PAX8-PPARγ Fusion Protein in thyroid carcinoma
|
|
|
- Russell Quinn
- 6 years ago
- Views:
Transcription
1 Sidney H. Ingbar Lecture, ATA 10/17/2013: PAX8-PPARγ Fusion Protein in thyroid carcinoma Ronald J. Koenig, MD, PhD Division of Metabolism, Endocrinology & Diabetes University of Michigan
2 Learning Objectives 1. Know what the PAX8-PPAR Fusion Protein is. 2. Know what types of thyroid cancer are associated with the PAX8-PPAR Fusion Protein. 3. Know about a clinical trial specifically designed for patients with PAX8-PPAR Fusion Protein thyroid cancer. 4. Know the normal function of PPAR. 5 Know about the Wnt pathway. (No disclosures)
3 Outline of today s presentation Background PPFP carcinoma patient samples Mouse model of PPFP thyroid carcinoma PPFP cell lines Summary and conclusions
4 Gene mutations underlie thyroid carcinoma Vu-Phan D & Koenig RJ. Mol. Cell. Endocrinol., in press (review)
5
6
7 PPFP is generated by a chromosomal translocation Paired Box Gene 8 (PAX8): Chr 2q Translocation (2;3)(q13;p25) Peroxisome Proliferator-Activated Receptor Gamma (PPARG): Chr 3p25 DBD Fusion junction DBD LBD PAX8 PPAR PAX8-PPAR Fusion Protein (PPFP)
8 Functions of PAX8 and PPAR. PAX8 is a transcription factor that is essential for thyroid development and that drives the expression of many thyroid-specific genes. PPAR is the master regulator of adipogenesis, among other functions. PPAR is expressed at very low levels in normal thyroid and has no known function in that organ.
9 PAX8-PPAR has dominant negative activity over PPAR (transfections in U2OS osteosarcoma cells) Kroll TG, et al. Science 289: , 2000
10 PPAR, a putative tumor suppressor Several mouse models of cancer are exacerbated by a single allele deletion of Pparg, including a model of thyroid cancer that is unrelated to PPFP (Kato, et al. Oncogene 25:2736, 2006). Hypothesis: PPFP is oncogenic because it inhibits the tumor suppressor activity of PPAR.
11 Outline of today s presentation Background PPFP carcinoma patient samples Mouse model of PPFP thyroid carcinoma PPFP cell lines Summary and conclusions
12 Gene expression signature of PPFP follicular thyroid cancers FC(+) FC(-) NT FA OA OC PC AC MC Thomas Giordano, MD, PhD Giordano TG, et al. Clin Cancer Res. 12: , 2006
13 Gene expression signature of PPFP follicular thyroid cancers. FC(+) FC(-) NT FA OA OC PC AC MC AQP7 ANGPTL4 Giordano TG, et al. Clin Cancer Res. 12: , 2006.
14 PPFP has PPAR -like activity on the AQP7 promoter. AQP7-Luc -Cz +Cz JEG N2a Fold Luc/Rluc Activity FRTL Dog thyrocytes pcdna PAX8 PPAR PPFP pcdna PAX8 PPAR PPFP Giordano TG, et al. Clin Cancer Res. 12: , 2006.
15 Outline of today s presentation Background PPFP carcinoma patient samples Mouse model of PPFP thyroid carcinoma PPFP cell lines Summary and conclusions
16 Thyroidal expression of PPFP in transgenic mice Ericka Diallo-Krou Melissa Dobson, PhD CAG promoter intron LoxP egfp LoxP PPFP X TPO promoter Cre Dobson ME, et al. Endocrinology. 152: , 2011
17 Thyroidal expression of PPFP in transgenic mice CAG promoter intron LoxP egfp LoxP PPFP X TPO promoter Cre PPFP/PPAR PPFP;Cre mean±sd, n=14 Wild type PPFP;Cre Hyperplasia, No neoplasia Dobson ME, et al. Endocrinology. 152: , 2011
18 FTC pakt
19 FTC pakt
20 PPFP carcinomas have increased phosphoakt pakt(s473) Immunohistochemistry Normal human thyroid PPFP cancer Diallo-Krou E, et al. Endocrinology. 150: , 2009
21 PPFP carcinomas have increased phosphoakt pakt(s473) Immunohistochemistry Normal human thyroid PPFP cancer Combined PPFP expression with thyroidspecific Pten deletion: PPFP;PtenFF;Cre Control mice Pten deletion: PtenFF;Cre. Mouse Thyroid AKT immunoblot pakt(t308) pakt(s473) Total AKT -actin
22 Mouse thyroid glands Wild type PtenFF;Cre PPFP;PtenFF;Cre Dobson ME, et al. Endocrinology. 152: , 2011
23 PPFP;PtenFF;Cre mice develop metastatic thyroid carcinoma Tracheal Invasion H&E Myc (PPFP) TTF-1 Vascular Invasion Lung Metastases H&E Myc (PPFP) TTF-1 PAX8 (PtenFF;Cre mice have benign thyroid hyperplasia with no neoplasia). Dobson ME, et al. Endocrinology. 152: , 2011
24 Pioglitazone therapy of PPFP;PtenFF;Cre thyroid cancer Thyroid Area (mm 2 ) Thyroid size by ultrasound PPFP;PtenFF;Cre Control Diet Pioglitazone PtenFF;Cre 4-2- Start End 0- Start End WT thyroid area 1.9±0.5 mm 2 Dobson ME, et al. Endocrinology. 152: , 2011
25 Pioglitazone therapy of PPFP;PtenFF;Cre thyroid cancer. Thyroid Area (mm 2 ) Thyroid size by ultrasound PPFP;PtenFF;Cre Control Diet Pioglitazone PtenFF;Cre 4-2- Start End 0- Start End Pioglitazone prevents local invasion and metastases in PPFP;PtenFF;Cre mice N Local invasion Vascular invasion Distant mets Control diet Pioglitazone P (Neither invasion nor metastases were found in any PtenFF;Cre mice) WT thyroid area 1.9±0.5 mm 2 Dobson ME, et al. Endocrinology. 152: , 2011.
26 Adipogenic PPAR -like response to pioglitazone in PPFP;PtenFF;Cre thyroids PtenFF;Cre Control Diet Pioglitazone PPFP; PtenFF;Cre 100 Lipid droplets Dobson ME, et al. Endocrinology. 152: , 2011
27 Adipogenic PPAR -like response to pioglitazone in PPFP;PtenFF;Cre thyroids PtenFF;Cre Control Diet Pioglitazone PPFP;PtenFF;Cre +Pio Oil Red O Perilipin-1 PPFP; PtenFF;Cre 100 Lipid droplets Dobson ME, et al. Endocrinology. 152: , 2011
28 Adipogenic PPAR -like response to pioglitazone in PPFP;PtenFF;Cre thyroids PtenFF;Cre Control Diet Pioglitazone PPFP;PtenFF;Cre +Pio Oil Red O Perilipin-1 Thyroid PPFP;PtenFF;Cre Thyroid MRI Control Pioglitazone Thyroid PPFP; PtenFF;Cre 100 Lipid droplets Thyroid 40 % Fat 0 Thyroid Dobson ME, et al. Endocrinology. 152: , 2011
29 Adipogenic PPAR -like response to pioglitazone in PPFP;PtenFF;Cre thyroids PtenFF;Cre Control Diet Pioglitazone PPFP;PtenFF;Cre +Pio Oil Red O Perilipin-1 Thyroid PPFP;PtenFF;Cre Thyroid MRI Control Pioglitazone Thyroid PPFP; PtenFF;Cre 100 Lipid droplets Thyroid 40 % Fat 0 Thyroid Adipocyte PPAR target genes induced PPFP;PtenFF;Cre +Pio/-Pio PtenFF;Cre +Pio/-Pio 17/17 3/17 Dobson ME, et al. Endocrinology. 152: , 2011
30 Adipogenic PPAR -like response to pioglitazone in PPFP;PtenFF;Cre thyroids PtenFF;Cre PPFP; PtenFF;Cre Control Diet Adipocyte PPAR target genes induced Pioglitazone 100 PPFP;PtenFF;Cre +Pio/-Pio Lipid droplets PtenFF;Cre +Pio/-Pio 17/17 3/17 PPFP;PtenFF;Cre +Pio Oil Red O Perilipin-1 Thyroid Thyroid Myc (PPFP) PPFP;PtenFF;Cre Thyroid MRI Control Pioglitazone TTF-1 Thyroid 40 % Fat Thyroid Dobson ME, et al. Endocrinology. 152: , 2011
31 Adipogenic PPAR -like response to pioglitazone in PPFP;PtenFF;Cre thyroids PtenFF;Cre PPFP; PtenFF;Cre Control Diet Adipocyte PPAR target genes induced Pioglitazone 100 PPFP;PtenFF;Cre +Pio/-Pio Lipid droplets PtenFF;Cre +Pio/-Pio 17/17 3/17 PPFP;PtenFF;Cre +Pio Oil Red O Perilipin-1 Thyroid Thyroid Myc (PPFP) PPFP;PtenFF;Cre Thyroid MRI Control Pioglitazone TTF-1 Thyroid 40 % Fat Thyroid Hypothesis: The therapeutic activity of pioglitazone in PPFP carcinomas is due to differentiation into adipocyte-like cells. Dobson ME, et al. Endocrinology. 152: , 2011
32 Adipogenic PPARγ-like response to pioglitazone in PPFP;PtenFF;Cre thyroids Adipoq Angptl4 Log 2 RNA Expression/Pgk1 Aqp7 Fabp4 Cebpa Plin1 PPFP; PtenFF;Cre PtenFF;Cre Control Diet Fabp4 Pioglitzaone 100 PtenFF;Cre CD Pio PPFP;PtenFF;Cre CD Pio PtenFF;Cre CD Pio PPFP;PtenFF;Cre CD Pio Dobson ME, et al. Endocrinology. 152: , 2011
33 Ratios of gene expression by genotype and Pio treatment GENE PtenFF;Cre Pio/CD PPFP;PtenFF;Cre / PtenFF;Cre (CD) PPFP;PtenFF;Cre / PtenFF;Cre (Pio) PPFP;PtenFF;Cre Pio/CD Adipoq Agpat Angptl Aqp Cd Cebpa Cidec Dgat Fabp Fasn Glut Gpd Lipe Lpl Pck Pdk Plin P<.05 Newman-Keuls test; Pio or PPFP induces gene P<.05 Newman-Keuls test; Pio or PPFP represses gene
34 NCT : Pioglitazone therapy of PPFP thyroid carcinomas Multi-site clinical trial. Local or metastatic disease not amenable to therapy with surgery or RAI. We screen archival tumor blocks from patients with FVPTC or FTC for the PAX8- PPAR translocation. Pioglitazone has very low toxicity; please consider referring patients to our trial!
35 Outline of today s presentation Background PPFP carcinoma patient samples Mouse model of PPFP thyroid carcinoma PPFP cell lines Summary and conclusions
36 PPFP increases cell invasiveness and anchorage-independent growth. PCCL3 thyroid cells stably expressing PPFP or DBD mutant AAA Dang Vu-Phan, PhD Colony formation in soft agar Colonies/5000 cells EV PPFP AAA Invading cells/5000 Invasion through Matrigel EV PPFP AAA Vu-Phan D, et al. Endocr Relat Cancer. 20:725-39, 2013.
37 The Connectivity Map (CMAP) CMAP is a collection of genome-wide transcriptional expression data from cultured human cells treated with bioactive small molecules, combined with pattern-matching algorithms that together enable the discovery of functional connections between drugs, genes and diseases.
38 CMAP connects PPFP with Wnt The PPFP gene signature was analyzed in CMAP. 70 bioactive small molecules elicited gene expression changes that were enriched for PPFP profile genes. 16 of those 70 have been reported to be Wnt pathway modulators.
39 Wnt signaling overview Niehrs C. Nature Reviews Molecular Cell Biology (2012) 13:767.
40 Wnt/Tcf pathway Anastas JN and Moon RT. Nat Rev Cancer. 13:11-26, 2013
41 PPFP induces a subpopulation of Wnt/TCF-activated cells Vu-Phan D, et al. Endocr Relat Cancer. 20:725-39, 2013
42 PPFP induces a subpopulation of Wnt/TCF-activated cells And pioglitazone further increases the GFP+ subpopulation Vu-Phan D, et al. Endocr Relat Cancer. 20:725-39, 2013
43 TCF_GFP+ and TCF_GFP cells are hierarchically organized TCF_GFP cells beget TCF_GFP cells TCF_GFP+ cells beget TCF_GFP+ and cells TCF_GFP (left) and TCF_GFP+ (right) cells were sorted by FACS, expanded in culture, and reanalyzed for GFP status. Vu-Phan D, et al. Endocr Relat Cancer. 20:725-39, 2013
44 TCF_GFP+ cells are enriched in colony formation and invasiveness Vu-Phan D, et al. Endocr Relat Cancer. 20:725-39, 2013
45 Wnt/TCF-responsive genes are induced in a mouse model of PPFP thyroid carcinoma Vu-Phan D, et al. Endocr Relat Cancer. 20:725-39, 2013
46 Summary and conclusions.1 PPFP is found in FTCs and FVPTCs. PPFP can antagonize PPAR or can be PPAR -like, depending on context. In a mouse model of PPFP thyroid cancer, the PPAR agonist pioglitazone is highly therapeutic and is pro-adipogenic. We have begun a clinical trial of pioglitazone in patients with PPFP thyroid carcinomas.
47 Summary and conclusions.2 PPFP expression enhances the ability of PCCL3 thyroid cells to invade through Matrigel and to have anchorage independent growth. These actions require an intact PPAR DBD within PPFP.
48 Summary and conclusions.3 PPFP induces a subpopulation of Wnt/TCF activated cells. The PPFP-induced TCF+ population is enriched in colony forming and invading cells. The PPFP cells are hierarchically organized by TCF status. Based upon this, we hypothesize that the TCF+ fraction harbors PPFP thyroid cancer stem cells.
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR ChIP-PCR was performed on PPARγ and RXR-enriched chromatin harvested during adipocyte differentiation at day and day 6 as described
Supporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
SUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
Oncogenes/Growth Factors & Environment
Oncogenes/Growth Factors & Environment 8 th Postgraduate Course in Endocrine Surgery Crete, Greece September, 2006 Orlo H. Clark M.D. Thyroid Cancer Thyroid cancer is the 8 th most common and most rapidly
THYROID TUMOR DIAGNOSIS: MARKER OF THE MONTH CLUB
THYROID TUMOR DIAGNOSIS: MARKER OF THE MONTH CLUB CHARACTERISTIC OF THE IDEAL TUMOR MARKER Specific Sensitive Easy to perform Easy to interpret Adaptable to FNA Reasonable cost (CHEAP) THYROID TUMOR MARKERS
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
Problem Set 8 Key 1 of 8
7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients
Supplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs.
Supplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs. (a) CNA analysis of expression microarray data obtained from 15 tumors in the SV40Tag
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
Activation of cellular proto-oncogenes to oncogenes. How was active Ras identified?
Dominant Acting Oncogenes Eugene E. Marcantonio, M.D. Ph.D. Oncogenes are altered forms of normal cellular genes called proto-oncogenes that are involved in pathways regulating cell growth, differentiation,
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Thyroid Nodules. Dr. HAKIMI, SpAK Dr. MELDA DELIANA, SpAK Dr. SISKA MAYASARI LUBIS, SpA
Thyroid Nodules ENDOCRINOLOGY DIVISION ENDOCRINOLOGY DIVISION Dr. HAKIMI, SpAK Dr. MELDA DELIANA, SpAK Dr. SISKA MAYASARI LUBIS, SpA Anatomical Considerations The Thyroid Nodule Congenital anomalies Thyroglossal
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
Evaluation and Management of Thyroid Nodules. Nick Vernetti, MD, FACE Palm Medical Group Las Vegas, Nevada
Evaluation and Management of Thyroid Nodules Nick Vernetti, MD, FACE Palm Medical Group Las Vegas, Nevada Disclosure Consulting Amgen Speaking Amgen Objectives Understand the significance of incidental
Neoplasia 18 lecture 6. Dr Heyam Awad MD, FRCPath
Neoplasia 18 lecture 6 Dr Heyam Awad MD, FRCPath ILOS 1. understand the role of TGF beta, contact inhibition and APC in tumorigenesis. 2. implement the above knowledge in understanding histopathology reports.
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital. NSW Health Pathology University of Sydney
Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital NSW Health Pathology University of Sydney Thyroid Cancer TC incidence rates in NSW Several subtypes - Papillary
Genomic binding of PAX8-PPARG fusion protein regulates cancer-related pathways and alters the immune landscape of thyroid cancer
/, 2017, Vol. 8, (No. 4), pp: 5761-5773 Genomic binding of PAX8-PPARG fusion protein regulates cancer-related pathways and alters the immune landscape of thyroid cancer Yanxiao Zhang 1,4, Jingcheng Yu
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
The Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
CANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)
CANCER Affects 25% of US population Kills 19% of US population (2nd largest killer after heart disease) NOT one disease but 200-300 different defects Etiologic Factors In Cancer: Relative contributions
Neoplasia part I. Dr. Mohsen Dashti. Clinical Medicine & Pathology nd Lecture
Neoplasia part I By Dr. Mohsen Dashti Clinical Medicine & Pathology 316 2 nd Lecture Lecture outline Review of structure & function. Basic definitions. Classification of neoplasms. Morphologic features.
Supplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
BIOL2005 WORKSHEET 2008
BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your
The role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
Dynamic Risk Stratification:
Dynamic Risk Stratification: Using Risk Estimates to Guide Initial Management R Michael Tuttle, MD Clinical Director, Endocrinology Service Memorial Sloan Kettering Cancer Center Professor of Medicine
AP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
Cancer Genetics. What is Cancer? Cancer Classification. Medical Genetics. Uncontrolled growth of cells. Not all tumors are cancerous
Session8 Medical Genetics Cancer Genetics J avad Jamshidi F a s a U n i v e r s i t y o f M e d i c a l S c i e n c e s, N o v e m b e r 2 0 1 7 What is Cancer? Uncontrolled growth of cells Not all tumors
Chapter 11 Gene Expression
Chapter 11 Gene Expression 11-1 Control of Gene Expression Gene Expression- the activation of a gene to form a protein -a gene is on or expressed when it is transcribed. -cells do not always need to produce
TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer
AD Award Number: W81XWH-04-1-0325 TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer PRINCIPAL INVESTIGATOR: Valerie Boka CONTRACTING ORGANIZATION: University of Texas Health Science
Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
Introduction to Cancer Biology
Introduction to Cancer Biology Robin Hesketh Multiple choice questions (choose the one correct answer from the five choices) Which ONE of the following is a tumour suppressor? a. AKT b. APC c. BCL2 d.
Clinical and Molecular Approach to Using Thyroid Needle Biopsy for Nodular Disease
Clinical and Molecular Approach to Using Thyroid Needle Biopsy for Nodular Disease Robert L. Ferris, MD, PhD Department of Otolaryngology/Head and Neck Surgery and Yuri E. Nikiforov, MD, PhD Division of
Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids
Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
Genotype analysis by Southern blots of nine independent recombinated ES cell clones by
Supplemental Figure 1 Selected ES cell clones show a correctly recombined conditional Ngn3 allele Genotype analysis by Southern blots of nine independent recombinated ES cell clones by hybridization with
Review Article The Role of the PAX8/PPARγ Fusion Oncogene in Thyroid Cancer
PPAR Research Volume 2008, Article ID 672829, 10 pages doi:10.1155/2008/672829 Review Article The Role of the PAX8/PPARγ Fusion Oncogene in Thyroid Cancer Kimberly A. Placzkowski, 1 Honey V. Reddi, 1 Stefan
Reviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): In this study the authors analysed 18 deep penetrating nevi for oncogenic genomic changes (single nucleotide variations, insertions/deletions,
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach
Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach NM23-M1 "knock- out" mice (without NDPK A) Experimental models of hepatocarcinogenesis Chemical
Nuclear Receptors. Estrogen and Thyroid Hormone Receptors and their Interaction. Estrogen Hormone Receptor.
SZENT ISTVÁN UNIVERSITY FACULTY OF VETERINARY MEDICINE Nuclear Receptors Estrogen and Thyroid Hormone Receptors and their Interaction Lior Kerner Budapest, 2012 What are Nuclear Receptors? o Proteins located
Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice
Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice Shen Yon Toh 1,2,3., Jingyi Gong 2., Guoli Du 2., John
Dilemmas in Cytopathology and Histopathology
Dilemmas in Cytopathology and Histopathology Yuri E. Nikiforov, MD, PhD Division of Molecular & Genomic Pathology University of Pittsburgh Medical Center, USA Objectives Discuss new WHO classification
BIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
PPARγ is a Major Driver of the Accumulation and Phenotype of Adipose-Tissue \(T_{reg}\) Cells
PPARγ is a Major Driver of the Accumulation and Phenotype of Adipose-Tissue \(T_{reg}\) Cells The Harvard community has made this article openly available. Please share how this access benefits you. Your
1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance. 13/10/2017 Sara Redaelli
Dott.ssa Sara Redaelli 13/10/2017 1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance Tumor Heterogeneity: Oncogenic Drivers in NSCLC The Promise of Genotype-Directed Therapy
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Examination of Mechanisms of Hepatotoxicity of Anti-diabetic PPARγ Agonists Using Applied Biosystems Rat Whole Genome Microarrays
Examination of Mechanisms of Hepatotoxicity of Anti-diabetic PPARγ Agonists Using Applied Biosystems Rat Whole Genome Microarrays Lu Zhang b, Lei Guo a, Leming Shi a, Weida Tong a, Yongming Sun b, Gary
Gerard M. Doherty, MD
Surgical Management of Differentiated Thyroid Cancer: Update on 2015 ATA Guidelines Gerard M. Doherty, MD Chair of Surgery Utley Professor of Surgery and Medicine Boston University Surgeon-in-Chief Boston
Delineation, Functional Validation, and Bioinformatic Evaluation of Gene Expression in Thyroid Follicular Carcinomas with the PAX8-PPARG Translocation
Delineation, Functional Validation, and Bioinformatic Evaluation of Gene Expression in Thyroid Follicular Carcinomas with the PAX8-PPARG Translocation Thomas J. Giordano, 1 AmyY.M. Au, 4 Rork Kuick, 2
Thyroid Cancer: When to Treat? MEGAN R. HAYMART, MD
Thyroid Cancer: When to Treat? MEGAN R. HAYMART, MD ASSOCIATE PROFESSOR OF MEDICINE UNIVERSITY OF MICHIGAN MICHIGAN AACE 2018 ANNUAL MEETING Thyroid Cancer: When Not to Treat? FOCUS WILL BE ON LOW-RISK
Regulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
Transgenic Mice and Genetargeting
Transgenic Mice and Genetargeting mice In Biomedical Science Techniques of transgenic and gene-targeting mice are indispensable for analyses of in vivo functions of particular genes and roles of their
THE FOLLICULAR VARIANT OF PAPILLARY THYROID CARCINOMA AND NIFTP
THE FOLLICULAR VARIANT OF PAPILLARY THYROID CARCINOMA AND NIFTP FOLLICULAR VARIANT OF PAPILLARY CARCINOMA HISTORICAL PERSPECTIVE FOLLICULAR VARIANT OF PAPILLARY CARCINOMA 1960 described by Dr. Stuart Lindsay
04/09/2018. Follicular Thyroid Tumors Updates in Classification & Practical Tips. Dissecting Indeterminants. In pursuit of the low grade malignancy
Follicular Thyroid Tumors Updates in Classification & Practical Tips Jennifer L. Hunt, MD, MEd Aubrey J. Hough Jr, MD, Endowed Professor of Pathology Chair of Pathology and Laboratory Medicine University
(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
Rossella Elisei. Department of Endocrinology, University Hospital, Pisa, Italy
Rossella Elisei Department of Endocrinology, University Hospital, Pisa, Italy THYROID CANCER IS RARE TUMOR AND REPRESENTS ONLY 3.8% OF ALL HUMAN TUMORS All human cancer Thyroid cancer MOST FREQUENT CANCER
Supplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
Neoplasia 2018 lecture 11. Dr H Awad FRCPath
Neoplasia 2018 lecture 11 Dr H Awad FRCPath Clinical aspects of neoplasia Tumors affect patients by: 1. their location 2. hormonal secretions 3. paraneoplastic syndromes 4. cachexia Tumor location Even
Combining molecular modelling with experiments: Sulfonylureas and glinides as new PPARγ agonists
Combining molecular modelling with experiments: Sulfonylureas and glinides as new PPARγ agonists Marco Scarsi Biozentrum - Swiss Institute of Bioinformatics Drug discovery and development 12-15 years of
MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
Fatty acid activated PPAR promotes tumorigenicity of prostate cancer cells by up regulating VEGF via PPAR responsive elements of the promoter.
University of Plymouth PEARL https://pearl.plymouth.ac.uk 01 University of Plymouth Research Outputs University of Plymouth Research Outputs 2016-02-23 Fatty acid activated PPAR promotes tumorigenicity
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
Early cell death (FGF) B No RunX transcription factor produced Yes No differentiation
Solution Key - Practice Questions Question 1 a) A recent publication has shown that the fat stem cells (FSC) can act as bone stem cells to repair cavities in the skull, when transplanted into immuno-compromised
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:
Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments: the 5' and 3' homology recombination arms and a fragment
Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A
Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual
Joshua Klopper, Madeleine Kane, Antonio Jimeno and Bryan Haugen
Joshua Klopper, Madeleine Kane, Antonio Jimeno and Bryan Haugen None Learning Objectives Understand the efficacy of long term bexarotene treatment for poorly differentiated thyroid cancer Understand the
p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
Supplemental Data Mutant p53 Gain of Function in Two Mouse Models of Li-Fraumeni Syndrome
Supplemental Data Mutant p53 Gain of Function in Two Mouse Models of Li-Fraumeni Syndrome S1 Kenneth P. Olive, David A. Tuveson, Zachary C. Ruhe, Bob Yin, Nicholas A. Willis, Roderick T. Bronson, Denise
What causes cancer? Physical factors (radiation, ionization) Chemical factors (carcinogens) Biological factors (virus, bacteria, parasite)
Oncogenes What causes cancer? Chemical factors (carcinogens) Physical factors (radiation, ionization) Biological factors (virus, bacteria, parasite) DNA Mutation or damage Oncogenes Tumor suppressor genes
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Inhibition of Gastric Cancer Invasion and Metastasis by PLA2G2A, a Novel β-catenin/tcf Target Gene
Supplementary Information Inhibition of Gastric Cancer Invasion and Metastasis by PLA2G2A, a Novel β-catenin/tcf Target Gene Kumaresan Ganesan, 1 Tatiana Ivanova, 1 Yonghui Wu, 1 Vikneswari Rajasegaran,
Cancer genetics
Cancer genetics General information about tumorogenesis. Cancer induced by viruses. The role of somatic mutations in cancer production. Oncogenes and Tumor Suppressor Genes (TSG). Hereditary cancer. 1
Biochemistry of Cancer and Tumor Markers
Biochemistry of Cancer and Tumor Markers The term cancer applies to a group of diseases in which cells grow abnormally and form a malignant tumor. It is a long term multistage genetic process. The first
Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
SUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
Case year old female presented with asymmetric enlargement of the left lobe of the thyroid
Case 4 22 year old female presented with asymmetric enlargement of the left lobe of the thyroid gland. No information available relative to a prior fine needle aspiration biopsy. A left lobectomy was performed.
Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)
Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer
Case 4 Diagnosis 2/21/2011 TGB
Case 4 22 year old female presented with asymmetric enlargement of the left lobe of the thyroid gland. No information available relative to a prior fine needle aspiration biopsy. A left lobectomy was performed.
Sezione di Endocrinologia e Medicina Interna Direttore: Prof. Ettore degli Uberti Dipartimento di Scienze Mediche Università degli Studi di Ferrara
Sezione di Endocrinologia e Medicina Interna Direttore: Prof. Ettore degli Uberti Dipartimento di Scienze Mediche Università degli Studi di Ferrara Endocrinology Overview of genetic markers Molecular markers
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
In search for obesogens. Ewa Szalowska BDS Amsterdam 2012
In search for obesogens Ewa Szalowska BDS Amsterdam 212 Obesogens-an environmental link to Obesogens (B. Blumberg 26)- a subset of endocrine disrupting chemicals (EDCs) that activate PPARγ obesity PPARγ
BIT 120. Copy of Cancer/HIV Lecture
BIT 120 Copy of Cancer/HIV Lecture Cancer DEFINITION Any abnormal growth of cells that has malignant potential i.e.. Leukemia Uncontrolled mitosis in WBC Genetic disease caused by an accumulation of mutations
Supplemental Figure 1. Quantification of proliferation in thyroid of WT, Ctns -/- and grafted
Supplemental Figure 1. Quantification of proliferation in thyroid of WT, Ctns -/- and grafted Ctns -/- mice. Cells immunolabeled for the proliferation marker (Ki-67) were counted in sections (n=3 WT, n=4
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
3/27/2017. Disclosure of Relevant Financial Relationships. Each year over 550,000 thyroid FNAs are performed in the U.S.!!! THYROID FNA: THE GOOD NEWS
Disclosure of Relevant Financial Relationships William C. Faquin, MD, PhD Director, Head and Neck Pathology Massachusetts Eye and Ear Massachusetts General Hospital Professor of Pathology Harvard Medical