hepatocellular carcinoma in hepatitis B carriers. J Infect Dis 2006; 193: Yuen MF, Tanaka Y, Mizokami M, et al. Role of hepatitis B virus genotype Ba and C, core promoter and precore mutations on hepatocellular carcinoma: a case control study. Carcinogenesis 2004; 25: Kidd AH, Kidd-Ljunggren K. A revised secondary structure model for the 3 -end of hepatitis B virus pregenomic RNA. Nucleic Acid Res 1996; 24: Li J, Buckwold VE, Hon MW, Ou JH. Mechanism of suppression of hepatitis B virus precore RNA transcription by a frequent double mutation. J Virol 1999; 73: Zhong S, Chan JY, Yeo W, Tam JS, Johnson PJ. Frequent integration of precore/core mutants of hepatitis B virus in human hepatocellular carcinoma tissues. J Viral Hepat 2000; 7: Cho SW, Shin YJ, Hahm KB, et al. Analysis of the precore and core promoter DNA sequence in liver tissues from patients with hepatocellular carcinoma. J Korean Med Sci 1999; 14: Fan YF, Lu CC, Chen WC, et al. Prevalence and significance of hepatitis B virus (HBV) pre-s mutants in serum and liver at different replicative stages of chronic HBV infection. Hepatology 2001; 33: Wang HC, Wu HC, Chen CF, Lei HY, Su IJ. Different types of ground glass hepatocytes in chronic hepatitis B virus infection contain specific pre-s mutants that induce endoplasmic reticulum stress. Am J Path 2003; 163: Hsieh YH, Su IJ, Wang HC, et al. Pre-S mutant surface antigens in chronic hepatitis B virus infection induce oxidative stress and DNA damage. Carcinogenesis 2004; 25: Gunther S, Fischer L, Pult I, Sterneck M, Will H. Naturally occurring variants of hepatitis B virus. Adv Virus Res 1999; 52: Zhong S, Chan JY, Yeo W, Tam JS, Johnson PJ. Hepatitis B envelope protein mutants in human hepatocellular carcinoma tissue. J Viral Hepat 1999; 6: Liu CJ, Kao JH, Shau WY, Chen PJ, Lai MY, Chen DS. Naturally occurring hepatitis B surface gene variants in chronic hepatitis B virus infection: correlation with viral serotypes and clinical stages of liver disease. J Med Virol 2002; 68: Preikschat P, Gunther S, Reinhold S, et al. Complex HBV populations with mutations in core promoter, C gene, and pre-s region are associated with development of cirrhosis in long-term renal transplant recipients. Hepatology 2002; 35: JID 2008:198 (1 December) Chen et al.