CTLA-4 Gene Polymorphisms in Tunisian Patients with Graves Disease

Transcription

1 Clinical Immunology Vol. 101, No. 3, December, pp , 2001 doi: /clim , available online at on CTLA-4 Gene Polymorphisms in Tunisian Patients with Graves Disease Hassen Hadj Kacem,* Mohamed Bellassoued, Noura Bougacha-Elleuch,* Mohamed Abid, and Hammadi Ayadi* *Faculté de Médecine, Laboratoire de Génétique Moléculaire Humaine, Sfax, Tunisia; and Service d Endocrinologie, CHU Hédi Chaker, Sfax, Tunisia Graves disease (GD) is an organ-specific autoimmune disorder of multifactorial etiology with a polygenic mode of inheritance. A recent report has demonstrated that there is a linkage and an association between the genetic markers of the CTLA-4 gene on chromosome 2q33 and GD. In order to confirm this association in a Tunisian population, three polymorphisms of the CTLA-4 gene were analyzed: the first is at the 318 position from the ATG start codon consisting of a C/T change; the second is in position 49 of exon 1, which lies in the A/G transition; and the third is in the 3 untranslated region with variant lengths of the dinucleotide (AT) n repeat. The genomic DNA from 144 patients with GD and 205 healthy individuals was genotyped after specific polymerase chain reaction amplification. Comparative analysis using a 2 test showed a weak yet significant difference in allele frequencies of the A/G dimorphic marker between patients and controls (P < 0.05), and a significant increase of A/A homozygous individuals among patients (21.53 vs 12.7%, P 0.02, odds ratio (OR) 1.89) was found. Analyses of CTLA-4 A/G polymorphism with respect to sex showed a significant difference in A/A genotypes between female patients and controls (OR 2.14; 95%, 1.13 < OR < 4.04, P < 0.05). The distribution of CTLA-4 (AT) n allele frequencies differed between patients and controls ( , 20 degrees of freedom, P ) and the highest OR was found with the CTLA-4 (AT)-224-bp allele (OR 6.43, 1.7 < OR < 28.64; P 0.001). In conclusion, these results show that the CTLA-4 gene, or one closely associated with it, confers susceptibility to GD in a Tunisian population Elsevier Science Key Words: Graves disease; CTLA-4; polymorphisms; association; gene susceptibility. INTRODUCTION Graves disease (GD) is an organ-specific autoimmune disease characterized by a thyroid hormone oversecretion, diffuse goiter, and specific orbital complications. Like other autoimmune disorders (1, 2), GD is likely to be a polygenic disorder with several genetic regions, termed susceptibility loci, contributing to inheritance. Population-based case-control studies have shown a consistent association of GD with HLA-DR3-carrying major histocompatibility complex (MHC) haplotypes (DRB1*0304-DQB1*0201-DQA1*0501) in Caucasian populations (3 7). Evidence for a linkage of GD to the MHC has also been found in some populations (4, 7 9), but this has been difficult to reproduce (10, 11). Other candidate susceptibility genes, including the thyrotropin receptor, the immunoglobulin heavy chain, the interleukin 1 receptor antagonist, the T cell antigen receptor, and the thyroid hormone receptor gene have been found to be associated with GD in some studied populations, but not in others (8, 12 17). Recently, evidence for varying degrees of genetic linkage have been reported between autoimmune thyroid disease (AITD) and markers on the long arms of chromosomes 14q31, 20q11, Xq21, 20q13, and 18q21 (11, 18 21) and on the short arms of chromosomes Xp11 (22) and 6 close to, but distinct from, the human leukocyte antigen region (23). A full genome screening in a large Tunisian family affected with AITD showed a linkage with the D2S171 microsatellite marker in the 2p21 chromosome (24). These studies are still waiting for confirmation in different populations. The CTLA-4 gene was first identified as a candidate gene for GD (25), and further family and case-control studies have consistently detected a linkage and association of the CTLA-4 gene with GD (26 28) and Hashimoto s thyroiditis (27). Three different polymorphisms have been described in the CTLA-4 gene: one in the promoter region at position 318 from the ATG start codon consisting of a C/T change (29); a second in position 49 of exon 1, which lies in an A/G transition resulting in a threonine (Thr) or alanine (Ala) dimorphism (30); and third in the 3 untranslated region with variant lenghts of a dinucleotide (AT) n repeat (31). In this study we analyzed the CTLA-4 allele distribution in unrelated Tunisian patients with GD to evaluate the contribution of the CTLA-4 gene to genetic susceptibility to GD /01 $ Elsevier Science All rights reserved.

2 362 HADJ KACEM ET AL. Patients and s MATERIALS AND METHODS One hundred forty-four unrelated patients (30 men and 114 women) with GD were included in this study. GD was diagnosed on the basis of clinical and laboratory evidence of thyrotoxicose, palpable diffuse goiter, high thyroid hormonal rates, positive anti-thyrotropin receptor, anti-thyroid peroxidase, and/or anti-thyroglobulin antibodies. Data gathered from the patient group were compared to those obtained from a control population of 205 unrelated healthy subjects (100 men and 105 women) originating from the same area with no clinical evidence or family history of AITD and inflammatory joint disease. DNA Analyses DNA from patients and controls was obtained from peripheral blood as previously described (32). The dimorphism 318 (C/T) was defined by employing a polymerase chain reaction amplification refractory mutation system using primers designed according to the published human CTLA-4 complementary sequence (30) (Accession Nos. L15006, X15070, X15071, and X15072) and changing the nucleotide previous to the 3 end in the forward primers to increase the specificity (forward primers, 5 ACTTAGTTATCCAGATCCAC 3 and 5 ACTTAGTTATCCAGATCCAT 3 ; reverse primers, 5 AGGCTCTTGAATAGAAAGC 3 ). For each sample, two independent reactions were carried out. Typing of the CTLA-4 exon 1 A/G transition at position 49 was achieved by the polymerase chain reaction restriction fragment length polymorphism method. The primers used were 5 CAAGGCTC- AGCTGAACCTGGGT 3 and 5 TACCTTTAACTTC- TGGCTTTG 3. The amplified products were digested with the restriction enzyme KpnI (Amersham) and analyzed on a 4% agarose gel. The G allele corresponds to the presence of two fragments (173 bp and 22 bp) generated by KpnI digestion, and the A allele corresponds to the 195-bp uncleaved fragment. The polymorphisms of the CTLA-4 (AT) n dinucleotide repeat were analyzed after specific PCR amplification using the primers 5 GATGCTAAAGGTTGTATTGC 3 and 5 TGGTGTATTAGTGTCCTG 3 (31). The 5 end of the forward primers was labeled with [ 32 -P]ATP. Amplified products were resolved on 5 7% sequencing gels and detected by autoradiography. Statistical Analyses The distribution of the alleles in patients with GD versus controls was compared using the 2 test. The association of GD with CTLA-4 (AT) n alleles was evaluated using relative predispositional effects methods (5). Statistical significance was reached when P 0.05, and Fisher s exact test was used when necessary. Odds ratios (OR) were calculated according to Woolf s formula (33). RESULTS AND DISCUSSION DNA from patients and controls was analyzed in order to determine the polymorphisms of the CTLA position, the CTLA-4 49 position, and the CTLA-4 (AT) n repeat in the 3 untranslated region. When the allelic and genotypic frequencies corresponding to the CTLA position in GD patients and controls were compared, no significant differences were found: frequencies of individuals with 318 C/C, C/T, and T/T genotypes were 91, 9, and 0% in patients and 93.2, 6.8, and 0% in controls (Table 1), respectively. The absence of the T/T genotype in our population was not surprising. Indeed, T/T genotype frequencies in other populations are not significantly different from zero (34). CTLA-4 49-exon 1 polymorphism analysis showed a significant increase of A/A homozygous individuals among GD patients (21.53 vs 12.7%, P 0.02, OR 1.89) (Table 1). The distribution of allele frequencies showed a weak difference between patients and controls; indeed, the CTLA-4 A allele in GD (43.4%) was higher than that in the normal population (35.6%), with an odds ratio of 1.39 (95%, 1.01 OR 1.91, P 0.03). Differing from our population, analysis of the CTLA-4 A/G polymorphism in Japanese (26) and British populations (28), with case-control and intrafamilial association studies, respectively, showed an excess of the G allele in GD patients with significant association. This discordance could be explained by genetic heterogeneity of GD. When we analyzed the CTLA-4 49-exon 1 polymorphism with respect to sex we found that CTLA-4 genotypes were similar in controls of both sexes (100 males and 105 females; , 2 degrees of freedom, P 0.821). The distribution of genotype frequencies between female patients and controls showed a weak significant association ( , 2 degrees of freedom, P 0.03) and the significant difference in A/A genotypes was preserved (OR 2.14; 95%, 1.13 OR 4.04, P 0.01) (Table 2). The same analyses have been done on male patients and no significant association was found, but we cannot make decisive conclusions because of the reduced number of males tested. A further study is indispensable; a larger sample of males is necessary to make a meaningful comparison between both sexes. Analyses of A/G polymorphism in 118 Japanese female patients with GD showed a significant increase of the G allele; the odds ratio for the G phenotype was 2.82 (26). CTLA-4 (AT) n polymorphism revealed twenty-one alleles (Table 3), as previously described (25, 27, 28), with sizes ranging from 188 to 234 bp (corresponding to

3 CTLA-4 GENE POLYMORPHISMS 363 TABLE C/T Substitution and 49-Exon 1 A/G Transition Polymorphisms in Tunisian Patients with Graves Disease and s 318 C/T substitution (n 205) Graves disease (n 144) N % N % Genotype frequencies a CC CT TT Allele frequencies b C T Phenotype frequencies c C positive T positive exon 1 A/G transition Genotype frequencies d AA e AG GG Allele frequencies f A G Phenotype frequencies g A positive G positive a Overall 2 : , 1 degree of freedom, P b Overall 2 : , 1 degree of freedom, P c Overall 2 : , 1 degree of freedom, P d Overall 2 : , 2 degrees of freedom, P e Overall 2 : , 1 degree of freedom, P OR 1.89, 95%, 1.03 OR f Overall 2 : , 1 degree of freedom, P OR 1.39, 95%, 1.01 OR g Overall 2 : 2 1.4, 1 degree of freedom, P 0.2. the 88- to 134-bp alleles reported by Yanagawa et al. (25). The distribution of allele frequencies between patients and controls showed a significant association (overall , 20 degrees of freedom, P ). The highest OR was found with the CTLA-4 (AT)-16 allele (224 bp) (OR 6.43, 1.7 OR 28.64; P 0.001). To reveal the relative effects (predisposing, protective, or neutral) of the CTLA-4 (AT) alleles, we applied the relative predispositional effects method (5). After removing the CTLA-4 (AT)-16 allele from both patient and control data and repeating comparisons, the overall 2 was not significant ( , 19 degrees of freedom, P 0.084). Therefore, allele CTLA-4 (AT)-16 (224 bp) is significantly associated with GD. Analysis of CTLA-4 49-exon 1 polymorphism with respect to the CTLA-4 (AT)-16 allele showed no difference between patient and control genotype distributions (2/13 A/A, 5/13 A/G, and 6/13 G/G) (P 0.86). The distribution of the 206-bp allele (corresponding to 106 bp) reported, by many other studies, to be associated with GD (25, 27, 28) showed no significant difference between patients and controls (8.39 vs 6.32%). The CTLA-4 gene on chromosome 2q33 is a good candidate gene for AITD, as it has an important role in T cell regulation (35). It is a member of the same family of cell-surface molecules as CD28 and, along with CD28, it can bind to B7. The CTLA-4/B7 complex competes with the CD28/B7 complex, delivers negative signals to the T cell, and affects T cell expansion, cytokine production, and immune responses (35). The CTLA-4 gene is linked with type 1 diabetes (IDDM) and GD (36, 28). Analysis of chromosome 2q31- q33 with eight polymorphic markers in 77 affected autoimmune thyroid disease sib-pairs showed the evident linkage between GD and the D2S117 marker (P ) in a British population (28). In our population, linkage analysis of CTLA-4 gene polymorphisms in a large Tunisian consanguineous family didn t show any role for this gene in the development of AITD (24, 37). In this work, we found an association between CTLA-4 (AT) n and CTLA-4 A/G polymorphisms and GD. These results could be explained by the genetic heterogeneity in the Tunisian population, which is characterized by important ge- TABLE 2 CTLA-4 Exon 1 Polymorphism Analyzed with Respect to Sex (n 205) GD females (n 114) GD males (n 30) N % N % N % Genotype frequencies a AA AG GG Allele frequencies b A G Phenotype frequencies c A positive G positive Note. CTLA-4 genotypes were similar in controls of both sexes: 100 males and 105 females; , 2 degrees of freedom, P GD, Graves disease. a 2 test of heterogeneity between GD females and controls ( , 2 degrees of freedom, P 0.03); odds ratio for the AA genotype is 2.14 (1.13 OR 4.04, CI 95%). 2 test of heterogeneity between GD males and controls ( , 2 degrees of freedom, P 0.14). b 2 test of heterogeneity between GD females and controls ( , 1 degree of freedom, P 0.06). 2 test of heterogeneity between GD males and controls ( , 1 degree of freedom, P 0.15). c 2 test of heterogeneity between GD females and controls ( , 1 degree of freedom, P 0.32). 2 test of heterogeneity between GD males and controls ( , 1 degree of freedom, P 0.55).

4 364 HADJ KACEM ET AL. TABLE 3 CTLA-4 (AT) n Repeat Polymorphism in Patients with Graves Disease and s CTLA-4 (AT) alleles (n 160) Graves disease (n 137) N Size (bp) N % N % a Note. Overall 2 : , 20 degrees of freedom, P The most elevated OR was found with the CTLA-4 (AT)-16 allele (224 bp): OR 6.43, 1.7 OR 28.64; P The overall 2 after removing the CTLA-4 (AT)-16 allele was , 19 degrees of freedom, P GD, Graves disease. a The 206-bp allele is equivalent to the 106-bp allele described by Yanagawa et al. (25). OR netic exchanges throughout history and frequent migration around the Mediterranean sea. Genetic association using case-control studies (this work) considers this gene a minor contributor to the genetic susceptibility of AITD in our population. Moreover, the CTLA-4 gene could be a common susceptibility gene of many autoimmune diseases in the Tunisian population. Indeed, polymorphisms of the CTLA-4 gene were analyzed in Tunisian patients with rheumatoid arthritis (RA) and a significant association was found between CTLA-4 (AT) n polymorphism and RA (P 0.001) (38). Exon 1 A/G polymorphism is an unlikely candidate itself because the Thr/Ala substitution is not expected to affect the function of the leader peptide (36). On the contrary, the CTLA-4 (AT) n repeat seems to be a good candidate because it may be involved in mrna stability (39). Therefore, we can speculate about a relationship between CTLA-4 polymorphisms and CTLA-4 expression on the cell surface. Further understanding of the regulated expression of this gene is central to elucidation of the regulation of a T-cell-mediated immune response, which may have an impact on the pathogenesis of autoimmune diseases. Nevertheless, the linkage of GD, as well as IDDM, to CTLA-4 alleles not located in the expressed protein is intriguing, and it is possible that the susceptibility gene may be a CTLA-4-linked gene. Indeed, the CTLA-4 gene region contains other nearby candidate genes for thyroid autoimmune diseases, including CD28, STAT-1 and -4, caspases 8 and 10, and camp response element-binding protein-1 (see URL In conclusion, our results showed that CTLA-4 or one closely associated with it is a new risk factor for GD in the Tunisian population. ACKNOWLEDGMENTS This work was supported by the Secrétariat d Etat à la Recherche Scientifique et Technologique (S.E.R.S.T.) (Tunisia) and the International Centre for Genetic Engineering and Biotechnology (I.C.G.E.B.) (Italy). We thank Mr. Faouzi Ktari for his critical reading of the manuscript. REFERENCES 1. Vyse, T. J., and Todd, J. A., Genetic analysis of autoimmune disease. Cell 85, , Mein, C. A., Esposito, L., Dunn, M. G., Johnson, G. C., Timms, A. E., Goy, J. V., Smith, A. N., Sebag-Montefiore, L., Merriman, M. E., Wilson, A. J., Pritchard, L. E., Cucca, F., Barnett, A. H., Bain, S. C., and Todd, J. A., A search for type 1 diabetes susceptibility genes in families from the United Kingdom. Nat. Genet. 19, , Stenszky, V., Kozma, L., Balazs, C., Rochlitz, S., Bear, J. C., and Farid, N. R., The genetics of Graves disease: HLA and disease susceptibility. J. Clin. Endocrinol. Metab. 61, , Volpé, R., Immunology of human thyroid disease. In Autoimmune Disease of the Endocrine System (R. Volpé, Ed.), pp , CRC Press, Boca Raton, FL, Payami, H., Joe, S., Farid, N. R., Stenszky, V., Chan, S. H., Yeo, P. P., Cheah, J. S., and Thomson, G., Relative predispositional effects (RPEs) of marker alleles with disease: HLA-DR alleles and Graves disease. Am. J. Hum. Genet. 45, , Yanagawa, T., Mangklabruks, A., Chang, Y. B., Okamoto, Y., Fisfalen, M. E., Curran, P. G., and DeGroot, L. J., Human histocompatibility leukocyte antigen-dqa1*0501 allele associated with genetic susceptibility to Graves disease in a Caucasian population. J. Clin. Endocrinol. Metab. 76, , Heward, J. M., Allahabadia, A., Daykin, J., Carr-Smith, J., Daly, A., Armitage, M., Dodson, P. M., Sheppard, M. C., Barnett, A. H., Franklyn, J. A., and Gough, S. C., Linkage disequilibrium between the human leukocyte antigen class II region of the major histocompatibility complex and Graves disease: Replication using a population case control and family-based study. J. Clin. Endocrinol. Metab. 83, , Uno, H., Sasazuki, T., Tamai, H., and Matsumoto, H., Two major genes, linked to HLA and Gm, control susceptibility to Graves disease. Nature 292, , Shields, D. C., Ratanachaiyavong, S., McGregor, A. M., Collins, A., and Morton, N. E., Combined segregation and linkage analysis of Graves disease with a thyroid autoantibody diathesis. Am. J. Hum. Genet. 55, , Roman, S. H., Greenberg, D., Rubinstein, P., Wallenstein, S., and Davies, T. F., Genetics of autoimmune thyroid disease: Lack of evidence for linkage to HLA within families. J. Clin. Endocrinol. Metab. 74, , 1992.

5 CTLA-4 GENE POLYMORPHISMS Tomer, Y., Barbesino, G., Keddache, M., Greenberg, D. A., and Davies, T. F., Mapping of a major susceptibility locus for Graves disease (GD-1) to chromosome 14q31. J. Clin. Endocrinol. Metab. 82, , Cuddihy, R. M., Dutton, C. M., and Bahn, R. S., A polymorphism in the extracellular domain of the thyrotropin receptor is highly associated with autoimmune thyroid disease in females. Thyroid 5, 89 95, Blakemore, A. I., Watson, P. F., Weetman, A. P., and Duff, G. W., Association of Graves disease with an allele of the interleukin-1 receptor antagonist gene. J. Clin. Endocrinol. Metab. 80, , Demaine, A., Welsh, K. I., Hawe, B. S., and Farid, N. R., Polymorphism of the T cell receptor beta-chain in Graves disease. J. Clin. Endocrinol. Metab. 65, , Tassi, V., Scarnecchia, L., Di Cerbo, A., Pirro, M. T., Di Paola, R., Liuzzi, A., Torlontano, M., Zingrillo, M., D Aloiso, L., and De Filippis, V., A thyroid hormone receptor beta gene polymorphism associated with Graves disease. J. Mol. Endocrinol. 15, , Kotsa, K. D., Watson, P. F., and Weetman, A. P., No association between a thyrotropin receptor gene polymorphism and Graves disease in the female population. Thyroid 7, 31 33, Cuddihy, R. M., and Bahn, R. S., Lack of an association between alleles of interleukin-1 alpha and interleukin-1 receptor antagonist genes and Graves disease in a North American Caucasian population. J. Clin. Endocrinol. Metab. 81, , Tomer, Y., Barbesino, G., Greenberg, D. A., Concepcion, E., and Davies, T. F., A new Graves disease-susceptibility locus maps to chromosome 20q11.2. International Consortium for the Genetics of Autoimmune Thyroid Disease. Am. J. Hum. Genet. 63, , Barbesino, G., Tomer, Y., Concepcion, E. S., Davies, T. F., and Greenberg, D. A., Linkage analysis of candidate genes in autoimmune thyroid disease. II. Selected gender-related genes and the X chromosome. International Consortium for the Genetics of Autoimmune Thyroid Disease. J. Clin. Endocrinol. Metab. 83, , Pearce, S. H., Vaidya, B., Imrie, H., Perros, P., Kelly, W. F., Toft, A. D., McCarthy, M. I., Young, E. T., and Kendall-Taylor, P., Further evidence for a susceptibility locus on chromosome 20q13.11 in families with dominant transmission of Graves disease. Am. J. Hum. Genet. 65, , Vaidya, B., Imrie, H., Perros, P., Young, E. T., Kelly, W. F., Carr, D., Large, D. M., Toft, A. D., Kendall-Taylor, P., and Pearce, S. H., Evidence for a new Graves disease susceptibility locus at chromosome 18q21. Am. J. Hum. Genet. 66, , Imrie, H., Vaidya, B., Perros, P., Kelly, W. F., Toft, A. D., Young, E. T., Kendall-Taylor, P., and Pearce, S. H., Evidence for a Graves disease susceptibility locus at chromosome Xp11 in a United Kingdom population. J. Clin. Endocrinol. Metab. 86, , Tomer, Y., Barbesino, G., Greenberg, D. A., Concepcion, E., and Davies, T. F., Mapping the major susceptibility loci for familial Graves and Hashimoto s diseases: Evidence for genetic heterogeneity and gene interactions. J. Clin. Endocrinol. Metab. 84, , Maalej, A., Makni, H., Ayadi, F., Bellassoued, M., Jouida, J., Bouguacha, N., Abid, M., and Ayadi, H., A full genome screening in a large Tunisian family affected with thyroid autoimmune disorders. Genes Immun. 2, 71 75, Yanagawa, T., Hidaka, Y., Guimaraes, V., Soliman, M., and DeGroot, L. J., CTLA-4 gene polymorphism associated with Graves disease in a Caucasian population. J. Clin. Endocrinol. Metab. 80, 41 45, Yanagawa, T., Taniyama, M., Enomoto, S., Gomi, K., Maruyama, H., Ban, Y., and Saruta, T., CTLA4 gene polymorphism confers susceptibility to Graves disease in Japanese. Thyroid 7, , Kotsa, K., Watson, P. F., and Weetman, A. P., A CTLA-4 gene polymorphism is associated with both Graves disease and autoimmune hypothyroidism. Clin. Endocrinol. 46, , Vaidya, B., Imrie, H., Perros, P., Young, E. T., Kelly, W. F., Carr, D., Large, D. M., Toft, A. D., McCarthy, M. I., Kendall-Taylor, P., and Pearce, S. H., The cytotoxic T lymphocyte antigen-4 is a major Graves disease locus. Hum. Mol. Genet. 8, , Deichmann, K., Heinzmann, A., Bruggenolte, E., Forster, J., and Kuehr, J., An Mse I RFLP in the human CTLA4 promotor. Biochem. Biophys. Res. Commun. 225, , 1996, doi: /bbrc Harper, K., Balzano, C., Rouvier, E., Mattei, M. G., Luciani, M. F., and Golstein, P., CTLA-4 and CD28 activated lymphocyte molecules are closely related in both mouse and human as to sequence, message expression, gene structure, and chromosomal location. J. Immunol. 147, , Polymeropolos, M. H., Xiao, H., Rath, D. S., and Merril, C. R., Dinucleotide repeat polymorphism at the human CTLA-4 gene. Nucleic Acids Res. 19, 4018, Kawazaki, E., Sample preparation from blood, cells and other fluids. In PCR Protocols: A Guide to Methods and Application (M. Innis, D. Gelffand, G. Snisky, and T. White, Eds.), pp , Academic Press, San Diego, Woolf, B., On estimating the relation between blood group and disease. Ann. Hum. Genet. 19, , Gonzalez-Escribano, M. F., Rodriguez, R., Valenzuela, A., Garcia, A., Garcia-Lozano, J. R., and Nunez-Roldan, A., CTLA4 polymorphisms in Spanish patients with rheumatoid arthritis. Tissue Antigens 53, , Bluestone, J. A., Is CTLA-4 a master switch for peripheral T cell tolerance? J. Immunol. 128, , Nistico, L., Buzzetti, R., Pritchard, L. E., Van der Auwera, B., Giovannini, C., Bosi, E., Larrad, M. T., Rios, M. S., Chow, C. C., Cockram, C. S., Jacobs, K., Mijovic, C., Bain, S. C., Barnett, A. H., Vandewalle, C. L., Schuit, F., Gorus, F. K., Tosi, R., Pozzilli, P., and Todd, J. A., The CTLA-4 gene region of chromosome 2q33 is linked to, and associated with, type 1 diabetes. Hum. Mol. Genet. 5, , Maalej, A., Bougacha, N., Rebai, A., Bellassouad, M., Ayadi- Makni, F., Abid, M., Jouida, J., Makni, H., and Ayadi, H., Lack of linkage and association between autoimmune thyroid diseases and the CTLA-4 gene in a large Tunisian family. Hum. Immunol., in press. 38. Hadj Kacem, H., Kaddour, N., Adyel, F. Z., Bahloul, Z., and Ayadi, H., HLA-DQB1 CAR1/CAR2, TNFa IR2/IR4 and CTLA-4 polymorphisms in Tunisian patients with rheumatoid arthritis and Sjögren s syndrome. Rheumatology 40, 1 5, Shaw, G., and Kamen, R., A conserved AU sequence from the 3 untranslated region of GM-CSF mrna mediates selective mrna degradation. Cell 46, , Received July 9, 2001; accepted with revision September 7, 2001; published online November 6, 2001