Induction of CYP1A2 by heavy coffee consumption is associated with the 163C>A polymorphism

Transcription

1 Induction of CYPA by heavy coffee consumption is associated with the 6C>A polymorphism Natasa Djordjevic, Roza Ghotbi, Slobodan Jankovic, Eleni Aklillu To cite this version: Natasa Djordjevic, Roza Ghotbi, Slobodan Jankovic, Eleni Aklillu. Induction of CYPA by heavy coffee consumption is associated with the 6C>A polymorphism. European Journal of Clinical Pharmacology, Springer Verlag,, 66 (7), pp <.7/s8--8->. <hal-887> HAL Id: hal Submitted on Apr HAL is a multi-disciplinary open access archive for the deposit and dissemination of scientific research documents, whether they are published or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers. L archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

2 Eur J Clin Pharmacol () 66:697 7 DOI.7/s8--8- PHARMACOGENETICS Induction of CYPA by heavy coffee consumption is associated with the CYPA 6C>A polymorphism Natasa Djordjevic & Roza Ghotbi & Slobodan Jankovic & Eleni Aklillu Received: 9 February / Accepted: 9 March / Published online: April # Springer-Verlag Abstract Objectives To investigate the association of CYPA genetic polymorphisms with the inducing effect of heavy coffee consumption on CYPA activity in Serbian and Swedish populations, and to determine the frequency of the CYPA genetic polymorphisms in Serbs. Methods Using PCR-RFLP and the tag-array minisequencing method, 6 Serbian healthy volunteers were genotyped for 86G>A, 67delT, 79T>G, 79C>T, 6C>A, 9G>A, and 79G>A. For 6 nonsmoking participants, the data on CYPA activity (plasma paraxanthine/caffeine ratio) and coffee consumption habit were available from our previous study. The data on CYPA genotype, enzyme activity, and coffee consumption from Swedish healthy nonsmoking subjects were included in the analyses. Results In Serbs, CYPA polymorphisms 86G>A, 67delT, 79T>G, 79C>T, 6C>A, and 9G>A were found at the frequencies of.,.,.,.7, 6., and 6.%, respectively, while 79G>A was not detected. Significant association of heavy coffee consumption with high CYPA enzyme activity was observed only in carriers of 6 A/A. Increasing effect of 6C>A on CYPA inducibility was found in both Serbian (P=.) N. Djordjevic : R. Ghotbi : E. Aklillu (*) Division of Clinical Pharmacology, Department of Laboratory Medicine, Karolinska Institutet, Karolinska University Hospital, Huddinge, C: 68 SE- 86 Stockholm, Sweden Eleni.Aklillu@ki.se N. Djordjevic : S. Jankovic Department of Pharmacology and Toxicology, Medical Faculty, University of Kragujevac, Svetozara Markovica 69, Kragujevac, Serbia and Swedish (P=.6) nonsmoking heavy coffee consumers. There was no significant difference in CYPA enzyme activity among genotypes in non heavy coffee consumers. The results indicate that and % of the phenotypic variability among Serbian and Swedish heavy coffee consumers, respectively, might be explained by 6C>A polymorphism. Conclusions CYPA polymorphism 6C>A has an important increasing effect on CYPA inducibility by heavy coffee consumption and may possibly be a contributing factor for interindividual variations in CYPA enzyme activity. Keywords CYPA. Polymorphisms. Induction. Coffee Introduction Cytochrome P A (CYPA) enzyme participates in the metabolism of numerous endogenous and foreign compounds and activates many procarcinogens [, ]. Therefore, any alteration in CYPA activity affects drug metabolism and modifies the risk of developing cancers and other diseases [ ]. CYPA activity displays extensive inter- and intraindividual variability, and a number of environmental and genetic factors have been reported to contribute to these variations [ ]. Polymorphism of the CYPA gene has been well described in many different populations, but only a few SNPs were associated with altered CYPA activity [,, ]. On the other hand, numerous drugs, including oral contraceptives, have been reported to induce or inhibit CYPA [,, ]. In addition, certain habits such as cigarette smoking also affect enzyme activity [9, ], and this effect is observed to be associated with CYPA

3 698 Eur J Clin Pharmacol () 66:697 7 polymorphism. Namely, substitution C>A at position 6 (rs76) leads to increased enzyme inducibility in smokers [7,, ], while carriers of 86G>A (rs69) who smoke cigarettes display decreased CYPA activity [8]. Recently, we reported that heavy coffee consumption (daily consumption of at least three cups of coffee) significantly increases CYPA activity [9]. This inducing effect has been observed in two separate populations, Serbs and Swedes, while controlling for the effect of drug intake and cigarette smoking. Yet, the association of the described effect with CYPA polymorphism has not been explored at this time. CYPA genetic polymorphisms in the Swedish population have been previously reported []. However, to the best of our knowledge, CYPA genotype in the Serbian population has not been investigated so far. The aim of the present study was to investigate the association of CYPA genetic polymorphisms with the inducing effect of heavy coffee consumption on CYPA activity in Serbian and Swedish populations, and to determine the frequency of the CYPA genetic polymorphisms in Serbs. CYPA genotyping DNA was extracted from the whole blood samples using QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany). Genotyping for six CYPA polymorphisms ( 86G>A, 6C>A, 79T>G, 79C>T, 9G>A, and 79G>A) was carried out using the tagarray minisequencing method, described by Lindroos et al. [7] with some modifications. The multiplex PCR and minisequencing primers (Table ) were designed using OligoPerfect Designer ( and Auto- Primer software ( (Beckman Coulter, Fullerton, CA, USA), and purchased from Integrated DNA Technologies (IDT, Coralville, IA, USA). Genotyping for 67delT was carried out using the PCR-RFLP method described by Chida et al. []. Statistical analysis Haplotype analysis and haplotype frequency calculations were carried out using the population genetic software program Arlequin, version. ( Chi-squared test was used to compare observed with expected allele frequencies (Hardy-Weinberg equilibrium). The 7X/7X ratio was log-transformed before statistical analyses. Oneway ANOVA followed by the post-hoc analyses (Fisher test) was used to assess the effect of genotype and coffee consumption on CYPA enzyme activity. Statistical analyses were performed with Statistica, version 7. (StatSoft, Tulsa, OK, USA), and P<. was considered as significant. Materials and methods Study subjects One hundred twenty-six unrelated healthy Serbian volunteers, 6 men and 66 women, were enrolled in the genotype analyses. As a part of the previous study [6], a -ml venous blood sample was collected into EDTA-containing Vacutainer tubes (Sarstedt, Nümbrecht, Germany) and frozen at 8 C. All samples were packed on dry ice and sent to Karolinska Institutet, Stockholm, Sweden, for genotyping analyses. For 6 nonsmoking participants, the data on CYPA activity [plasma paraxanthine (7X)/caffeine (7X) ratio] and coffee consumption were available from our previous study [9]. Additionally, data on CYPA genotype and activity of Swedish nonsmoking subjects [] were included in the analyses. There were no oral contraceptive users among the study subjects. All subjects participated voluntarily after written informed consent had been obtained. The study was approved by the ethics committees at the Medical Faculty, University of Kragujevac, Serbia, and at Karolinska Institutet, Sweden. The study was conducted in accordance with the Declaration of Helsinki and its subsequent revisions. Results The frequencies of the CYPA SNPs, haplotypes, and genotypes in the Serbian population are summarized in Table. The most frequent SNPs in Serbs were 6C>A and 9G>A. Seven different haplotypes were found, including two novel ones that were assigned as CYPA*X ( 79T>G, 6C>A, 9G>A) and CYPA*Y ( 67delT, 79T>G, 79G>A, 6C>A). All haplotypes were in Hardy-Weinberg equilibrium (χ <., P=.). To investigate the influence of genotype on CYPA inducibility by coffee consumption, we analyzed both Serbian and Swedish heavy and non heavy coffee consumers. Cigarette smokers and oral contraceptive users were not included in the comparison. In heavy coffee consumers, the only genotype-phenotype association revealed by comparison of log-transformed 7X/7X ratios included 6C>A polymorphism. The observed difference in CYPA activity was significant in both Serbian (Fig., P=.) and Swedish (Fig., P=.6) heavy coffee consumers, with the highest mean 7X/7X ratio in the 6 A/A genotype group (Table ). The coefficients of determination indicate that % (r =.) and % (r =.) of the phenotypic variability among Serbian and Swedish heavy coffee consumers, respectively, might be explained by the 6C>A polymorphism. On the other

4 Eur J Clin Pharmacol () 66: Table SNPs and primers used in genotyping of CYPA gene by the tag-array minisequencing method SNP rs# Primer name Sequence to PCR product (bp) 86G>A rs69 CYPA*C-F TGGAGTGCAGTGGTGCGA 9 CYPA*C-R TTCCAGCTACTCGGGAAG CYPA*C-MS-fo GAGTAGCCTTCCCGAGCATTTGGCTCACCGCAACCTCCGCCTCTC 79T>G rs696 CYPA*J*K-F AAGCTAGTGGGGACAGAAAGA CYPA*J*K-R TTAAAAATGGCTTAGTCCAAACTG CYPA*J-MS-fo AAACCATCGACTCACGGGATGGGGAGCCTGGGCTAGGTGTAGGGG 79C>T rs76 CYPA*J*K-F AAGCTAGTGGGGACAGAAAGA CYPA*J*K-R TTAAAAATGGCTTAGTCCAAACTG CYPA*K-MS-re ATTGACCAAACTGCGGTGCGAGTCAAGAGCTGGGTAGCAAAGCCC 6C>A rs76 CYPA*F-F AATCTTGAGGCTCCTTTCCA 7 CYPA*F-R AGCTGGATACCAGAAAGACTAAGC CYPA*F-MS-fo ATTAACTCGACTGCCGCGTGTGCTCAAAGGGTGAGCTCTGTGGGC 9G>A rs7 CYPArs7-F AGAAGGAGCTGGGTACATGG CYPArs7-R AGCAGGCACATAACAGGTGT CYPArs7- MS-fo AACAACGATGAGACCGGGCTACCCTATAGCCAGGAGAAGCCTTGA 79G>A rs97 CYPArs97-F TACACGGGAGGCTCAGGT 97 CYPArs97-R TATCACCCAGGCTGGAGTAC CYPArs97- AAGGCACGTATCATATCCCTGGTTGGCTTGAGCTGGGGAGGCAGA MS-fo hand, in non heavy coffee consumers there was no significant difference in CYPA enzyme activity among the different genotype groups, in Serbs (P.) or in Swedes (P.). To further evaluate the effect of heavy coffee consumption on CYPA activity, we compared log-transformed 7X/7X ratios between heavy and non heavy coffee consumers within each CYPA 6 genotype group. As expected, in both Serbs and Swedes the inducing effect of heavy coffee consumption on CYPA was observed only in carriers of 6 A/A (Table ). Discussion In the present study, we investigated the association of CYPA genetic polymorphisms and the induction of CYPA by heavy coffee consumption in Serbs and Swedes, using caffeine as a probe drug and plasma 7X/ 7X ratio as an index of CYPA enzyme activity. To the best of our knowledge, this is the first study to report increased CYPA inducibility by heavy coffee consumption in carriers of 6 A/A genotype. In addition, we described the frequencies of the seven most important SNPs of CYPA gene, as well as haplotypes and genotypes, in the Serbian population. The frequencies of investigated CYPA genetic variations, as well as of corresponding alleles and genotypes in Serbs, were comparable with the results previously published for other Caucasians [,, 8 ]. So far, only a few variations of the CYPA gene were associated with altered enzyme inducibility []. Nakajima et al. [8] described 86G>A as a causal factor of decreased CYPA induction in Japanese smokers. On the contrary, in Korean smokers CYPA activity was not found to be affected by this polymorphism []. Substitution of G>A at the position 86 of the CYPA gene is known as a feature of Asian populations [, ], and it is very rare in Caucasians [9]. As expected, in both Serbs and Swedes 86G>A occurred at a very low frequency (less than %) []. Therefore, in the present study the proposed decreasing effect of this polymorphism on CYPA induction could not be tested. Association of CYPA*K ( 79T>G, 79C>T, 6C>A) with low enzyme activity in Ethiopians [] was reported previously, but this allele is also rare in both Asians and Caucasians. On the other hand, Sachse et al. [7] observed higher enzyme inducibility in the presence of 6 A/A genotype, and the effect was also restricted to smokers. The importance of 6C>A polymorphism for CYPA enzyme induction was confirmed by a number of studies, reporting higher CYPA enzyme activity in the presence of the CYPA inducers, such as cigarette smoking or omeprazol [,,, ]. Substitution C>A at position 6 is one of the most common CYPA polymorphisms in Caucasians, with frequencies that range from.8% in British [] to 7.% in Swedish population []. In Serbs, 6C>A was the most frequently observed SNP,

5 7 Eur J Clin Pharmacol () 66:697 7 Table SNP and haplotype frequencies of CYPA gene in Serbs Observed frequency 9% CI SNP 86G>A. (/7).,. 67delT. (/8).,.8 79T>G. (9/6).7,.6 79G>A.7 (/7).,.8 6C>A.6 (6/6).,.668 9G>A.6 (9/66).,.68 79G>A. (/7).,.7 Haplotype a CYPA*A.8 (97/).7,.6 CYPA*C. (/).,. CYPA*M.8 (8/).86,.68 CYPA*V.8 (7/).,.8 CYPA*W. (/).,.6 CYPA*X.6 (/).,. CYPA*Y.8 (/).,. Genotype CYPA*A/*A. (8/6).9,.6 CYPA*A/*M.9 (/6).6,.6 CYPA*A/*V. (/6).,.7 CYPA*A/*W.6 (/6).,.6 CYPA*A/*X.8 (/6).,.9 CYPA*A/*Y.8 (/6).,.9 CYPA*C/*M.8 (/6).,.9 CYPA*M/*M.9 (7/6).,.79 CYPA*M/*V. (/6).,.8 CYPA*M/*W.8 (/6).,.9 CYPA*M/*X. (/6).,.7 CYPA*M/*Y.8 (/6).,.9 a CYPA*A (wild type), CYPA*C ( 86G>A), CYPA*M ( 6C>A, 9G>A), CYPA*V ( 67delT, 6C>A), CYPA*W ( 67delT, 6C>A, 79T>G), CYPA*X ( 79T>G, 6C>A, 9G>A), CYPA*Y ( 67delT, 79T>G, 79G>A, 6C>A) with a frequency that fitted well with the expected range. To investigate the effect of 6C>A on induction of CYPA by heavy coffee consumption, we compared enzyme activity among Serbian and Swedish heavy coffee consumers, controlling for the effect of cigarette smoking and oral contraceptive use. Our results demonstrate significant differences in 7X/7X ratios among 6C>A genotypes in heavy coffee consumers, with the highest CYPA enzyme activity detected in carriers of 6 A/A genotype. The inducing effect of heavy coffee consumption was observed only in subjects homozygous for the variant type allele, which designates the 6A allele as a recessive factor necessary for the CYPA induction. As expected, the influence of 6C>A was not observed either in Serbian or in Swedish non heavy coffee consumers. Several previous studies using plasma levels of haloperidol []; caffeine as a probe; urinary (AFMU+U+X)/7U [], (AAMU+AFMU+U+X)/ 7U [], or (AFMU+U+X+7U+7X)/7X ratio [] or theophilline as a probe; and plasma (U+X)/TP ratio [] as index of CYPA activity failed to find any correlation of 6C>A polymorphism with CYPA induction. Nevertheless, some of the studies [, ] had too low sample power, which might be the reason for the lack of significance in genotype-phenotype association. In addition, incomplete determination of the different haplotypes existing in the populations was suggested as one of the possible explanations for the discrepant results [, ], suggesting that functional impact of 6C>A probably depends on whether this polymorphism occurs alone or in linkage disequilibrium with other SNPs. Furthermore, none of the previous studies took into account heavy Number of subjects Serbs, C/C n=. Serbs, A/C n= Serbs, A/A n= X/7X Fig. The frequency distributions of the log-transformed 7X/7X ratios in Serbian heavy coffee consumers, with respect to 6C>A variation of CYPA gene. The arrows indicate the medians and the numbers along them are antilog values. The vertical line shows the reference antilog value of.

6 Eur J Clin Pharmacol () 66: Number of subjects Swedes, C/C n=9 Swedes, A/C n= Swedes, A/A n= X/7X Fig. The frequency distributions of the log-transformed 7X/7X ratios in Swedish heavy coffee consumers, with respect to 6C>A variation of CYPA gene. The arrows indicate the medians and the numbers along them are antilog values. The vertical line shows the reference antilog value of.6 coffee consumption as a possible confounding factor [9]. Our study demonstrates that heavy coffee consumption habit might be a possible confounding factor for the discrepant findings from studies that investigated the association of the 6C>A polymorphism with CYPA enzyme induction. Caffeine as a metabolic probe has several important advantages: rapid and complete absorption, wide distribution, low plasma protein binding, complete biotransformation, short half-life, and negligible renal excretion []. After ingestion, caffeine (7X) is predominantly metabolized by CYPA to paraxanthine (7X), and the 7X/ 7X ratio in plasma has been suggested as the most robust and valid measurement of CYPA activity [6, 7]. In the present study, CYPA activity was estimated by plasma 7X/7X ratio, after administration of mg oral dose of caffeine [9, ]. Possible competitive inhibition with caffeine from other dietary sources was avoided by abstaining from intake of any caffeine-containing food, beverage, and medication for at least h prior to and during the study [9, ]. On the other hand, it is known that cigarette smoking induces and oral contraceptive use inhibits CYPA [8, 9]. To avoid the effect of these confounders, in the present study smokers and oral contraceptive users were excluded from the comparison. Recently, we reported significantly lower CYPA activity in Serbs compared to Swedes [9]. In addition, while in Swedes 6C>A polymorphism most frequently occurred alone (CYPA*F) [], in Serbs it was always in linkage disequilibrium with other SNPs, mostly with 9G>A (CYPA*M). To avoid the described confounding effect of ethnicity, Serbian and Swedish heavy coffee consumers were analyzed separately. The influence of 6C>A on CYPA activity was significant in both Serbian and Swedish heavy coffee consumers, while other CYPA polymorphisms, including 9G>A, did not affect enzyme activity. Additionally, in both Serbs and Swedes, the inducing effect of heavy coffee consumption on CYPA was observed only in carriers of 6A/A. The results strongly suggest that 6C>A polymorphism has an important increasing effect on CYPA inducibility by heavy coffee consumption, regardless of possible linkage disequilibrium with other CYPA SNPs. Table Comparisons of mean 7X/7X ratios between non heavy and heavy coffee consumers in Serbs and Swedes based on the CYPA 6C>A genotype Non heavy coffee consumers Heavy coffee consumers P value n Mean ± SD n Mean ± SD Serbs C/C.8±..±.9.6 C/A.±..6±..7 A/A.8±..±.. Swedes C/C 9.±. 9.±.9.7 C/A 8.±..9±.7. A/A.7±..68±. <.

7 7 Eur J Clin Pharmacol () 66:697 7 In conclusion, the results of the study indicate that the 6C>A CYPA polymorphism has an important increasing effect on CYPA inducibility by heavy coffee consumption. In heavy coffee consumers, genotyping for 6C>A should be considered as a factor affecting interindividual variations in drug metabolism, as well as susceptibility to diseases associated with CYPA activity. Acknowledgments Authors would like to thank all volunteers who participated in the study. We are very grateful to Lilleba Bohman, Takashi Fukasawa, and Lili Milani for both technical support in the laboratory and scientific collaboration. The study was financially supported by the Swedish Research Council, Medicine, 9; the Medical Faculty, University of Kragujevac, Republic of Serbia, JP / ; the Swedish Institute; Plan Nacional de Investigación Científica, Desarrollo e Innovación Tecnológica (I+D+I), Instituto de Salud Carlos III, Subdirección General de Evaluación y Fomento de la Investigación, PI7; and Ayudas para la consolidación y apoyo a grupos de investigación de Extremadura, GRU9 (Orden de 7 de diciembre de 8, DOE de enero de 9). Conflict of interest statement The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. References. Nakajima M, Yokoi T, Mizutani M, Shin S, Kadlubar FF, Kamataki T (99) Phenotyping of CYPA in Japanese population by analysis of caffeine urinary metabolites: absence of mutation prescribing the phenotype in the CYPA gene. Cancer Epidemiol Biomarkers Prev :. Zhou SF, Wang B, Yang LP, Liu JP () Structure, function, regulation and polymorphism and the clinical significance of human cytochrome P A. Drug Metab Rev (in press). Bageman E, Ingvar C, Rose C, Jernstrom H (8) Coffee consumption and CYPA*F genotype modify age at breast cancer diagnosis and estrogen receptor status. Cancer Epidemiol Biomarkers Prev 7:89 9. Palatini P, Ceolotto G, Ragazzo F, Dorigatti F, Saladini F, Papparella I, Mos L, Zanata G, Santonastaso M (9) CYPA genotype modifies the association between coffee intake and the risk of hypertension. J Hypertens 7:9 6. Aklillu E, Carrillo JA, Makonnen E, Hellman K, Pitarque M, Bertilsson L, Ingelman-Sundberg M () Genetic polymorphism of CYPA in Ethiopians affecting induction and expression: characterization of novel haplotypes with singlenucleotide polymorphisms in intron. Mol Pharmacol 6: Kashuba AD, Bertino JS Jr, Kearns GL, Leeder JS, James AW, Gotschall R, Nafziger AN (998) Quantitation of three-month intraindividual variability and influence of sex and menstrual cycle phase on CYPA, N-acetyltransferase-, and xanthine oxidase activity determined with caffeine phenotyping. Clin Pharmacol Ther 6: 7. Sachse C, Brockmoller J, Bauer S, Roots I (999) Functional significance of a C >A polymorphism in intron of the cytochrome P CYPA gene tested with caffeine. Br J Clin Pharmacol 7: 9 8. Nakajima M, Yokoi T, Mizutani M, Kinoshita M, Funayama M, Kamataki T (999) Genetic polymorphism in the -flanking region of human CYPA gene: effect on the CYPA inducibility in humans. J Biochem : Djordjevic N, Ghotbi R, Bertilsson L, Jankovic S, Aklillu E (8) Induction of CYPA by heavy coffee consumption in Serbs and Swedes. Eur J Clin Pharmacol 6:8 8. Ghotbi R, Christensen M, Roh HK, Ingelman-Sundberg M, Aklillu E, Bertilsson L (7) Comparisons of CYPA genetic polymorphisms, enzyme activity and the genotype-phenotype relationship in Swedes and Koreans. Eur J Clin Pharmacol 6:7 6. Chida M, Yokoi T, Fukui T, Kinoshita M, Yokota J, Kamataki T (999) Detection of three genetic polymorphisms in the - flanking region and intron of human CYPA in the Japanese population. Jpn J Cancer Res 9: Han XM, Ouyang DS, Chen XP, Shu Y, Jiang CH, Tan ZR, Zhou HH () Inducibility of CYPA by omeprazole in vivo related to the genetic polymorphism of CYPA. Br J Clin Pharmacol :. Parker AC, Pritchard P, Preston T, Choonara I (998) Induction of CYPA activity by carbamazepine in children using the caffeine breath test. Br J Clin Pharmacol : Fuhr U, Anders EM, Mahr G, Sorgel F, Staib AH (99) Inhibitory potency of quinolone antibacterial agents against cytochrome PIA activity in vivo and in vitro. Antimicrob Agents Chemother 6:9 98. Gunes A, Ozbey G, Vural EH, Uluoglu C, Scordo MG, Zengil H, Dahl ML (9) Influence of genetic polymorphisms, smoking, gender and age on CYPA activity in a Turkish population. Pharmacogenomics : Djordjevic N, Carrillo JA, Gervasini G, Jankovic S, Aklillu E () In vivo evaluation of CYPA6 and xanthine oxidase enzyme activities in the Serbian population. Eur J Clin Pharmacol (in press) 7. Lindroos K, Sigurdsson S, Johansson K, Ronnblom L, Syvanen AC () Multiplex SNP genotyping in pooled DNA samples by a four-colour microarray system. Nucleic Acids Res :e7 8. Chevalier D, Cauffiez C, Allorge D, Lo-Guidice JM, Lhermitte M, Lafitte JJ, Broly F () Five novel natural allelic variants 9A>C, G>A (D8N), 6A>T (I86F), 7G>A (C6Y) and 9C>T (CY) of the human CYPA gene in a French Caucasian population. Hum Mutat 7: 6 9. Kootstra-Ros JE, Smallegoor W, van der Weide J () The cytochrome P CYPA genetic polymorphisms *F and *D do not affect clozapine clearance in a group of schizophrenic patients. Ann Clin Biochem :6 9. Sachse C, Bhambra U, Smith G, Lightfoot TJ, Barrett JH, Scollay J, Garner RC, Boobis AR, Wolf CR, Gooderham NJ () Polymorphisms in the cytochrome P CYPA gene (CYPA) in colorectal cancer patients and controls: allele frequencies, linkage disequilibrium and influence on caffeine metabolism. Br J Clin Pharmacol : Pavanello S, Pulliero A, Lupi S, Gregorio P, Clonfero E () Influence of the genetic polymorphism in the -noncoding region of the CYPA gene on CYPA phenotype and urinary mutagenicity in smokers. Mutat Res 87:9 66. Shimoda K, Someya T, Morita S, Hirokane G, Yokono A, Takahashi S, Okawa M () Lack of impact of CYPA genetic polymorphism (C/A polymorphism at position 7 in intron and G/A polymorphism at position -96 in the - flanking region of CYPA) on the plasma concentration of haloperidol in smoking male Japanese with schizophrenia. Prog Neuropsychopharmacol Biol Psychiatry 6:6 6. Nordmark A, Lundgren S, Ask B, Granath F, Rane A () The effect of the CYPA *F mutation on CYPA inducibility in pregnant women. Br J Clin Pharmacol :

8 Eur J Clin Pharmacol () 66: Takata K, Saruwatari J, Nakada N, Nakagawa M, Fukuda K, Tanaka F, Takenaka S, Mihara S, Marubayashi T, Nakagawa K (6) Phenotype-genotype analysis of CYPA in Japanese patients receiving oral theophylline therapy. Eur J Clin Pharmacol 6: 8. Krul C, Hageman G (998) Analysis of urinary caffeine metabolites to assess biotransformation enzyme activities by reversed-phase high-performance liquid chromatography. J Chromatogr B Biomed Sci Appl 79:7 6. Fuhr U, Jetter A, Kirchheiner J (7) Appropriate phenotyping procedures for drug metabolizing enzymes and transporters in humans and their simultaneous use in the cocktail approach. Clin Pharmacol Ther 8: Fuhr U, Rost KL (99) Simple and reliable CYPA phenotyping by the paraxanthine/caffeine ratio in plasma and in saliva. Pharmacogenetics : Kalow W, Tang BK (99) Caffeine as a metabolic probe: exploration of the enzyme-inducing effect of cigarette smoking. Clin Pharmacol Ther 9: 8 9. Abernethy DR, Todd EL (98) Impairment of caffeine clearance by chronic use of low-dose oestrogen-containing oral contraceptives. Eur J Clin Pharmacol 8: 8