HepaRG LX2. HepaRG HepaRG LX2 LX2

Microarray Analysis and Liver Diseases

Microarray Analysis and Liver Diseases Snorri S. Thorgeirsson M.D., Ph.D. Laboratory of Experimental Carcinogenesis Center for Cancer Research, NCI, NIH Application of Microarrays to Cancer Research Identifying

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

SUPPLEMENTARY INFORMATION

DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

SUPPLEMENTARY INFORMATION

doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured

Understanding Root Cause: Pathogenesis of Hepatic Fibrosis

10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3

Molecular mechanisms of Fibrosis: Targets of Therapy. John P Iredale University of Edinburgh, UK

Molecular mechanisms of Fibrosis: Targets of Therapy John P Iredale University of Edinburgh, UK Take home messages: The wound healing MFBs of the liver and the hepatic macrophages are key players in progressive

Inflammatory Cells and Metastasis

Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge

a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

CHAPTER V LOSS OF HISTONE DEACETYLASE 3 INCREASES SUSCEPTIBILITY FOR GENOMIC DAMAGE AND DISEASE DEVELOPMENT. Background and Significance

CHAPTER V LOSS OF HISTONE DEACETYLASE 3 INCREASES SUSCEPTIBILITY FOR GENOMIC DAMAGE AND DISEASE DEVELOPMENT Background and Significance The metabolic syndrome (MetS) is defined in an individual who has

Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein

Gene Ontology and Functional Enrichment Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein The parsimony principle: A quick review Find the tree that requires the fewest

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

Molecular signature for management of hepatocellular carcinoma

Molecular signature for management of hepatocellular carcinoma Yujin Hoshida, MD, PhD Liver Cancer Program, Tisch Cancer Institute Division of Liver Diseases, Department of Medicine Icahn School of Medicine

Analysis on the mechanism of reduced nephron number and the pathological progression of chronic renal failure in Astrin deficient rats

Analysis on the mechanism of reduced nephron number and the pathological progression of chronic renal failure in Astrin deficient rats Summary of Doctoral Thesis Hidenori Yasuda Graduate School of Veterinary

Tissue repair. (3&4 of 4)

Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid

SOMATOSTATIN RECEPTORS IN HEPATOCELLULAR CARCINOMA. Marie LEQUOY Saint-Antoine Hospital, Department of Hepatology, Paris, France

SOMATOSTATIN RECEPTORS IN HEPATOCELLULAR CARCINOMA Marie LEQUOY Saint-Antoine Hospital, Department of Hepatology, Paris, France Somatostatin : SST Somatostatin (SST) protein : 2 active forms (alternative

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,

2.28E E AKT/CAT P-3-4:

Supplemental Table 1: IPA network analysis of the microarray data presented in Figure 6 showing the most significant molecular and cellular function classifications along with the respective number of

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.

Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated

Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA

Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization

Milk micro-rna information and lactation

Christophe Lefèvre, BioDeakin,. Deakin University, Geelong VIC Australia Milk micro-rna information and lactation New Signals in milk? - Markers of milk and lactation status? - Signal infant development?

Non-Invasive Assessment of Liver Fibrosis. Patricia Slev, PhD University of Utah Department of Pathology

Non-Invasive Assessment of Liver Fibrosis Patricia Slev, PhD University of Utah Department of Pathology Disclosure Patricia Slev has no relevant financial relationships to disclose. 2 Chronic Liver Disease

BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES. Overview and Mechanism of Action Dr.

BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES Overview and Mechanism of Action Dr. Leah Klapper, CSO 88 BL-8040: Novel CXCR4 Antagonist For Hematological Cancers Indications:

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

SUPPLEMENTARY INFORMATION

doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

TITLE: TREATMENT OF ENDOCRINE-RESISTANT BREAST CANCER WITH A SMALL MOLECULE C-MYC INHIBITOR

AD Award Number: W81XWH-13-1-0159 TITLE: TREATMENT OF ENDOCRINE-RESISTANT BREAST CANCER WITH A SMALL MOLECULE C-MYC INHIBITOR PRINCIPAL INVESTIGATOR: Qin Feng CONTRACTING ORGANIZATION: Baylor College of

micrornas (mirna) and Biomarkers

micrornas (mirna) and Biomarkers Small RNAs Make Big Splash mirnas & Genome Function Biomarkers in Cancer Future Prospects Javed Khan M.D. National Cancer Institute EORTC-NCI-ASCO November 2007 The Human

Impact of Prognostic Factors

Melanoma Prognostic Factors: where we started, where are we going? Impact of Prognostic Factors Staging Management Surgical intervention Adjuvant treatment Suraj Venna, MD Assistant Clinical Professor,

WHAT THE EXPERIMENTAL MODELS CAN TEACH US IN NAFLD/NASH? Claudio Tiribelli, MD PhD Scientific Director FIF

WHAT THE EXPERIMENTAL MODELS CAN TEACH US IN NAFLD/NASH? Claudio Tiribelli, MD PhD Scientific Director FIF ctliver@fegato.it Worldwide estimated prevalence of NAFLD distribution of PNPLA3 genotypes 2017-Younussi

Supplementary Figures

Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human

Macrophage derived Wnt signalling opposes Notch signalling in a Numb mediated manner to specify HPC fate in chronic liver disease in human and mouse.

Macrophage derived Wnt signalling opposes Notch signalling in a Numb mediated manner to specify HPC fate in chronic liver disease in human and mouse. Luke Boulter, Olivier Govaere, Tom G Bird, Sorina Radulescu,

A quick review. The clustering problem: Hierarchical clustering algorithm: Many possible distance metrics K-mean clustering algorithm:

The clustering problem: partition genes into distinct sets with high homogeneity and high separation Hierarchical clustering algorithm: 1. Assign each object to a separate cluster. 2. Regroup the pair

contributes to reversal of biliary fibrosis by Popov et al.

Supplementary data to MS Macrophage-mediated phagocytosis of apoptotic cholangiocytes contributes to reversal of biliary fibrosis by Popov et al. Supplementary table 1. Primers and probes used in quantitative

The use of diagnostic FFPE material in cancer epidemiology research

The use of diagnostic FFPE material in cancer epidemiology research Neil O Callaghan Genetic Epidemiology Laboratory Department of Pathology The University of Melbourne www.pedigree.org.au Overview Who

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

Nature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs.

Supplementary Figure 1 RNA-Seq analysis of CD8 + TILs and N-TILs. (a) Schematic representation of the tumor and cell types used for the study. HNSCC, head and neck squamous cell cancer; NSCLC, non-small

Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.

Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+

Study Design to Validate Biomarkers of Therapeutic Response in NASH Due to Cirrhosis

Study Design to Validate Biomarkers of Therapeutic Response in NASH Due to Cirrhosis Detlef Schuppan Institute of Translational Immunology and Research Center for Immune Therapy, University Medical Center

SUPPLEMENTARY INFORMATION

doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

Rath, N., and Olson, M. (2016) Regulation of pancreatic cancer aggressiveness by stromal stiffening. Nature Medicine, 22(5), pp. 462-463. There may be differences between this version and the published

SUPPLEMENTARY INFORMATION

doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted

SUPPLEMENTARY APPENDIX

SUPPLEMENTARY APPENDIX 1) Supplemental Figure 1. Histopathologic Characteristics of the Tumors in the Discovery Cohort 2) Supplemental Figure 2. Incorporation of Normal Epidermal Melanocytic Signature

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1

a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac

Icd 10 code pancreatic cancer

Free, official coding info for 2018 ICD - 10 -CM C25.9 - includes detailed rules, notes, synonyms, ICD -9-CM conversion, index and annotation crosswalks, DRG grouping and. Free, official coding info for

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h

Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)

Index. Note: Page numbers of article titles are in boldface type.

Note: Page numbers of article titles are in boldface type. A Abetalipoproteinemia NASH and, 537 Acquired errors of metabolism NASH and, 536 537 Amiodarone steatohepatitis due to, 527 Anticonvulsant mood

Suppression of the Malignant Phenotype of Bladder Cancer Cells Investigations of the Proteome in Relation to Phenotype and Gene Expression

Suppression of the Malignant Phenotype of Bladder Cancer Cells Investigations of the Proteome in Relation to Phenotype and Gene Expression Topics Modulation of Phenotype by Extracellular Matrix. Bioinformatics

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

Title: Human breast cancer associated fibroblasts exhibit subtype specific gene expression profiles

Author's response to reviews Title: Human breast cancer associated fibroblasts exhibit subtype specific gene expression profiles Authors: Julia Tchou (julia.tchou@uphs.upenn.edu) Andrew V Kossenkov (akossenkov@wistar.org)

In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell

Supplementary Methods BrdU incorporation in vivo In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell proliferation in the heart. Mice were subjected to LI-TAC, and 5 days later

Overview of PSC Making the Diagnosis

Overview of PSC Making the Diagnosis Tamar Taddei, MD Assistant Professor of Medicine Yale University School of Medicine Overview Definition Epidemiology Diagnosis Modes of presentation Associated diseases

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ling Huang 1, Audrey Holtzinger 1,2,11, Ishaan Jagan 1,11, Michael BeGora 1, Ines

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin

Gene expression profiling predicts clinical outcome of prostate cancer. Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M.

SUPPLEMENTARY DATA Gene expression profiling predicts clinical outcome of prostate cancer Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M. Hoffman, William L. Gerald Table of Contents

ANALYTISCHE STRATEGIE Tissue Imaging. Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich

ANALYTISCHE STRATEGIE Tissue Imaging Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich Quantitative Breast single cancer cell analysis Switzerland Brain Breast Lung Colon-rectum

VUmc. VU University Medical Center, Amsterdam, The Netherlands University of Pisa, Pisa, Italy

MicroRNA-21 (mir-21) in pancreatic adenocarcinoma: correlation with clinical outcome and pharmacological aspects underlying its role in the modulation of gemcitabine activity Elisa Giovannetti, Niccola

Supplementary methods:

Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

Mark D Gorrell Sumaiya Chowdhury, Fiona Keane, Stephen Twigg, Geoff McCaughan

The protease fibroblast activation protein [FAP] as a biomarker and therapeutic target in chronic liver injury Mark D Gorrell Sumaiya Chowdhury, Fiona Keane, Stephen Twigg, Geoff McCaughan A.W. Morrow

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

p53 cooperates with DNA methylation and a suicidal interferon response to maintain epigenetic silencing of repeats and noncoding RNAs

p53 cooperates with DNA methylation and a suicidal interferon response to maintain epigenetic silencing of repeats and noncoding RNAs 2013, Katerina I. Leonova et al. Kolmogorov Mikhail Noncoding DNA Mammalian

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

Portal Fibroblasts in Biliary Fibrosis

Curr Pathobiol Rep (2014) 2:185 190 DOI 10.1007/s40139-014-0054-y MYOFIBROBLAST (TATIANA KISSELEVA, SECTION EDITOR) Portal Fibroblasts in Biliary Fibrosis Rebecca G. Wells Published online: 14 September

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.

Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

Review on Tumour Doubling Time (DT) To review the studies that measuring the actual tumour doubling time for human cancers.

Review on Tumour Doubling Time (DT) Objective To review the studies that measuring the actual tumour doubling time for human cancers. Methods We searched the Medline database from January 1966 to January

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken

Supplementary Figures

Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

SUPPLEMENTARY INFORMATION

Haematopoietic stem cell release is regulated by circadian oscillations Simón Méndez-Ferrer *, Daniel Lucas *, Michela Battista * and Paul S. Frenette * Mount Sinai School of Medicine, *Departments of

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

Supplemental Table S1

Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

AD Award Number: W81XWH-12-1-0137 TITLE: Computational models of anti-vegf therapies in prostate cancer PRINCIPAL INVESTIGATOR: Mac Gabhann, Dr. Feilim CONTRACTING ORGANIZATION: Johns Hopkins University,

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

chapter 1 - fig. 2 Mechanism of transcriptional control by ppar agonists.

chapter 1 - fig. 1 The -omics subdisciplines. chapter 1 - fig. 2 Mechanism of transcriptional control by ppar agonists. 201 figures chapter 1 chapter 2 - fig. 1 Schematic overview of the different steps

Mechanisms of hepatic fibrogenesis in chronic liver disease

Mechanisms of hepatic fibrogenesis in chronic liver disease JPEMS 2014, Physiopathology Module Corentin Bessy (Nantes) _ Gabrielle Cepella (Amsterdam) _ Charly Gaisne (Angers) _ Gwladys Guilloineau (Angers)

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

Hepatotoxicity Test by Stem Cell derived Hepatocyte

Tuesday, April 24, 2012 Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches Hepatotoxicity Test by Stem Cell derived Hepatocyte Seiichi Ishida National Institute of Health Sciences

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.

Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters

Supplementary Data: Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters Tiffany Hung 1,2, Yulei Wang 3, Michael F. Lin 4,5, Ashley K. Koegel 1,2, Yojiro Kotake 6-8, Gavin

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

Journal Club Semmler Lorenz

Beer et al. 2015 - Analysis of the Secretome of Apoptotic Peripheral Blood Mononuclear Cells: Impact of Released Proteins and Exosomes for Tissue Regeneration Journal Club 13.11.2017 1 Introduction to

DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

Pathological Analysis of Small Hepatocellular Carcinoma with Poor Prognosis

Pathological Analysis of Small Hepatocellular Carcinoma with Poor Prognosis Haeryoung Kim, M.D., Ph.D. Department of Pathology Seoul National University Bundang Hospital Small HCC Definition: HCC < 2cm

Topically Applicable Stromal Cell Growth Factors - Encapsulated Cosmeceuticals

Topically Applicable Stromal Cell Growth Factors - Encapsulated Cosmeceuticals Stem cells move to injured area, differentiate into neighboring cells, and replace the damaged cells Cell Eons Stem cells

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag

Nottingham Patterns of liver fibrosis and their clinical significance

Nottingham 2006 Patterns of liver fibrosis and their clinical significance Alastair D Burt Professor of Pathology and Dean of Clinical Medicine University of Newcastle upon Tyne Collapse of reticulin

Supplementary Materials:

Supplementary Materials: Supplemental Figure 1: Profibrotic markers in wt/wt or ex/ex mouse kidneys 42 days post IRI. The levels of fibronectin and αsma were examined by immunostaining in ADAM17 wt/wt

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.

Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data