Supplementary Information
|
|
|
- Mae Mitchell
- 6 years ago
- Views:
Transcription
1 Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim, Min Young Lee, Seung Jae Hyeon, Soojin Lee, Dong Hyun Kim, Sung Jae Jang, Hyoenjoo Im, Sun-Joon Min, Hyunah Choo, Ae Nim Pae, Dong Jin Kim, Kyung Sang Cho, Neil W. Kowall, and Hoon Ryu Lee et al. 1
2 Supplementary Materials and Methods Primary neuron culture Mouse primary neurons were obtained from the neostriatum of B6C57BL/6 [embryonic day 15 (E15)] as described previously [Supplementary Reference 1-3]. All experiments were initiated 48 to 72 hr after plating. Under these conditions the primary neurons are not susceptible to camptothecin-induced cytotoxicity. For cytotoxicity studies, cells were rinsed with warm PBS and then placed in Minimum Essential Medium (MEM; Life Technologies, Gaithersburg, MD) with 5.5 g/l glucose, 10% FCS, 2 mm L-glutamine). Camptothecin (1µM) was treated to primary cultures for 12 hour with or without either 1hr pre-treatment of nogalamycin (1µM) or distamycin (1 µm). Neuronal cell viability was determined by phase contrast microscopy and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay [Supplementary References 1-3]. Supplementary Reference 1. Ryu H, Lee J, Zaman K, Kubilis J, Ferrante RJ, Ross BD, Neve R, Ratan RR (2003a) Sp1 and Sp3 are oxidative stress-inducible, antideath transcription factors in cortical neurons. J Neurosci 23: Ryu H, Lee J, Olofsson BA, Mwidau A, Deodoglu A, Escudero M, Flemington E, Azizkhan- Clifford J, Ferrante RJ, Ratan RR (2003b) Histone deacetylase inhibitors prevent oxidative neuronal death independent of expanded polyglutamine repeats via an Sp1-dependent pathway. Proc Natl Acad Sci USA 100: Lee J, Kosaras B, Del Signore SJ, Cormier K, McKee A, Ratan RR, Kowall NW, Ryu H (2010) Modulation of lipid peroxidation and mitochondrial function improves neuropathology in Huntington's disease mice. Acta Neuropathol 121: Lee et al. 2
3 Supplementary Table 3. The list of qpcr primers for the detection of mrna levels in mouse cells and brains. Gene Oligo Sequence Arc Forward: 5'- GGA GTT CAA GAA GGA GTT TC -3' Reverse: 5'- CCA CAT ACT GAA TGA TCT CC -3' Egr1 Forward: 5'- AAC TTC AGT CGT AGT GAC CA -3' Reverse: 5'- CCA CAC TTT TGT CTG CTT TC -3' Ezh1 Forward: 5'- GTG AAG GAA GAA GAT GAG AC -3' Reverse: 5'- TCA TCA GAG TAC TGG TTG AG -3' Fos Forward: 5'- GAG CTG ACA GAT ACA CTC CA -3' Reverse: 5'- CAG ACC TCC AGT CAA ATC CA -3' Gabarapl2 Forward: 5'- AGT GGA TGT TTA AGG AGG AC -3' Reverse: 5'- GAT GAT CCA CAT GAA CTG AG -3' Gapdh Forward: 5'- CCG TGT TCC TAC CCC CAA T -3' Reverse: 5'- CTT CAC CAC CTT CTT GAT GTC ATC -3' Setdb1 Forward: 5'- GGC TCT CAG AAT CAT GGA CA -3' Reverse: 5'- CTA TCA ACA GCT GTG GCT GA -3' Lee et al. 3
4 Supplementary Table 4. The list of qpcr primers for the detection of H3K9me3 occupancy in the 5 -UTR promoter of Setdb1/Eset gene. Primer name Binding region Sequence Primer length Primer1-F -1179~-1158 AATGCCCTACTTCACACATGCA 22mer Primer1-R -982~-963 GCCAAACCCAGGCAAACTGA 20mer Primer2-F -334~-315 GGTTAGACTCGGTGTAGTGA 20mer Primer2-R -159~-140 GAGCCTCATCTTCTCACACA 20mer Primers were designed through BLAST/GRCm38 to target two 5 -UTR regions of Setdb1 promoter (-1179~- 963/-334~ (upstream) and -315~-140 (down stream) from the CDS region). Mouse Setdb1 is located in Chromosome 3: 95,323,525-95,357,202 reverse strand. GRCm38: CM Lee et al. 4
5 Supplementary Table 5. The list of qpcr primers for the detection of human mutant HTT and mouse endogenous Htt mrna levels. Gene Oligo Sequence Forward: 5'-AGG TTC GCT TTT ACC TGC GG-3' HTT Reverse: 5'-CAT CAG CTT TTC CAG GGT CG-3' Forward: 5'-CCC CAT TCA TTG CCT TGC TG-3' Htt Reverse: 5'-CTT GAG CGA CTC GAA AGC CT-3' Lee et al. 5
6 Supplementary Figure 1. Western blot analysis with anti-setdb1 antibody shows the specificity for SETDB1 protein. a, Anti-SETDB1 rabbit antibody (Santa Cruz, sc-66884) detected the expression of Myc-tagged SETDB1 protein. The major band of SETDB1 protein was found at 180kDa (red arrow). Cells (HEK293) were transiently transfected with Myc-His or Myc-SETDB1 plasmid DNAs for 48h and then harvested for the immunoblot analysis. b, The Myc antibody (MBL, M192-3) detected the expression of Myc-tagged SETDB1. c, The immunoblotting with STDEB1 antibody confirmed that the endogenous level of SETDB1 protein is increased in HD striatal cells (STHdhQ 111/111 ) compared to wild type cells (STHdhQ 7/7 ). This image (panel c) represents the full blot of SETDB1 protein in the main Figure 2c. Lee et al. 6
7 Supple Figure 2. Nogalamycin reduces the colocalization of heterochromatin binding protein 1 alpha (HP1α) and H3K9me3 in HD transgenic (R6/2) mice. a, Nogalamycin reduces the level of HP1α in the striatum of R6/2 mice. Scale bar: 10 µm. b, Nogalamycin reduces the level of H3K9me3 in the striatum of R6/2 mice. WT (n=5); R6/2 (n=5); R6/2+nogalamycin (R6/2+Nogala) (n=5). c, The alteration in HP1α level is correlated with H3K9me3 level in the striatum. Nogalamycin administration shifted the correlation levels of H3K9me3 and HP1α in the striatum of R6/2 mice. Significantly different from WT at **p < Significantly different from R6/2 at ## p < Lee et al. 7
8 Articles for Acta Neuropathologica Supplementary Figure 3. Analysis of the dimethylated H3K9 (H3K9me2) level and its colocalization with nucleosomal structure using deconvolved and 3-D constructed confocal images. a, Deconvolved image shows punctate structures of H3K9me3 (red) in the nuclei of striatal neurons in WT (n=5), R6/2 mice (n=5), and nogalamycin-treated R6/2 mice (R6/2+Nogala) (n=5). Scale bar: 10µm. Significantly different from R6/2 mice at **p < b, Nogalamycin reduced the density of H3K9me2 in R6/2 mice. 3-D rendering (deconvolved and isosurface) images showing that H3K9me2 (red) is landscaped spatially apposed to pericentromere structure (blue) in the striatal neuron of R6/2 mice. Nogalamycin reduced the volume expansion of pericentromeric structure. Scale bars (white): 5µm. Lee et al. 8
9 Supplementary Figure 4. Nogalamycin modulates the ratio of H3K9me3 versus acetylated histone H3K9 (H3K9ac) in the striatum of HD transgenic (R6/2) mice. a, Nogalamycin improves the H3K9ac immunoreactivity in the striatum of R6/2 mice. The H3K9ac immunoreactivity was reduced in striatal neurons of R6/2 mice compared with WT mice. Scale bar, 10 µm. b, Densitometry analysis shows that nogalamycin restores the level of H3K9ac in the striatum of R6/2 mice. WT (n=5); R6/2 (n=5); R6/2 + nogalamycin (R6/2+Nogala) (n=5). Significantly different from WT at **p < Significantly different from R6/2 at # p < c, Nogalamycin balances the acetylation and the trimethylation of H3K9. Examination of the proportion of H3K9me3 to H3K9ac reveals a shift towards greater methylation in R6/2 mice relative to WT control mice. Nogalamycin shifts the H3K9me3 level and balances the ratio of H3K9me3 versus H3K9ac towards the level in WT mice. Lee et al. 9
10 Supplementary Figure 5. Scatter plot analysis of H3K9me-ChIP-on-ChIP array from the striatal tissue of WT, R6/2, and R6/2 + nogalamycin (Nogala) mice. a, The distributions of H3K9me3-enriched DNA are well normalized between WT versus R6/2 mice. B, The distributions of H3K9me3-enriched DNA are well normalized between R6/2 versus R6/2 + Nogala mice. Lee et al. 10
11 Figure 6. The effect of nogalamycin on motor behavior in WT mice. a, Scheme showing experimental procedure of nogalamycin treatment and rotarod tests in WT mice. Mice were treated with nogalamycin from 5 to 8 weeks of age. Rotarod tests were measured three times at 6, 7 and 8 weeks of age. b, Nogalamycin (Nogala) administration did not influence the rotarod performance in WT mice. WT (n=5); WT + Nogala (n=5). Lee et al. 11
12 Supplementary Figure 7. Nogalamycin reduces immunoreactivity of mhtt in the striatum of HD transgenic (R6/2) mice. a, Light microscopy images show that nogalamycin decreases mhtt immunoreactivity in the striatal neurons of R6//2 mice compared to the vehicle-treated R6/2 mice. b, Densitometry analysis shows that nogalamycin decreases mhtt immunoreactivity in the cytosol of striatal neurons compared to the vehicle-treated R6/2 mice. WT (n=5); R6/2 (n=5); R6/2 + nogalamycin (R6/2+Nogala) (n=5). Significantly different at **, p< Scale bar: 10 µm. Lee et al. 12
13 Supplementary Figure 8. Effect of nogalamycin on endogenous Htt and mutant HTT (mhtt) transgene expression in HD transgenic (R6/2) mice. a, qpcr analysis of Htt expression in the striatal tissue of WT (n=3), R6/2 mice (n=3), and nogalamycin-treated (Nogala) R6/2 mice (n=3). Nogalamycin did not affect the expression level of endogenous Htt. Htt expression was normalized to Gapdh expression. b The relative mrna expression of mhtt transgene in the striatal tissue of WT (n=3), R6/2 mice (n=3), and nogalamycin-treated (Nogala) R6/2 mice (n=3). Nogalamycin did not affect the expression level of mhtt. c The agarose gel analysis represents that nogalamycin does not affect mrna levels of endogenous Htt, mhtt transgene, and Gapdh in the striatum of R6/2 mice. Lee et al. 13
14 Supplementary Figure 9. Nogalamycin prevents camptothecin-induced primary neuronal death. a Nogalamycin protects primary neurons from genotoxic neuronal damage. Phase contrast images show the morphology change of primary neurons in response to camptothecin. Primary neurons (48 hr in vitro culture) were pretreated with nogalamycin (1 µm) or distamycin (1µM) 1 hr before camptothecin (1µM) treatment. b Nogalamycin increases the viability of primary neurons against camptothecin-induced cell death. The graph represents triplicate experiments. **Significantly different from control at p<0.01; ## Significantly different from camptothecin only at p<0.01; Significantly different from control at p<0.01. Lee et al. 14
15 Supplementary Figure 10. Nogalamycin reduces immunoreactivity of activated caspase-3 in the striatum of HD transgenic (R6/2) mice. Caspase-3 immunoreactivity is increased in striatal neurons of R6/2 mice compared to wild-type littermate mice at 10 weeks of age (left panel). Nogalamycin decreases caspase-3 immunoreactivity in striatal neurons of R6/2 mice. WT (n=5); R6/2 (n=5); R6/2 + nogalamycin (R6/2+Nogala) (n=5). Significantly different from WT mice at **p < Significantly different from R6/2 mice at ## p < Lee et al. 15
Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N
MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using
Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
Supplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
Supplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'
Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA
Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
Supplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
Supplementary Figures
Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in
SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
Supplementary Figure 1a
Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results
Nature Immunology: doi: /ni.3836
Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:
Supplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.
University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and
Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments
SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M
A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging
Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because
Supplementary Figure S1 Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because importin-α6 was shown to be testis-specific. Human and chicken importin protein
Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E
Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili
SUPPORTING INFORMATION
SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena
Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and
BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL
1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.
BIOLOGY 621 Identification of the Snorks
Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on
Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac
ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,
Supplementary Figure 1
Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated
Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease
Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,
Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade
Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha
Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype
J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high
Culture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)
A. B. C. D. E. PA JSRI JSRI 2 PA DSAM DSAM 2 DSAM 3 PA LNAP LNAP 2 LNAP 3 PAO Fcor Fcor 2 Fcor 3 PAO Wtho Wtho 2 Wtho 3 Wtho 4 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB
Supplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
Supporting Information
Supporting Information Malapeira et al. 10.1073/pnas.1217022110 SI Materials and Methods Plant Material and Growth Conditions. A. thaliana seedlings were stratified at 4 C in the dark for 3 d on Murashige
Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis
Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott
A basic helix loop helix transcription factor controls cell growth
A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability
Beta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015
Bioinformatics in Medical Product Development SMPD 287 Three Beta Thalassemia Sami Khuri Department of Computer Science San José State University Hemoglobin Outline Anatomy of a gene Hemoglobinopathies
Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast
Supplemental Figures, Tables and Results Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Sami Hocine 1, Pascal Raymond 2, Daniel Zenklusen 2, Jeffrey A. Chao 1 &
Supplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota
Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources
www.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:
Beta Thalassemia Case Study Introduction to Bioinformatics
Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha
Supplemental Figures: Supplemental Figure 1
Supplemental Figures: Supplemental Figure 1 Suppl. Figure 1. BM-DC infection with H. pylori does not induce cytotoxicity and treatment of BM-DCs with H. pylori sonicate, but not heat-inactivated bacteria,
Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and Gerard D. Wright.
Supplementary Data for TetX is a Flavin-Dependent Monooxygenase Conferring Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and
CIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR
CIRCRESAHA/2004/098145/R1 - ONLINE 1 Expanded Materials and Methods Validation by Semi-quantitative Real-Time Reverse Transcription PCR Expression patterns of 13 genes (Online Table 2), selected with respect
Supplementary information
Supplementary information Unique polypharmacology nuclear receptor modulator blocks inflammatory signaling pathways Mi Ra Chang 1, Anthony Ciesla 1, Timothy S. Strutzenberg 1, Scott J. Novick 1, Yuanjun
Lezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 10: Sintesi proteica Synthesis of proteins Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/473/eaai7696/dc1 Supplementary Materials for Astrocyte-shed extracellular vesicles regulate the peripheral leukocyte response to inflammatory brain lesions
SUPPLEMENTARY RESULTS
SUPPLEMENTARY RESULTS Supplementary Table 1. hfpr1- Flpln-CHO hfpr2-flpln-cho pec 50 E max (%) Log( /K A) Log( /K A) N pec 50 E max (%) Log( /K A) Log( /K A) n ERK1/2 phosphorylation fmlp 9.0±0.6 80±7
TetR repressor-based bioreporters for the detection of doxycycline using Escherichia
Supplementary materials TetR repressor-based bioreporters for the detection of doxycycline using Escherichia coli and Acinetobacter oleivorans Hyerim Hong and Woojun Park * Department of Environmental
Relationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia
elationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia H.J. Ou 1, G. Huang 2, W. Liu 3, X.L. Ma 2, Y. Wei 4, T. Zhou 5 and Z.M. Pan 3 1 Department of Neurology, The
*To whom correspondence should be addressed. This PDF file includes:
www.sciencemag.org/cgi/content/full/science.1212182/dc1 Supporting Online Material for Partial Retraction to Detection of an Infectious Retrovirus, XMRV, in Blood Cells of Patients with Chronic Fatigue
ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.
Cell cycle analysis For cell cycle analysis, single cell suspensions of E12.5 fetal liver cells were suspended in 4 ml ice-cold 7% ethanol with gentle vortexing, incubated at -2 C for 4 hours, and washed
McAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers.
Mclpine PERK-GSK3 regulates foam cell formation Supplemental Material Supplementary Table I. Sequences of real time PCR primers. Primer Name Primer Sequences (5-3 ) Product Size (bp) GRP78 (human) Fwd:
University of Groningen. Vasoregression in incipient diabetic retinopathy Pfister, Frederick
University of Groningen Vasoregression in incipient diabetic retinopathy Pfister, Frederick IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from
SUPPLEMENTAL FIGURE 1
SUPPLEMENTL FIGURE 1 C Supplemental Figure 1. pproach for removal of snorns from Rpl13a gene. () Wild type Rpl13a exonintron structure is shown, with exo in black and intronic snorns in red rectangles.
Supporting Information. Mutational analysis of a phenazine biosynthetic gene cluster in
Supporting Information for Mutational analysis of a phenazine biosynthetic gene cluster in Streptomyces anulatus 9663 Orwah Saleh 1, Katrin Flinspach 1, Lucia Westrich 1, Andreas Kulik 2, Bertolt Gust
SUPPLEMENTARY INFORMATION
BASELINE ISCHAEMIA a b Phd2 +/- c d Collateral growth and maintenance SMC recruitment SMC proliferation Phd2 +/- NF- B off NF- B on NF- B on NF- B on Endothelial cell Smooth muscle cell Pro-arteriogenic
Loyer, et al. microrna-21 contributes to NASH Suppl 1/15
Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 SUPPLEMENTARY MATERIAL: Liver MicroRNA-21 is Overexpressed in Non Alcoholic Steatohepatitis and Contributes to the Disease in Experimental Models
Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies
Borneo Journal of Resource Science and Technology (2013) 3(2): 15-20 Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies EDMUND UI-HANG SIM *1, NUR DIANA ANUAR 2, TENG-AIK ONG 3, GUAN-
Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients
Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Shuichi OTABE, Karine CLEMENT, Séverine DUBOIS, Frederic LEPRETRE, Veronique PELLOUX,
Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis SUPPLEMENTARY INFORMATION
Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis Pooja Arora 1, Aneesh Goyal 2, Vivek T atarajan 1, Eerappa Rajakumara 2, Priyanka Verma 1, Radhika Gupta 3,
Isolate Sexual Idiomorph Species
SUPLEMENTARY TABLE 1. Isolate identification, sexual idiomorph and species of each isolate used for MAT locus distribution in Paracoccidioides species. Isolate Sexual Idiomorph Species Pb01 MAT1-1 P. lutzii
SUPPLEMENTAL METHODS Cell culture RNA extraction and analysis Immunohistochemical analysis and laser capture microdissection (LCM)
SUPPLEMENTAL METHODS Cell culture Human peripheral blood mononuclear cells were isolated from healthy donors by Ficoll density gradient centrifugation. Monocyte differentiation to resting macrophages ()
Baseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3
Next-Generation Sequencing Technology Reveals a Characteristic Pattern of Molecular Mutations in 72.8% of Chronic Myelomonocytic Leukemia (CMML) by Detecting Frequent Alterations in TET2, CBL, RAS, and
mir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Supplementary Information
Title: mir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Authors: Juan Pablo Lopez 1, Raymond Lim 3, Cristiana Cruceanu 1, Liam Crapper 1,
Supplementary Data. Clinical Setup. References. Program for Embryo Donation
Supplementary Data Clinical Setup Notwithstanding their value in stem cell research, the source of supernumerary human blastocysts for the derivation of new stem cell lines and the modalities of their
Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10
J. gen. Virol. (1988), 69, 945-949. Printed in Great Britain 945 Key words: BTV/genome segment lo/nucleotide sequence Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 By
The Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital
The Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital Jung-Woo Choi MD, PhD; Younghye Kim MD, PhD; Ju-Han Lee
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
Mutation analysis of a Chinese family with oculocutaneous albinism
/, 2016, Vol. 7, (No. 51), pp: 84981-84988 Mutation analysis of a Chinese family with oculocutaneous albinism Xiong Wang 1, Yaowu Zhu 1, Na Shen 1, Jing Peng 1, Chunyu Wang 1, Haiyi Liu 2, Yanjun Lu 1
What do you think of when you here the word genome?
What do you think of when you here the word genome? What do you think of when you here the word genome? Personal Genomics Outline Review of pre-lab work Genomics and Medicine Case Overview & Assignment
Supplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction
Original article http://dx.doi.org/10.3345/kjp.2012.55.11.424 Korean J Pediatr 2012;55(11):424-429 eissn 1738-1061 pissn 2092-7258 Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex
Genome-wide identification of TCF7L2/TCF4 target mirnas reveals a role for mir-21 in Wnt-driven epithelial cancer
INTERNATIONAL JOURNAL OF ONCOLOGY 40: 519-526, 2012 Genome-wide identification of TCF7L2/TCF4 target mirnas reveals a role for mir-21 in Wnt-driven epithelial cancer FENGMING LAN 1-3*, XIAO YUE 1-3,5*,
INTERLEUKIN-10 FACILITATES BOTH CHOLESTEROL UPTAKE AND EFFLUX IN MACROPHAGES
SUPPLEMENTAL DATA INTERLEUKIN-10 FACILITATES BOTH CHOLESTEROL UPTAKE AND EFFLUX IN MACROPHAGES Xinbing Han, Shiro Kitamoto, Qingyu Lian and William A. Boisvert Vascular Medicine Research Unit, Brigham
Engineering a polarity-sensitive biosensor for time-lapse imaging of apoptotic processes and degeneration
nature methods Engineering a polarity-sensitive biosensor for time-lapse imaging of apoptotic processes and degeneration Yujin E Kim, Jeannie Chen, Jonah R Chan & Ralf Langen Supplementary figures and
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10743 Supplementary Figures and Legends Supplementary Figure 1. CYP17A1 (red boxes) lies at the intersection of steroid hormone biosynthetic pathways. CYP17A1
Ho Young Jung Hye Seung Han Hyo Bin Kim 1 Seo Young Oh 1 Sun-Joo Lee 2 Wook Youn Kim
Journal of Pathology and Translational Medicine 2016; 50: 138-146 ORIGINAL ARTICLE Comparison of Analytical and Clinical Performance of HPV 9G DNA Chip, PANArray HPV Genotyping Chip, and Hybrid-Capture
Cancer Genetics 204 (2011) 45e52
Cancer Genetics 204 (2011) 45e52 Exon scanning by reverse transcriptaseepolymerase chain reaction for detection of known and novel EML4eALK fusion variants in nonesmall cell lung cancer Heather R. Sanders
Advanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health
Write your name here Surname Other names Edexcel GCE Centre Number Candidate Number Biology Advanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health Thursday 8 January 2009 Morning Time: 1 hour
Development of RT-qPCR-based molecular diagnostic assays for therapeutic target selection of breast cancer patients
Development of RT-qPCR-based molecular diagnostic assays for therapeutic target selection of breast cancer patients Sangjung Park The Graduate School Yonsei University Department of Biomedical Laboratory
PATIENTS AND METHODS. Subjects
PATIENTS AND METHODS Subjects Twenty-nine morbidly obese subjects involved in a gastric surgery program were enrolled in the study between October 25 and March 21. Bariatric surgery was performed in patients
3) Table_S1: Clinical Characteristics of Breast Cancer Patients. 5) Table_S3: Primer sequences used for qt-pcr of ChIP samples
Supplemental Section: 1) Eight supplemental figures and legends 2) Supplemental Materials and Methods 3) Table_S1: Clinical Characteristics of Breast Cancer Patients 4) Table_S2: Oligonucleotide sequences
Viral hepatitis, which affects half a billion people
GASTROENTEROLOGY 2006;130:435 452 BASIC LIVER, PANCREAS, AND BILIARY TRACT Natural Killer Cells Ameliorate Liver Fibrosis by Killing Activated Stellate Cells in NKG2D-Dependent and Tumor Necrosis Factor
On the relevance of carnosine and carnosinase for the development of diabetic nephropathy Riedl, Eva Maria Susanne
University of Groningen On the relevance of carnosine and carnosinase for the development of diabetic nephropathy Riedl, Eva Maria Susanne IMPORTANT NOTE: You are advised to consult the publisher's version
The animals were housed in standard cages with ad libitum access to both food and
Supplementary data: Supplementary Material and Methods Animal preparation The animals were housed in standard cages with ad libitum access to both food and water. During the imaging sessions, the animals
Supplementary Material Hofko M et al., Detection of carbapenemases by real-time PCR and melt-curve analysis on the BD MAX TM System
Supplementary Material Hofko M et al., Detection of carbapenemases by real-time PCR and melt-curve analysis on the BD MAX TM System Supplementary Material and Methods Characterization of isolates by the
Supplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature
Supplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature BA vs. preadipocytes. b, Number of GPCRs with 2-fold
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/6/e1603001/dc1 Supplementary Materials for Serotonin rebalances cortical tuning and behavior linked to autism symptoms in 15q11-13 CNV mice Nobuhiro Nakai, Masatoshi
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action Supplementary Figure : Expression levels of toll-like receptor 4 (Tlr4) in muse lung does not change throughout the
Malignant Amelanotic Melanoma of the Pleura without Primary Skin Lesion: An Autopsy Case Report. a a*
2009 63 6 379 384 Malignant Amelanotic Melanoma of the Pleura without Primary Skin Lesion: An Autopsy Case Report a b a a a* a b 380 63 6 Chest x ray and computed tomography (CT). A, Chest x ray on admission
Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany
HLA ISSN 2059-2302 BRIEF COMMUNICATION Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany C. J. Hernández-Frederick 1, N. Cereb 2,A.S.Giani 1, J.
The Expression of Integrins in Korean Breast Cancer Patients
64 1 Vol. 64, No. 1, J anuary, 2003, 1, 2, 3 1 2 3 The Expression of Integrins in Korean Breast Cancer Patients Hong Kim, M.D., Yong Sik Jung, M.D., Hye Jin Kim, M.S., Hyun Hee Im, M.D. 1, Jin Woo Lee,