What if you could help your team realise their health goals?

Size: px
Start display at page:

Download "What if you could help your team realise their health goals?"

Transcription

1 What if you could help your team realise their health goals? Realise Health Plans combine clinical data, lifestyle information and health coaching to help your employees understand their health and make lasting changes.

2 Health and wellbeing insights that your team can really work with Better health isn t only about managing ill health and treating disease it s about preventing it. But how do you inspire your employees to get a handle on their health? Realise Health Plans, delivered by LiveSmart, combine the best of digital technology with blood analysis and personal encouragement to give your employees health insights they can act on. They ll be able to see how they re doing, where their risks are and how they can improve, and they ll feel supported with one-to-one telephone coaching sessions that help them set realistic goals for living and working well every day. We ll fit in with you Online lifestyle assessment A heads-up on health risks We can send your employees blood-sample collecting kits at no additional cost. Or LiveSmart s nurses can come to you. It takes less than ten minutes per employee to collect their blood samples. If your employees work away from the office we can visit them where they are, or they can pop in to a LiveSmart-approved clinic. 1 Realise Health Plans harness the best of technology to give your employees a true picture of their health. Using online tools, the LiveSmart team will assess your employees nutrition, mental wellbeing and cognitive performance. Your employees can connect their wearable tech to add to the picture. Liver disease. Heart disease. Diabetes. Realise blood assessments can indicate everything from poor nutrition to the presence of chronic disease, depending on the number of health markers you choose to test against (6, 34 or 39). With a snapshot of their health to look at, your employees can clearly see where they need to improve things. From watching what they eat, to keeping up with that yoga class, to getting help from a GP. 1 There s an extra charge for office, home and clinic visits. Speak to your dedicated account manager or intermediary for more information.

3 Coaching to inspire change One view of employee health Next steps made simple We understand that habits are hard to change. That s why Realise Health Plans include three telephone coaching calls to encourage your employees to make the changes that matter. They ll get valuable help setting realistic health goals that they can stick to, and they ll feel motivated by seeing their achievements on their personal digital dashboard. Health coaching is provided by a Health and Care Professions Council (HCPC)- registered dietitian. Healthy employees are good for business. Realise Health Plans make it easier for you to picture what a healthy workforce could look like. Clearly track your overall business health score on your corporate dashboard through anonymous employee data. Use it to keep an eye on progress and inform the decisions you make about your wellbeing strategy. 2 LiveSmart make it easy for your employees to take their next steps to better health. They ll point the way to benefits such as discounted nutritional supplements, sports equipment and gym membership, plus any AXA PPP healthcare services they have access to. Every plan also includes one 24/7 digital Doctor@Hand GP appointment your employees can make use of. 3 Going from pre-diabetic to the normal range was absolutely amazing. I could not have believed in three months I could have achieved those results. 2 Available with plans for 50+ employees. 3 Doctor@Hand is delivered by Doctor Care Anywhere Telephone coaching has helped yo-yo dieter Jo change her lifestyle choices and achieve her health goals Jo Sims, AXA PPP healthcare employee, 2017

4 Choose your plan REALISE HEART REALISE PLUS REALISE PREMIUM Step 1 Assess Using responses to the online assessment, LiveSmart s experts will take a good look at your employees medical history, lifestyle information, brain function and cognitive function. If they ve got wearable tech 4, they can connect it to the Realise digital platform to give an even fuller picture of their health. Step 2 Analyse LiveSmart blood-sample collecting kits are free. Or, for an additional charge, LiveSmart s nurses can come to your offices on collection days that fit around your business, or visit your remote-workers where they re based. If it s more convenient, your employees can also visit a LiveSmart-approved clinic to have their blood sample collected. 6 blood tests 34 blood tests 39 blood tests Step 3 LiveSmart will create a report for each of your employees showing what their in-depth assessment has revealed. It ll highlight where they re doing well and pinpoint areas they can improve. If LiveSmart s experts have detected signs of any disease, or risks of conditions like high cholesterol, they ll make this clear. Review Report written by an HCPC-registered dietitian Report written by an HCPC-registered dietitian and a GMC-registered GP Step 4 Talk it through Your employees can set up a 50-minute telephone coaching session to talk through their results with a dietitian. They ll be able to discuss any immediate concerns or potential problems their analysis has revealed, and set some achievable health goals for sustainable change. Step 5 Support LiveSmart will point the way to other services and advice we offer here at AXA PPP healthcare to make it easy for your employees to realise their health goals. Step 6 Improve LiveSmart dietitians will inspire on-going change in your employees with two further telephone coaching sessions of 20 minutes each. Using motivational techniques and support, they ll help your employees make changes they can really stick with. 4 Compatible wearable technology includes Fitbit, Jawbone, Withings and Apple devices.

5 Take a look at what s tested Here s a list of the health markers Realise Health Plans check against. HEALTH MARKERS REALISE HEART 6 blood tests REALISE PLUS 34 blood tests REALISE PREMIUM 39 blood tests CARDIOVASCULAR Total Cholesterol, LDL Cholesterol, HDL Cholesterol, Cholesterol: HDL ratio, Triglycerides VITAMINS & MINERALS Vitamin D LIVER FUNCTION Alkaline Phosphatase (ALP), Alanine Aminotransferase (ALT) Aspartate Aminotransferase (AST), Gamma-glutamyl Transferase (GGT) Total Protein, Albumin, Bilirubin, Globulin KIDNEY FUNCTION Creatinine, Uric Acid, Urea, Albumin BONE HEALTH Calcium, Corrected Calcium, Alkaline Phosphatase BLOOD HEALTH Haemoglobin, HCT, Red Cell Count, RDW, Platelet Count, MPV, MCV, MCH Blood Type IMMUNE SYSTEM White Cell Count, Neutrophils, Lymphocytes, Monocytes, Eosinophils, Basophils INFLAMMATION CRP, Omega 6:3 Ratio METABOLIC HEALTH Hba1c (diabetes risk) Glucose (diabetes risk)** TSH (Thyroid Health) NUTRITION Fruit and veg consumption Meal composition Fat, salt and sugar intake Weight*, BMI* and waist circumference EXERCISE Steps Physical activity* Core, strength and resistance Resting heart rate* Blood pressure** LIFESTYLE Smoking Alcohol Sleep MENTAL HEALTH Memory/processing speed test Stress Mood MEDICAL HISTORY Family Personal TELEPHONE HEALTH COACHING WITH AN HCPC-REGISTERED DIETITIAN Over 3 months: Over 3 months: Over 3 months: 1x 50 mins 1x 50 mins 1x 50 mins 2x 20 mins 2x 20 mins 2x 20 mins *Extra data can be pulled from your employees wearable fitness trackers, if they use them. **Available with LiveSmart s on-site blood collection service only.

6 AXA PPP healthcare is working with LiveSmart, a company registered with the Care Quality Commission, to reinvent wellbeing and help prevent ill health. Realise Health Plans give us a real opportunity to tackle today s lifestyle-related problems and drive better employee health for businesses like yours. All LiveSmart dietitians are registered with the Health and Care Professions Council (HCPC), and all their GPs are registered with the General Medical Council (GMC). To find out more about Realise Health Plans, get in touch with your intermediary or AXA PPP healthcare account manager. They ll be delighted to help. AXA PPP healthcare, Phillips House, Crescent Road, Tunbridge Wells, Kent TN1 2PL. AXA PPP healthcare Limited. Registered Office: 5 Old Broad Street, London EC2N 1AD, United Kingdom. Registered in England No Authorised by the Prudential Regulation Authority and regulated by the Financial Conduct Authority and the Prudential Regulation Authority. AXA PPP healthcare We may record and/or monitor calls for quality assurance, training and as a record of our conversation. PB62280/01.18

Direct access to intelligent care for healthier muscles, joints and bones. Working Body Member guide

Direct access to intelligent care for healthier muscles, joints and bones. Working Body Member guide Direct access to intelligent care for healthier muscles, joints and bones Working Body Member guide October 2015 Helping you keep your muscles, joints and bones healthy Chances are you don t give your

More information

Fullerton Healthcare Screening Centres

Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday

More information

A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.

A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

M Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES

M Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES M Series Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES ABOUT MINMED We are a progressive medical group that enlarges organically by growing constantly,

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

COMMIT TO YOUR HEALTH. Your healthy future begins today.

COMMIT TO YOUR HEALTH. Your healthy future begins today. COMMIT TO YOUR HEALTH. Your healthy future begins today. HELLO, HEALTH. With our comprehensive Life Time Health membership, reaching your healthiest potential is assured with a plan created exclusively

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

Research Data Available

Research Data Available Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family

More information

For so much more than a check on your health

For so much more than a check on your health Health assessments For so much more than a check on your health For Living Devote some time to the most important thing you have. Your health You don't need Bupa health insurance health assessments are

More information

Health Screening for Nanyang Technological University (NTU)

Health Screening for Nanyang Technological University (NTU) Health Screening for Nanyang Technological University (NTU) Health screening packages are offered at corporate rates to NTU staff and dependents at the indicated clinics. Please refer to this document

More information

Get to know yourself better. Attend our health screening event.

Get to know yourself better. Attend our health screening event. Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening

More information

Hop on The Right Track

Hop on The Right Track Hop on The Right Track Know yourself - for once we know ourselves, we may learn how to care for ourselves. Socrates HealthConnexion, a new health screening and preventive medicine initiative offers customised

More information

With you for the journey

With you for the journey With you for the journey not just for the assessment With you every step of the way Score Score s Every journey begins with the first step The first movement FORWARD in the direction you want to travel

More information

For dental insurance. that makes life easier for my people. For Living

For dental insurance. that makes life easier for my people. For Living For dental insurance that makes life easier for my people For Living New for 2018 2 Bupa dental insurance Contents 4 Why choose Bupa dental insurance? 6 Bupa Dental Plan 8 Bupa Dental Choice 10 Combining

More information

Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest

Total Cholesterol A Type of Fat. LDL Bad Cholesterol. HDL Good Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely

More information

With you for the journey

With you for the journey With you for the journey not just for the assessment With you every step of the way Expert s Every journey begins with the first step The first movement FORWARD in the direction you want to travel Not

More information

Responsibilities for diabetes care. What care to expect and how to prepare for a consultation?

Responsibilities for diabetes care. What care to expect and how to prepare for a consultation? Responsibilities for diabetes care. What care to expect and how to prepare for a consultation? People with diabetes should expect to get the best of care to keep them in good health. In order to do this,

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Best practices for a successful wellness screening program

Best practices for a successful wellness screening program Health & Wellness Best practices for a successful wellness screening program Identify risk. Increase engagement. Incite change. Identifying health risks in your employee population People at risk for chronic

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This

More information

Health First. New Health Bucks Program MANATEE YOURCHOICE HEALTH PLAN

Health First. New Health Bucks Program MANATEE YOURCHOICE HEALTH PLAN Health First New Health Bucks Program MANATEE YOURCHOICE HEALTH PLAN www.manateeyourchoice.com/healthfirst A special thanks to Aetna for covering the printing costs of this booklet. CONTENTS OUR PURPOSE

More information

Food & Fitness: Small Steps to Great Health

Food & Fitness: Small Steps to Great Health Food & Fitness: Small Steps to Great Health Cheryl Miller, M.A., M.S. Exercise Physiology & Community Health HealthQuest cheryl.miller@khpa.ks.gov www.khpa.ks.gov/healthquest/ Self-Leadership You, the

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

Get to know yourself better. Attend our health screening event.

Get to know yourself better. Attend our health screening event. Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION

More information

Senior Executive Wellness Profile

Senior Executive Wellness Profile Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,

More information

DIABETES AND LABORATORY TESTS. Author: Josephine Davis

DIABETES AND LABORATORY TESTS. Author: Josephine Davis DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Weight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

Weight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of

More information

Weight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL

Weight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of

More information

Multiphasic Blood Analysis

Multiphasic Blood Analysis Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

Welcome to Wellivo Global

Welcome to Wellivo Global Welcome to Wellivo Global Wellivo Global is established with the noble vision of financial freedom for the masses. We have clear cognizance of this goal from its very inception. Our aim is to provide a

More information

Pre-Diabetes Treatment Packages

Pre-Diabetes Treatment Packages Pre-Diabetes Treatment Packages Price List - Valid to end September 2018 Type II Diabetes is a serious life-limiting disease which lowers both quality of life and life expectancy. It is a lifestyle disease

More information

Smartphone Apps for Diabetes Management

Smartphone Apps for Diabetes Management Smartphone Apps for Diabetes Management By David Kerr, MD; Charis Hoppe; and Ceara AxelrodMarch 2017 There s an app for pretty much everything these days reading magazines (Diabetes Forecast has its own!),

More information

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr. 5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:

More information

QUALITY HEALTHCARE MEN'S PHYSICAL CHECK-UP ELIGIBLE TO EARN ASIA MILES

QUALITY HEALTHCARE MEN'S PHYSICAL CHECK-UP ELIGIBLE TO EARN ASIA MILES Detailed Medical History Physical Examination Visual Acuity Body Mass Index & Waist Circumference Package name: PLATINUM EXECUTIVE PREMIUM ELITE CS Code CN72 CN70 CN68 CN66 Screening Purpose Package Price

More information

Wellness Screening and Questionnaire

Wellness Screening and Questionnaire Wellness Screening and Questionnaire healthyliving.pepsico.com Questions? Call 1-855-PEP-1117 8am 9pm Eastern Time Monday Friday 2017 Wellness Screening and Questionnaire It s Good to Know Work, school,

More information

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such

More information

Keeping your diabetes support as mobile as you are,

Keeping your diabetes support as mobile as you are, Millions of people have diabetes. But we at Novo Nordisk know that managing diabetes is a personal journey. That is why we created the e-book Your guide to better office visits, with valuable insights

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Janis Baines Section Manager, Food Data Analysis, Food Standards Australia New Zealand. Paul Atyeo Assistant Director, ABS Health Section

Janis Baines Section Manager, Food Data Analysis, Food Standards Australia New Zealand. Paul Atyeo Assistant Director, ABS Health Section ILSI SEAR Australasia March 2015 Nutrition information from the Australian Health Survey Background and selected results Janis Baines Section Manager, Food Data Analysis, Food Standards Australia New Zealand

More information

Welcome You have the power to improve your healthcare costs! The City of Cocoa Beach has partnered with Bravo, a company that works with employers lik

Welcome You have the power to improve your healthcare costs! The City of Cocoa Beach has partnered with Bravo, a company that works with employers lik 2017 BravoWell Program Welcome You have the power to improve your healthcare costs! The City of Cocoa Beach has partnered with Bravo, a company that works with employers like yours to administer engaging

More information

Your Guide to Managing and Understanding Your Cholesterol Levels

Your Guide to Managing and Understanding Your Cholesterol Levels Your Guide to Managing and Understanding Your Cholesterol Levels Our goal at Bon Secours is to help you be well. Our experienced Heart Team includes cardiologists, cardiovascular surgeons, electrophysiologists,

More information

Understanding your blood results:

Understanding your blood results: Understanding your blood results: Contents Introduction... 1 Haematology... 2 Biochemistry... 3 MB - 'Electrolytes' (Sodium, Potassium, Chloride, Bicarbonate):... 3 MB - Kidney parameters... 4 MB - Liver

More information

Blood Test Results Report

Blood Test Results Report Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

ROUTINE LAB STUDIES. Routine Clinic Lab Studies

ROUTINE LAB STUDIES. Routine Clinic Lab Studies ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not

More information

Living well today...32 Hope for tomorrow...32

Living well today...32 Hope for tomorrow...32 managing diabetes managing managing managing managing managing managing diabetes Scientific research continually increases our knowledge of diabetes and the tools to treat it. This chapter describes what

More information

Achieve Your Best Health

Achieve Your Best Health Achieve Your Best Health for Metabolic Health paisc.com What is health coaching? Health coaching is a voluntary program for members diagnosed with certain health conditions. We take a personalized and

More information

The Journey towards Total Wellbeing A Health System s Innovative Approach

The Journey towards Total Wellbeing A Health System s Innovative Approach The Journey towards Total Wellbeing A Health System s Innovative Approach Company Profile Wellness A state of complete physical, mental and social wellbeing and not merely the absence of disease or infirmity

More information

Personal Diabetes Passport

Personal Diabetes Passport Personal Diabetes Passport Contact information: Name: Physician: Diabetes Education Centre: Dietitian: Ophthalmologist: Chiropodist: Type of Diabetes: Type 1 (T1DM) Increased risk for diabetes Type 2(T2DM)

More information

A VIDEO SERIES. living WELL. with kidney failure HOW KIDNEY FAILURE AFFECTS YOUR BODY

A VIDEO SERIES. living WELL. with kidney failure HOW KIDNEY FAILURE AFFECTS YOUR BODY A VIDEO SERIES living WELL with kidney failure HOW KIDNEY FAILURE AFFECTS YOUR BODY Contents 2 Introduction 3 What will I learn? 4 How does kidney failure affect my body? 5 How can I protect my heart

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

A Creative, Community Wellness Program

A Creative, Community Wellness Program A Creative, Community Wellness Program Did You Know Today the adults in the U.S. Over 66% of adults are obese or overweight Medical costs for obese adults is 77% higher than a healthy adult 55% do not

More information

Annual Report and. Business Plan Summary. Greater Manchester Health and Social Care Partnership

Annual Report and. Business Plan Summary. Greater Manchester Health and Social Care Partnership Annual Report and Business Plan Summary 2016-17 2017-18 Greater Manchester Health and Social Care Partnership Our first year and beyond In April 2016, devolution gave Greater Manchester control of its

More information

HEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE

HEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE HEALTH SCREEN CARE VIGNE Healthcare provides a comprehensive Health Screening Package of Silver Gold Platinum Cancer EXCLUSIVE HEALTH SCREENING EXPERIENCE Meet & Greet Medical Review with Doctor Appointment

More information

BUPA ADVANCED HEALTH OUR MOST DETAILED HEALTH AND FITNESS ASSESSMENT

BUPA ADVANCED HEALTH OUR MOST DETAILED HEALTH AND FITNESS ASSESSMENT BUPA ADVANCED HEALTH OUR MOST DETAILED HEALTH AND FITNESS ASSESSMENT bupa.co.uk BUPA ADVANCED HEALTH CREATING A DETAILED PICTURE OF YOUR HEALTH Combining an in-depth profile of your overall health with

More information

Bupa Complete Health

Bupa Complete Health Bupa Complete Health The in-depth health and wellbeing assessment Bupa Complete Health The in-depth health and wellbeing assessment Introducing Bupa Introducing Bupa Complete Health Complete Health created

More information

PRACTICE WHAT WE PREACH

PRACTICE WHAT WE PREACH PRACTICE WHAT WE PREACH Sioned Quirke Professional Manager Adult Weight Management Service, ABUHB & Lead Specialist Dietitian in obesity management WELSH HEALTH SURVEY WAG 2012 59% of adults were classified

More information

WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL

WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

* * Interpretation

* * Interpretation LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)

More information

Annual Max. Point Value. Program Activity STEP 1: KNOW YOUR NUMBERS

Annual Max. Point Value. Program Activity STEP 1: KNOW YOUR NUMBERS The City of Colorado Springs Reach Your Peak Wellness Program Year 10 3 Step Wellness Program November 1, 2013 October 31, 2014 Wellness Activities & Point Distribution Program Activity STEP 1: KNOW YOUR

More information

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522

More information

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0. LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

RICHMOND PARK SCHOOL LIFESTYLE SCREENING REPORT Carmarthenshire County Council

RICHMOND PARK SCHOOL LIFESTYLE SCREENING REPORT Carmarthenshire County Council RICHMOND PARK SCHOOL LIFESTYLE SCREENING REPORT 2016 Carmarthenshire County Council WHY LEAD A HEALTHY LIFESTYLE? A nutritious, well-balanced diet along with physical activity and refraining from smoking

More information

FIGHTING FAT A ROLE FOR FOOD RETAILERS

FIGHTING FAT A ROLE FOR FOOD RETAILERS FIGHTING FAT A ROLE FOR FOOD RETAILERS In January 2016, Oliver Wyman led a session at the World Economic Forum in Davos, Switzerland, entitled Sugar, obesity, and diabetes the other global food crisis.

More information

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

Lifestyle Health Assessment.

Lifestyle Health Assessment. Lifestyle Health Assessment. Nuffield Health. Specialists in you. Open the conversation. At Nuffield Health all our health assessments focus on preventative health. This means that we concentrate on informing

More information

The changes that patients make to their lifestyle, are as important a part of treatment as their medicines. 1

The changes that patients make to their lifestyle, are as important a part of treatment as their medicines. 1 Healthy lifestyle The changes that patients make to their lifestyle, are as important a part of treatment as their medicines. 1 However, making lifestyle changes can be hard for any of us. We know that

More information

The Blood Chemistry Panel Explained

The Blood Chemistry Panel Explained The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com

More information

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation

More information

AIDS and insurance. Information about the necessity of AIDS testing Implications of undergoing an AIDS test The choices available to you INSURANCE

AIDS and insurance. Information about the necessity of AIDS testing Implications of undergoing an AIDS test The choices available to you INSURANCE INSURANCE AIDS and insurance Information about the necessity of AIDS testing Implications of undergoing an AIDS test The choices available to you Please read carefully NSW and TAS only What is AIDS? AIDS

More information

Wellness is a state of complete harmony of BODY, MIND & SPIRIT

Wellness is a state of complete harmony of BODY, MIND & SPIRIT Wellness is a state of complete harmony of BODY, MIND & SPIRIT Index About Us Specialty Clinics Corporate Wellness Jehangir Silver & Gold Jehangir Platinum (Whole Body Screening) Jehangir Comprehensive

More information

WIN QUARTERLY UTILIZATION REPORT 7/1/2010 TO 12/31/2010. EXPERTISE PARTNERSHIP V A L U E April 20, 2011

WIN QUARTERLY UTILIZATION REPORT 7/1/2010 TO 12/31/2010. EXPERTISE PARTNERSHIP V A L U E April 20, 2011 WIN QUARTERLY UTILIZATION REPORT 7/1/2010 TO 12/31/2010 EXPERTISE PARTNERSHIP V A L U E April 20, 2011 T R E N D S A N A L Y S I S S T A T I S T I C S P L A N N I N G T O O L S Participation Mass Screening

More information

BC Biomedical Laboratories Adult Reference Ranges

BC Biomedical Laboratories Adult Reference Ranges BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100

More information

The Diabetes Prevention Program's Lifestyle Change Program. Participant Notebook

The Diabetes Prevention Program's Lifestyle Change Program. Participant Notebook The Diabetes Prevention Program's Lifestyle Change Program Participant Notebook The Diabetes Prevention Program's Lifestyle Change Program Your name: Your Lifestyle Coach is Address: Phone: Session 1A:

More information

Results Report. Welcome to Your ABT Report! Introduction to the ABT Report

Results Report. Welcome to Your ABT Report! Introduction to the ABT Report Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a

More information

Results Report. Welcome to Your ABT Report!

Results Report. Welcome to Your ABT Report! Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be

More information

Achieve Your Best Health

Achieve Your Best Health Achieve Your Best Health for High Cholesterol paisc.com What is health coaching? Health coaching is a voluntary program for members diagnosed with certain health conditions. We take a personalized and

More information

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar

More information

Education that supports your health and your life

Education that supports your health and your life Alberta Healthy Living Program Education that supports your health and your life Central Zone Winter 2018 Workshop Guide The Alberta Healthy Living Program (AHLP) offers free workshops and one-on-one sessions

More information

Rev. date Kaiser Foundation Health Plan of Washington

Rev. date Kaiser Foundation Health Plan of Washington PE3620000-01-17 Rev. date 2014013 2017 Kaiser Foundation Health Plan of Washington Gestational diabetes Information to help you stay healthy during your pregnancy What is gestational diabetes? How gestational

More information

Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor

Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene

More information

JUST DIAGNOSED WITH DIABETES?

JUST DIAGNOSED WITH DIABETES? JUST DIAGNOSED WITH DIABETES? Being told that you have diabetes can be a real shock. And learning to live with it can be a challenge. You might be going through all sorts of emotions. It s perfectly normal

More information

Your Partnership in Health Report: Chronic Conditions ABC Company and Kaiser Permanente

Your Partnership in Health Report: Chronic Conditions ABC Company and Kaiser Permanente Your Partnership in Health Report: s ABC Company and Kaiser Permanente Measurement Period: JUL-01-2012 through JUN-30-2013 Report Date: DEC-31-2013 Commercial All Members Partnership in Health (PIH) reports:

More information

Table of Contents. Early Identification Chart Biometric Screening Comprehensive Cardiovascular Disease Risk Assessment...

Table of Contents. Early Identification Chart Biometric Screening Comprehensive Cardiovascular Disease Risk Assessment... Public Safety Table of Contents Early Identification Chart... 1 Biometric Screening... 2 Comprehensive Cardiovascular Disease Risk Assessment.... 2 Recommended after Comprehensive Cardiovascular Disease

More information

360+ Health Assessment.

360+ Health Assessment. 360+ Health Assessment. Nuffield Health. Specialists in you. Open the conversation. At Nuffield Health all our health assessments focus on preventative health. This means that we concentrate on informing

More information

PERSONALIZED PREDICTIVE PREVENTIVE

PERSONALIZED PREDICTIVE PREVENTIVE PERSONALIZED PREDICTIVE PREVENTIVE What is healthy advice? 1984 What is healthy advice? T o d a y We re all different Dietary Advice Health Exercise Advice Don t eat fat Aim for 600iu of Vitamin D Your

More information