Stimulating healthy tissue regeneration by targeting the 5-HT 2B receptor in chronic liver disease.

Size: px
Start display at page:

Download "Stimulating healthy tissue regeneration by targeting the 5-HT 2B receptor in chronic liver disease."

Transcription

1 Stimulating healthy tissue regeneration by targeting the 5-HT 2B receptor in chronic liver disease. Mohammad R Ebrahimkhani, Fiona Oakley, Lindsay B Murphy, Jelena Mann, Anna Moles, Maria J Perugorria, Elizabeth Ellis, Anne F Lakey, Alastair Burt, Angela Douglass, Matthew C Wright, Steven A White, Fabrice Jaffré, Luc Maroteaux, and Derek A Mann. Supplemental Figure 1. HSC depletion or 5-HT 2B receptor antagonism does not affect cholangiocyte proliferation, hedgehog signalling or hepatocyte growth factor expression during liver injury. Mice underwent bile duct ligation (BDL). Fourteen days later BDL mice were given IP injections of C1-3-gliotoxin (C1-3-GT), control antibody conjugated to gliotoxin (CSBD9-GT) or vehicle every other day for a further 7 days. Representative liver sections and morphometric quantification of CK19 and Gli2 positively stained cells shows no difference in the average number of Gli2 and CK19 positively stained cells between the treatment groups (a). Whole liver hepatocyte growth factor (HGF) mrna levels were measured 24 hours after acute CCl 4 liver damage ± 5-HT 2A antagonist ketanserin (2A) or 5-HT 2B antagonist SB (2B) and at 14 days BDL ± the 5-HT 2B antagonist SB (2B), administered daily from day 7 (b). Mice underwent bile duct ligation (BDL) or sham operation. At 7 days post surgery mice were given the 5-HT 2B antagonist SB (2B) or vehicle daily for 7 days (c). Data shows representative liver sections and morphometric quantification of alpha fetoprotein (AFP), Gli2 and cytokeratin 19 (CK19) positively stained cells. Administration of the 5-HT 2 antagonists did not change hepatic HGF expression or progenitor cell expansion (AFP), hedgehog signalling (Gli2) or cholangiocyte proliferation (CK19). Photomicrographs are at x magnification. Data are expressed as mean ± s.e.m and representative of 5 mice per group.

2 Supplemental Figure 2. 5-HT 2B receptors expression and function in normal and diseased liver. Serum liver transaminases AST, ALT and gamma-gt (GGT) were similar in normal uninjured adult wild type (WTwhite bars) and 5-HT 2B receptor knockout (KO-black bars) mice, suggesting that gene deletion of 5-HT 2B receptors does not cause liver damage (a). Mitotic hepatocytes were quantified using PCNA immunostaining at 36 hours post PHX ± 2A or 2B receptor antagonist administration. Hepatocyte proliferation was blunted by antagonism of 5-HT 2A receptors but stimulated by antagonism of 5-HT 2B receptors (b). Data are expressed as mean ± s.e.m and representative of least 4 mice per group. Representative liver sections showing 5-HT 2B receptor immuno-histochemical staining in BDL, acute CCl 4 injury, normal liver and the positive control tissues stomach and brain. Red arrows denote HSC and yellow arrows denote cholangiocytes. Photomicrographs are at 400x magnification (c). 5-HT 2B receptor mrna levels were quantified in isolated hepatocytes, Kupffer cells, cholangiocytes and HSC (d) and hepatocytes isolated from either normal liver or 72 hours partial hepatectomised liver (PHX) (e). HSC express high levels of 5-HT 2B receptor compared to other liver cell types. Hepatocytes express relatively low levels of this receptor and the expression decreases by ~50% after partial hepatectomy.

3 Supplemental Figure 3. HSC depletion during partial hepatectomy promotes liver regeneration. Mice underwent PHX and were then given IP injections of C1-3 or C1-3-gliotoxin (C1-3-GT) at 24 hours and 48 hours post surgery. The data shows representative liver sections and morphometric quantification of AFP, Gli2 and CK19 and total manual cell counts in 15 HP fields of αsma (HSC), PCNA (hepatocyte regeneration), BrDU and F4/80 (Kupffer Cells) positively stained cells. Administration of C1-3-GT to partial hepatectomised mice resulted in a reduction of αsma+ cells and an increase in hepatocyte proliferation. However, no change in expansion of hepatic progenitor cells, hedgehog signalling, cholangiocyte proliferation or Kupffer cells was observed. Photomicrographs are at x magnification. Data are expressed as mean ± s.e.m and representative of 4 mice per group. *P <0.05 and **P <0.01 versus control as calculated by ANOVA.

4 Supplemental Figure 4. Depletion of HSC or antagonism of 5-HT 2B receptors does not affect the liver damage, cholangiocyte or progenitor cell proliferation after toxic injury but stimulates liver regeneration. Whole liver αsma mrna levels, a marker of HSC activation, were quantified in olive oil controls and at 24, 48 and 72 hours post CCl 4 injury (a) and was maximal at 48 hours. Representative liver sections and morphometric quantification of AFP (progenitor cells), Gli2 (hedgehog signalling) and CK19 (cholangiocyte proliferation) and total manual cell counts in 15 HP fields of αsma (HSC), PCNA (hepatocyte regeneration) and F4/80 (Kupffer Cells) positively stained cells in mice injured with CCl 4, then treated at 24 hours and 40 hours with either C1-3 or C1-3-GT ± the 5-HT 2B antagonist SB (2B) or appropriate vehicle (b). HSC depletion (reduced αsma), administration of the 5-HT 2B antagonist SB or these treatments combined stimulated liver regeneration (PCNA) to equivalent levels but does not affect progenitor cell (AFP) or cholangiocyte (CK19) proliferation or Kupffer cells (F4/80) numbers. Photomicrographs are at x magnification. Serum transaminases ALP, ALT and AST were measured and no difference was observed with administration of either C1-3 or C1-3-GT ± the 5-HT 2B antagonist SB (2B), suggesting that the injury process was not affected by 5-HT 2B receptor antagonism or HSC depletion (c). Data are expressed as mean ± s.e.m and representative of 5 mice per group. *P <0.05 and ***P <0.001 versus control as calculated by ANOVA.

5 Supplemental Figure 5. Selective blockade of 5-HT 2B receptor in hepatic stellate cells inhibits an ERK dependant recruitment of JunD to the mouse and rat TGFβ1 promoter. ChIP primers designed to span regulatory AP-1 sites either distal (primer 8 and fig 3g) or proximal (primer 2) to the transcription start site of the rat TGFβ1 gene (a). ChIP primers designed to span regulatory AP-1 sites either distal (primer 1) or proximal (primer 2) to the transcription start site of the mouse TGFβ1 gene (b). ChIP analysis of JunD recruitment to putative AP-1 sites in the distal and proximal regions of the TGFβ1 promoter in rat (a) and mouse (b) HSC stimulated with 5-HT for 4 hours but not in HSC pre-treated with SB or the ERK inhibitor PD Western blot detection of ERK/phospho-ERK in mouse (c) and human (d) hepatic stellate cells stimulated with 5-HT for 10 min ± 30 min pre-treatment with PD98059 or SB Whole liver TGFβ1 mrna levels in wild type (black bars) and JunD-knockout (white bars) mice at peak injury (day 1 after the final CCl 4 injection), day 4 and 7 following 8 weeks of CCl 4 injury (e). Expression of hepatic TGFβ1 is lower in mice lacking JunD. Data are mean ± s.e.m, representative of 4 mice per group. Mice were given CCl 4 by IP injection bi-weekly for 3 weeks then administered ketanserin (2A) or SB (2B) or vehicle was then administered tri-weekly in addition to bi-weekly CCl 4 for a further 5 weeks (f). Average cell counts of active caspase 3 (apoptotic cells) in livers after 3 and 8 weeks chronic CCl 4 ± ketanserin or SB Antagonism of 5-HT 2B receptor but not 5-HT 2A receptors significantly increase apoptosis. Western blot detection of 5-HT 2B in primary cell-culture activated human hepatic stellate cells (HSC) and primary human hepatocytes. 5-HT 2B receptors are highly expressed in HSC compared to human hepatocytes (g).

6 Supplemental Figure 6. Regulation of hepatocyte proliferation and fibrogenesis by the 5-HT 2 receptors. Diagram showing that platelet derived serotonin can directly stimulate hepatocyte regeneration via 5-HT 2A receptors expressed on hepatocytes, but simultaneously induce expression of the potent inhibitor of hepatocyte regeneration; TGFβ1 via the 5-HT 2B receptor expressed on HSC in an ERK-P JunD-P dependant manner. We suggest that autocrine TGFβ1 signalling can feedback onto the HSC to further provoke their fibrogenic activities in addition to providing a negative signal to limit liver regeneration.

7 Supplemental Figure 7. Methods Murine primary liver cell isolation. We opened the abdominal cavity of an anesthetized mouse and canulated the portal vein. We then perfused the liver with Hank's Buffered Salt Solution (HBSS) without Ca and Mg containing HEPES (5mM) and EDTA (0.5mM), 3ml/min for 9 min followed by collagenase D (1mg/ml) (Roche) perfusion for another 9 min. We passed the digested tissue through a nylon mesh (pore size: 100 um) and pooled three mouse liver for each isolation. Hepatocytes: we isolated hepatocytes using two rounds of centrifugation at 50g for 3 mins. Stellate cells: we isolated HSCs based on their density by centrifuging the cells on an 11.5% optiprep gradient (Axis-Shield), at 1400g for 17 mins 1. Kupffer cells: we isolated KC from livers digested with 20mg collagenase B and 110mg pronase (Roche). We filtered livers through nybolt mesh and pelleted the cells by centrifugation at 400g for 7 mins. We re-suspended the cell pellets in HBSS containing DNAse, and layered onto a 16% Optiprep gradient and spun at 600g for 20 mins. We removed the upper layer containing KC and pelleted the cells as before. We re-suspended the KC in medium and plated for 20 mins to allow them to adhere, we then washed plates thoroughly to remove contaminating cells and then cultured KC at 37 o C and 5% CO Cholangiocytes: Dolichos biflorus agglutinin (DBA) is a lectin that specifically binds to cholangiocytes. We incubated digested single cells with biotinylated Dolichols Biflorus agglutinin (Vector Laboratories) for 30 mins at 4 C. We then collected cholangiocytes bound to the streptavidin-conjugated MACS beads (Miltenyi Biotec) using a magnetic column Oakley, F., et al. Nuclear factor-kappab1 (p50) limits the inflammatory and fibrogenic responses to chronic injury. The American journal of pathology 166, (2005). 2. Alabraba, E.B., et al. A new approach to isolation and culture of human Kupffer cells. Journal of immunological methods 326, (2007). 3. Nakagome, Y., et al. Autoimmune cholangitis in NOD.c3c4 mice is associated with cholangiocyte-specific Fas antigen deficiency. Journal of autoimmunity 29, (2007).

8 Supplemental Figure 8. Table 1: Forward and reverse primer sequences and annealing temperatures for qrt-pcr and ChIP assay. For qrt-pcr reactions, SYBR Green Master Mix (Sigma) was combined with specific primer pairs, 20ng cdna per target gene reaction or 5ng per GAPDH reaction and forty PCR cycles performed. Relative level of transcriptional difference was calculated using the following equation: [1/(2 A )] x100, where (A = average experimental group average control) after the GAPDH cdna value had been deducted from the target gene for each sample. Target gene Rat TGFβ Mouse TGFβ Mouse IL-1β Mouse IL-6 Mouse TNFα Mouse a-sma Mouse TIMP1 Mouse Pro-collagen I Mouse HGF Mouse 5HT-2BR Mouse 5HT-2BR Rat TGFβ1 promoter (primer 2) Rat TGFβ1 promoter (primer 8) Mouse TGFβ1 promoter (primer 1) Mouse TGFβ1 promoter (primer 2) Primer sequence Forward 5 - gaacccccattgctgtcc -3 Reverse 5 - tccgtctccttggttcag -3 Forward 5 - cgaagcggactactagc -3 Reverse 5 - caaaagacagccactcag -3 Forward 5 - gaaccaagcaacgacaaa -3 Reverse 5 - gcagactcaaactccact -3 Forward 5 - tttccaatgctctcctaa -3 Reverse 5 - taggtttgccgtagat -3 Forward 5 - gcggtgcctatgtctcag -3 Reverse 5 - ttggtggtttgctgac -3 Forward 5 - tcagcgcctccagttcct -3 Reverse 5 - aaaaaaaaccacgagtaacaaatcaa -3 Forward 5 - gcatggacatttattctccactgt -3 Reverse 5 - tctctaggagccccgatctg -3 Forward 5 - ttcacctacagcacgcttgtg -3 Reverse 5 - gatgactgtcttgcccca agt -3 Forward 5 -aaaaattacatgggcaact-3 Reverse 5 -attcaatttgctagcatcctg-3 Forward 5 - tttgggtcactggctgctttct-3 Reverse 5 - agtccaccgtgttaggcgttg-3 Forward 5 -taggaagccacagaagacaagcgt-3 Reverse 5 - agacactcacagccaaggtgactt-3 Forward 5'-aagaaacgcctctctgtcca-3' Reverse 5'-caggtcagctgggctacatt-3' Forward 5'-cctccaagcaaacccatcta-3' Reverse 5'-cggccagctaactaaccaac-3' Forward 5'-gggtctaagctgaggtgctg-3' Reverse 5'-tgggttctcatctcccactc-3' Forward 5'-tggcagtagctcccctattt-3' Reverse 5'- gggtctcccaaggaaaggta-3' Annealing temperature 51 o C 48 o C 54 o C

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

More information

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,

More information

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β

More information

contributes to reversal of biliary fibrosis by Popov et al.

contributes to reversal of biliary fibrosis by Popov et al. Supplementary data to MS Macrophage-mediated phagocytosis of apoptotic cholangiocytes contributes to reversal of biliary fibrosis by Popov et al. Supplementary table 1. Primers and probes used in quantitative

More information

Understanding Root Cause: Pathogenesis of Hepatic Fibrosis

Understanding Root Cause: Pathogenesis of Hepatic Fibrosis 10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis

More information

Molecular mechanisms of Fibrosis: Targets of Therapy. John P Iredale University of Edinburgh, UK

Molecular mechanisms of Fibrosis: Targets of Therapy. John P Iredale University of Edinburgh, UK Molecular mechanisms of Fibrosis: Targets of Therapy John P Iredale University of Edinburgh, UK Take home messages: The wound healing MFBs of the liver and the hepatic macrophages are key players in progressive

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Nature Medicine: doi: /nm.4324

Nature Medicine: doi: /nm.4324 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in 9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade

More information

Supplemental Experimental Procedures

Supplemental Experimental Procedures Cell Stem Cell, Volume 2 Supplemental Data A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis Andrew S. Brack, Irina M. Conboy, Michael J. Conboy,

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with

More information

NASH Bench to Bedside

NASH Bench to Bedside NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent

More information

AP VP DLP H&E. p-akt DLP

AP VP DLP H&E. p-akt DLP A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy

More information

SUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis

SUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis SUPPLEMENTARY INFORMATION Involvement of IL-21 in the epidermal hyperplasia of psoriasis Roberta Caruso 1, Elisabetta Botti 2, Massimiliano Sarra 1, Maria Esposito 2, Carmine Stolfi 1, Laura Diluvio 2,

More information

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.

More information

Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to

Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,

More information

Frontiers of Science Foundation Scholar. Toby Bothwell. Freshman, University of Arkansas. final research manuscripts

Frontiers of Science Foundation Scholar. Toby Bothwell. Freshman, University of Arkansas. final research manuscripts Frontiers of Science Foundation Scholar Toby Bothwell Oklahoma city, OKlahoma Freshman, University of Arkansas final research manuscripts The Effect of Estradiol and Estrogen Receptors α and β on Bone

More information

Supplementary Figure 1: Lgr5 expression in liver was induced by CCL4 and decreased after liver recovery. Mice were treated with single dose of CCL4

Supplementary Figure 1: Lgr5 expression in liver was induced by CCL4 and decreased after liver recovery. Mice were treated with single dose of CCL4 Supplementary Figure 1: Lgr5 expression in liver was induced by CCL4 and decreased after liver recovery. Mice were treated with single dose of CCL4 or control oil, the livers were collected at various

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast

More information

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and

More information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): The manuscript by Wu et al describes critical role of RNA binding protein CUGBP1 in the development of TGF-beta-mediated liver fibrosis. The activation

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding

More information

Recombinant Protein Expression Retroviral system

Recombinant Protein Expression Retroviral system Recombinant Protein Expression Retroviral system Viruses Contains genome DNA or RNA Genome encased in a protein coat or capsid. Some viruses have membrane covering protein coat enveloped virus Ø Essential

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine 1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells

More information

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC

More information

Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained

Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained 1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;

More information

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary

More information

In vitro human regulatory T cell suppression assay

In vitro human regulatory T cell suppression assay Human CD4 + CD25 + regulatory T cell isolation, in vitro suppression assay and analysis In vitro human regulatory T cell suppression assay Introduction Regulatory T (Treg) cells are a subpopulation of

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Procaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk

Procaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk A HeLa actin - + + - - + Cytochrome C (1 M) Z-VAD-fmk PMN - + + - - + actin Cytochrome C (1 M) Z-VAD-fmk Figure S1. (A) Pan-caspase inhibitor z-vad-fmk inhibits cytochrome c- mediated procaspase-3 cleavage.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,

More information

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation

More information

BRIDGE THE GAP A Human Pathways Approach to Disease Research

BRIDGE THE GAP A Human Pathways Approach to Disease Research BRIDGE THE GAP A Human Pathways Approach to Disease Research BIOMED 21 Brussels December 8 th, 2015 Brigitte Landesmann Systems Toxicology Unit and EURL ECVAM Institute for Health and Consumer Protection

More information

In vitro human regulatory T cell expansion

In vitro human regulatory T cell expansion - 1 - Human CD4 + CD25 + regulatory T cell isolation, Workflow in vitro expansion and analysis In vitro human regulatory T cell expansion Introduction Regulatory T (Treg) cells are a subpopulation of T

More information

M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination

M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination Supplemental Information Title: M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination Authors: Veronique E. Miron, Amanda Boyd, Jing-Wei Zhao, Tracy J. Yuen, Julia M.

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates

More information

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained

More information

In vitro human regulatory T cell expansion

In vitro human regulatory T cell expansion - 1 - Human CD4 + CD25 + CD127 dim/- regulatory T cell Workflow isolation, in vitro expansion and analysis In vitro human regulatory T cell expansion Introduction Regulatory T (Treg) cells are a subpopulation

More information

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate

More information

Laura Smart 9/22/2011

Laura Smart 9/22/2011 Laura Smart 9/22/2011 Fibrosis is a wound healing response in which damaged regions are encapsulated by an extracellular matrix or scar. Fibrosis develops in almost all patients with chronic liver injury

More information

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195. pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences. Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental

More information

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation. SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic

More information

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.

More information

Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master. Mix, Roche Applied Science) using specific oligonucleotides.

Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master. Mix, Roche Applied Science) using specific oligonucleotides. 1 SUPPLEMENTAL MATERIAL SUPPLEMENT METHODS Real Time PCR. Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master Mix, Roche Applied Science) using specific oligonucleotides. Rat ST2L forward

More information

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

Supporting Information

Supporting Information Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween

More information

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)

More information

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae

More information

Supplemental Figures:

Supplemental Figures: Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:

For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Supplementary Protocol 1. Adaptor preparation: For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x 96 5 -GATC

More information