MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

Transcription

1 Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum (FBS, BioWhittaker, Lonza,Verviers, Belgium), 1% L-glutamine (Gibco) and 1% penicillin/streptomycin (Gibco). MZ-CRC-1 and HEK293 cell lines were cultured in DMEM high medium containing 4.5 g/l of glucose, L-glutamine and pyruvate (Gibco), supplemented with 15% or 10% (for HEK293) FBS and 1% penicillin/streptomycin. All cells were maintained at 37 C and 5% CO 2 atmosphere. Cell lysates and Western blot analysis Cells were washed with ice-cold PBS and incubated with lysis buffer (m-per, Thermo Fisher Scientific, Rockford, IL, USA) containing protease (Thermo Fisher Scientific) and phosphatase (Thermo Fisher Scientific) inhibitors, for 30 min on ice. Cell lysates were collected by scraping and cleared by centrifugation at 14,000 rpm for 10 min in a pre-cooled (4 C) centrifuge. The following antibodies were used for Western blot: RET (H-300), RET (C-19), p-ret (Y1062) (Santa Cruz Biotechnology, Heidelberg, Germany); ERK, p-erk (Cell Signaling, Danvers, MA, USA) and actin (C4, MP Biomedicals, Illkirch, France). Secondary antibodies used were goat anti-rabbit IgG-HRP (Bio-Rad, Veenendaal, The Netherlands) and goat anti-mouse IgG-HRP (Bio-Rad). All the experiments were performed in duplicates RNA extraction and RT-PCR Cells were washed with PBS (Gibco) and RNA extraction was performed using the RNeasy mini kit (Qiagen, Venlo, The Netherlands). First strand cdna was originated using the Ready-To-Go You- Prime First-Strand Beads kit (GE Healthcare, Zeist, The Netherlands) according to the manufacturer s instructions. The following primers were used: RET forward (5 - CCGTGAAGATGCTGAAAGAG-3 ); RET reverse (5 -AGAGGCCGTCGTCATAAATC-3 );

2 GAPDH forward (5 -TGAAGGTCGGAGTCAACGGATTTGGT-3 ); GAPDH reverse (5 - GCAGAGATGATGACCCTTTTGGCTC -3 ). Supplemental Table 1. IC50 concentrations of the different tyrosine kinase inhibitors in different cell lines Cell-line Compound MTC-TT MZ-CRC TPC-1 Sunitinib μm μm μm Vandetanib μm μm μm Axitinib μm > 5 μm μm XL μm > 5 μm μm MTC-TT cells express a MEN2A mutation, MZ-CRC-1 cells express a MEN2B mutation, and TPC-1 cells express a RET/PTC rearrangement. Supplemental Table 2. Effect of DMSO on cell proliferation of MZ-CRC-1, MTC-TT and TPC-1 Cell proliferation Control (SD) 0 concentration (SD) Sign. MZ-CRC % (10.2%) 100% (7.0%) 0.35 (NS) MTC-TT 94.2% (18.4%) 100% (14.5%) 0.11 (NS) TPC % (10.4%) 100% (12.1%) 0.93 (NS) Control cells were grown without DMSO or inhibitors, cells in the 0 condition were grown without inhibitors but in the presence of 0.1% DMSO. Supplemental figure legends FIG. 1. Additional dose response curves for (A) MTC-TT cells treated with sunitinib, (B) MTC-TT cells treated with axitinib, (C) MZ-CRC-1 cells treated with sunitinib and (D) TPC-1 cells treated with axitinb. FIG. 2. (A) Dose response curves for HEK293 cell line incubated with different concentrations of XL184, vandetanib, sunitinib and axitinib. (B) Overview of the IC50 values (the concentration that

3 lead to 50% cell death) of the four tyrosine kinase inhibitors for MTC-TT, MZ-CRC-1 and TPC-1 cell lines. Error bars shown correspond to standard deviation. * Concentrations are above 5 M. FIG. 3. Effects of XL184 and vandetanib on RET mrna levels. (A) MTC-TT cells treated with IC50 concentration and 5 M of XL184 showed no effect on RET transcription levels. (B) MZ-CRC-1 cells treated with IC50 concentration and 5 M of vandetanib showed a decrease in RET transcription levels after prolonged exposure (5 days) to 5 M of this inhibitor. (C) Graphical representation of RET bands intensity after correction for GAPDH levels confirmed a reduction of RET mrna levels for MZ-CRC-1 cells after prolonged exposure to 5 M of vandetanib. MTC-TT cells express a MEN2A mutation (RET C634R) and MZ-CRC-1 cells express a MEN2B mutation (RET M918T). IC50 = concentration that leads to 50% cell death. GAPDH was used as an internal control.

4 Verbeek Supp. Fig1 A) C) B) D)

5 A) Verbeek Supp. Fig2 B)

6 Verbeek Supp. Fig3 A) MTC-TT treated with XL184 C) 2 days 5 days 0,6 C 0 IC50 max 0 IC50 max 0,5 Control RET GAPDH Expression levels 0,4 0,3 0,2 0,1 2d, 0 2d, IC50 2d, max 5d, 0 5d, IC50 5d, max B) MZ-CRC-1 treated with vandetanib 0 XL184 Vandetanib 2 days 5 days C 0 IC50 max 0 IC50 max RET GAPDH