What if you could help your team realise their health goals?
|
|
- Kelley Briggs
- 5 years ago
- Views:
Transcription
1 What if you could help your team realise their health goals? Realise Health Plans combine clinical data, lifestyle information and health coaching to help your employees understand their health and make lasting changes.
2 Health and wellbeing insights that your team can really work with Better health isn t only about managing ill health and treating disease it s about preventing it. But how do you inspire your employees to get a handle on their health? Realise Health Plans, delivered by LiveSmart, combine the best of digital technology with blood analysis and personal encouragement to give your employees health insights they can act on. They ll be able to see how they re doing, where their risks are and how they can improve, and they ll feel supported with one-to-one telephone coaching sessions that help them set realistic goals for living and working well every day. We ll fit in with you Online lifestyle assessment A heads-up on health risks We can send your employees blood-sample collecting kits at no additional cost. Or LiveSmart s nurses can come to you. It takes less than ten minutes per employee to collect their blood samples. If your employees work away from the office we can visit them where they are, or they can pop in to a LiveSmart-approved clinic. 1 Realise Health Plans harness the best of technology to give your employees a true picture of their health. Using online tools, the LiveSmart team will assess your employees nutrition, mental wellbeing and cognitive performance. Your employees can connect their wearable tech to add to the picture. Liver disease. Heart disease. Diabetes. Realise blood assessments can indicate everything from poor nutrition to the presence of chronic disease, depending on the number of health markers you choose to test against (6, 34 or 39). With a snapshot of their health to look at, your employees can clearly see where they need to improve things. From watching what they eat, to keeping up with that yoga class, to getting help from a GP. 1 There s an extra charge for office, home and clinic visits. Speak to your dedicated account manager or intermediary for more information.
3 Coaching to inspire change One view of employee health Next steps made simple We understand that habits are hard to change. That s why Realise Health Plans include three telephone coaching calls to encourage your employees to make the changes that matter. They ll get valuable help setting realistic health goals that they can stick to, and they ll feel motivated by seeing their achievements on their personal digital dashboard. Health coaching is provided by a Health and Care Professions Council (HCPC)- registered dietitian. Healthy employees are good for business. Realise Health Plans make it easier for you to picture what a healthy workforce could look like. Clearly track your overall business health score on your corporate dashboard through anonymous employee data. Use it to keep an eye on progress and inform the decisions you make about your wellbeing strategy. 2 LiveSmart make it easy for your employees to take their next steps to better health. They ll point the way to benefits such as discounted nutritional supplements, sports equipment and gym membership, plus any AXA PPP healthcare services they have access to. Every plan also includes one 24/7 digital Doctor@Hand GP appointment your employees can make use of. 3 Going from pre-diabetic to the normal range was absolutely amazing. I could not have believed in three months I could have achieved those results. 2 Available with plans for 50+ employees. 3 Doctor@Hand is delivered by Doctor Care Anywhere Telephone coaching has helped yo-yo dieter Jo change her lifestyle choices and achieve her health goals Jo Sims, AXA PPP healthcare employee, 2017
4 Choose your plan REALISE HEART REALISE PLUS REALISE PREMIUM Step 1 Assess Using responses to the online assessment, LiveSmart s experts will take a good look at your employees medical history, lifestyle information, brain function and cognitive function. If they ve got wearable tech 4, they can connect it to the Realise digital platform to give an even fuller picture of their health. Step 2 Analyse LiveSmart blood-sample collecting kits are free. Or, for an additional charge, LiveSmart s nurses can come to your offices on collection days that fit around your business, or visit your remote-workers where they re based. If it s more convenient, your employees can also visit a LiveSmart-approved clinic to have their blood sample collected. 6 blood tests 34 blood tests 39 blood tests Step 3 LiveSmart will create a report for each of your employees showing what their in-depth assessment has revealed. It ll highlight where they re doing well and pinpoint areas they can improve. If LiveSmart s experts have detected signs of any disease, or risks of conditions like high cholesterol, they ll make this clear. Review Report written by an HCPC-registered dietitian Report written by an HCPC-registered dietitian and a GMC-registered GP Step 4 Talk it through Your employees can set up a 50-minute telephone coaching session to talk through their results with a dietitian. They ll be able to discuss any immediate concerns or potential problems their analysis has revealed, and set some achievable health goals for sustainable change. Step 5 Support LiveSmart will point the way to other services and advice we offer here at AXA PPP healthcare to make it easy for your employees to realise their health goals. Step 6 Improve LiveSmart dietitians will inspire on-going change in your employees with two further telephone coaching sessions of 20 minutes each. Using motivational techniques and support, they ll help your employees make changes they can really stick with. 4 Compatible wearable technology includes Fitbit, Jawbone, Withings and Apple devices.
5 Take a look at what s tested Here s a list of the health markers Realise Health Plans check against. HEALTH MARKERS REALISE HEART 6 blood tests REALISE PLUS 34 blood tests REALISE PREMIUM 39 blood tests CARDIOVASCULAR Total Cholesterol, LDL Cholesterol, HDL Cholesterol, Cholesterol: HDL ratio, Triglycerides VITAMINS & MINERALS Vitamin D LIVER FUNCTION Alkaline Phosphatase (ALP), Alanine Aminotransferase (ALT) Aspartate Aminotransferase (AST), Gamma-glutamyl Transferase (GGT) Total Protein, Albumin, Bilirubin, Globulin KIDNEY FUNCTION Creatinine, Uric Acid, Urea, Albumin BONE HEALTH Calcium, Corrected Calcium, Alkaline Phosphatase BLOOD HEALTH Haemoglobin, HCT, Red Cell Count, RDW, Platelet Count, MPV, MCV, MCH Blood Type IMMUNE SYSTEM White Cell Count, Neutrophils, Lymphocytes, Monocytes, Eosinophils, Basophils INFLAMMATION CRP, Omega 6:3 Ratio METABOLIC HEALTH Hba1c (diabetes risk) Glucose (diabetes risk)** TSH (Thyroid Health) NUTRITION Fruit and veg consumption Meal composition Fat, salt and sugar intake Weight*, BMI* and waist circumference EXERCISE Steps Physical activity* Core, strength and resistance Resting heart rate* Blood pressure** LIFESTYLE Smoking Alcohol Sleep MENTAL HEALTH Memory/processing speed test Stress Mood MEDICAL HISTORY Family Personal TELEPHONE HEALTH COACHING WITH AN HCPC-REGISTERED DIETITIAN Over 3 months: Over 3 months: Over 3 months: 1x 50 mins 1x 50 mins 1x 50 mins 2x 20 mins 2x 20 mins 2x 20 mins *Extra data can be pulled from your employees wearable fitness trackers, if they use them. **Available with LiveSmart s on-site blood collection service only.
6 AXA PPP healthcare is working with LiveSmart, a company registered with the Care Quality Commission, to reinvent wellbeing and help prevent ill health. Realise Health Plans give us a real opportunity to tackle today s lifestyle-related problems and drive better employee health for businesses like yours. All LiveSmart dietitians are registered with the Health and Care Professions Council (HCPC), and all their GPs are registered with the General Medical Council (GMC). To find out more about Realise Health Plans, get in touch with your intermediary or AXA PPP healthcare account manager. They ll be delighted to help. AXA PPP healthcare, Phillips House, Crescent Road, Tunbridge Wells, Kent TN1 2PL. AXA PPP healthcare Limited. Registered Office: 5 Old Broad Street, London EC2N 1AD, United Kingdom. Registered in England No Authorised by the Prudential Regulation Authority and regulated by the Financial Conduct Authority and the Prudential Regulation Authority. AXA PPP healthcare We may record and/or monitor calls for quality assurance, training and as a record of our conversation. PB62280/01.18
Direct access to intelligent care for healthier muscles, joints and bones. Working Body Member guide
Direct access to intelligent care for healthier muscles, joints and bones Working Body Member guide October 2015 Helping you keep your muscles, joints and bones healthy Chances are you don t give your
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More informationA test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.
Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationM Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES
M Series Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES ABOUT MINMED We are a progressive medical group that enlarges organically by growing constantly,
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationCOMMIT TO YOUR HEALTH. Your healthy future begins today.
COMMIT TO YOUR HEALTH. Your healthy future begins today. HELLO, HEALTH. With our comprehensive Life Time Health membership, reaching your healthiest potential is assured with a plan created exclusively
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationResearch Data Available
Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family
More informationFor so much more than a check on your health
Health assessments For so much more than a check on your health For Living Devote some time to the most important thing you have. Your health You don't need Bupa health insurance health assessments are
More informationHealth Screening for Nanyang Technological University (NTU)
Health Screening for Nanyang Technological University (NTU) Health screening packages are offered at corporate rates to NTU staff and dependents at the indicated clinics. Please refer to this document
More informationGet to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
More informationHop on The Right Track
Hop on The Right Track Know yourself - for once we know ourselves, we may learn how to care for ourselves. Socrates HealthConnexion, a new health screening and preventive medicine initiative offers customised
More informationWith you for the journey
With you for the journey not just for the assessment With you every step of the way Score Score s Every journey begins with the first step The first movement FORWARD in the direction you want to travel
More informationFor dental insurance. that makes life easier for my people. For Living
For dental insurance that makes life easier for my people For Living New for 2018 2 Bupa dental insurance Contents 4 Why choose Bupa dental insurance? 6 Bupa Dental Plan 8 Bupa Dental Choice 10 Combining
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationWith you for the journey
With you for the journey not just for the assessment With you every step of the way Expert s Every journey begins with the first step The first movement FORWARD in the direction you want to travel Not
More informationResponsibilities for diabetes care. What care to expect and how to prepare for a consultation?
Responsibilities for diabetes care. What care to expect and how to prepare for a consultation? People with diabetes should expect to get the best of care to keep them in good health. In order to do this,
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationBest practices for a successful wellness screening program
Health & Wellness Best practices for a successful wellness screening program Identify risk. Increase engagement. Incite change. Identifying health risks in your employee population People at risk for chronic
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More informationHealth First. New Health Bucks Program MANATEE YOURCHOICE HEALTH PLAN
Health First New Health Bucks Program MANATEE YOURCHOICE HEALTH PLAN www.manateeyourchoice.com/healthfirst A special thanks to Aetna for covering the printing costs of this booklet. CONTENTS OUR PURPOSE
More informationFood & Fitness: Small Steps to Great Health
Food & Fitness: Small Steps to Great Health Cheryl Miller, M.A., M.S. Exercise Physiology & Community Health HealthQuest cheryl.miller@khpa.ks.gov www.khpa.ks.gov/healthquest/ Self-Leadership You, the
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationGet to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationDIABETES AND LABORATORY TESTS. Author: Josephine Davis
DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationWeight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationWeight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationWelcome to Wellivo Global
Welcome to Wellivo Global Wellivo Global is established with the noble vision of financial freedom for the masses. We have clear cognizance of this goal from its very inception. Our aim is to provide a
More informationPre-Diabetes Treatment Packages
Pre-Diabetes Treatment Packages Price List - Valid to end September 2018 Type II Diabetes is a serious life-limiting disease which lowers both quality of life and life expectancy. It is a lifestyle disease
More informationSmartphone Apps for Diabetes Management
Smartphone Apps for Diabetes Management By David Kerr, MD; Charis Hoppe; and Ceara AxelrodMarch 2017 There s an app for pretty much everything these days reading magazines (Diabetes Forecast has its own!),
More informationEvaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.
5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:
More informationQUALITY HEALTHCARE MEN'S PHYSICAL CHECK-UP ELIGIBLE TO EARN ASIA MILES
Detailed Medical History Physical Examination Visual Acuity Body Mass Index & Waist Circumference Package name: PLATINUM EXECUTIVE PREMIUM ELITE CS Code CN72 CN70 CN68 CN66 Screening Purpose Package Price
More informationWellness Screening and Questionnaire
Wellness Screening and Questionnaire healthyliving.pepsico.com Questions? Call 1-855-PEP-1117 8am 9pm Eastern Time Monday Friday 2017 Wellness Screening and Questionnaire It s Good to Know Work, school,
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More informationKeeping your diabetes support as mobile as you are,
Millions of people have diabetes. But we at Novo Nordisk know that managing diabetes is a personal journey. That is why we created the e-book Your guide to better office visits, with valuable insights
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationJanis Baines Section Manager, Food Data Analysis, Food Standards Australia New Zealand. Paul Atyeo Assistant Director, ABS Health Section
ILSI SEAR Australasia March 2015 Nutrition information from the Australian Health Survey Background and selected results Janis Baines Section Manager, Food Data Analysis, Food Standards Australia New Zealand
More informationWelcome You have the power to improve your healthcare costs! The City of Cocoa Beach has partnered with Bravo, a company that works with employers lik
2017 BravoWell Program Welcome You have the power to improve your healthcare costs! The City of Cocoa Beach has partnered with Bravo, a company that works with employers like yours to administer engaging
More informationYour Guide to Managing and Understanding Your Cholesterol Levels
Your Guide to Managing and Understanding Your Cholesterol Levels Our goal at Bon Secours is to help you be well. Our experienced Heart Team includes cardiologists, cardiovascular surgeons, electrophysiologists,
More informationUnderstanding your blood results:
Understanding your blood results: Contents Introduction... 1 Haematology... 2 Biochemistry... 3 MB - 'Electrolytes' (Sodium, Potassium, Chloride, Bicarbonate):... 3 MB - Kidney parameters... 4 MB - Liver
More informationBlood Test Results Report
Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
More informationLiving well today...32 Hope for tomorrow...32
managing diabetes managing managing managing managing managing managing diabetes Scientific research continually increases our knowledge of diabetes and the tools to treat it. This chapter describes what
More informationAchieve Your Best Health
Achieve Your Best Health for Metabolic Health paisc.com What is health coaching? Health coaching is a voluntary program for members diagnosed with certain health conditions. We take a personalized and
More informationThe Journey towards Total Wellbeing A Health System s Innovative Approach
The Journey towards Total Wellbeing A Health System s Innovative Approach Company Profile Wellness A state of complete physical, mental and social wellbeing and not merely the absence of disease or infirmity
More informationPersonal Diabetes Passport
Personal Diabetes Passport Contact information: Name: Physician: Diabetes Education Centre: Dietitian: Ophthalmologist: Chiropodist: Type of Diabetes: Type 1 (T1DM) Increased risk for diabetes Type 2(T2DM)
More informationA VIDEO SERIES. living WELL. with kidney failure HOW KIDNEY FAILURE AFFECTS YOUR BODY
A VIDEO SERIES living WELL with kidney failure HOW KIDNEY FAILURE AFFECTS YOUR BODY Contents 2 Introduction 3 What will I learn? 4 How does kidney failure affect my body? 5 How can I protect my heart
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationA Creative, Community Wellness Program
A Creative, Community Wellness Program Did You Know Today the adults in the U.S. Over 66% of adults are obese or overweight Medical costs for obese adults is 77% higher than a healthy adult 55% do not
More informationAnnual Report and. Business Plan Summary. Greater Manchester Health and Social Care Partnership
Annual Report and Business Plan Summary 2016-17 2017-18 Greater Manchester Health and Social Care Partnership Our first year and beyond In April 2016, devolution gave Greater Manchester control of its
More informationHEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE
HEALTH SCREEN CARE VIGNE Healthcare provides a comprehensive Health Screening Package of Silver Gold Platinum Cancer EXCLUSIVE HEALTH SCREENING EXPERIENCE Meet & Greet Medical Review with Doctor Appointment
More informationBUPA ADVANCED HEALTH OUR MOST DETAILED HEALTH AND FITNESS ASSESSMENT
BUPA ADVANCED HEALTH OUR MOST DETAILED HEALTH AND FITNESS ASSESSMENT bupa.co.uk BUPA ADVANCED HEALTH CREATING A DETAILED PICTURE OF YOUR HEALTH Combining an in-depth profile of your overall health with
More informationBupa Complete Health
Bupa Complete Health The in-depth health and wellbeing assessment Bupa Complete Health The in-depth health and wellbeing assessment Introducing Bupa Introducing Bupa Complete Health Complete Health created
More informationPRACTICE WHAT WE PREACH
PRACTICE WHAT WE PREACH Sioned Quirke Professional Manager Adult Weight Management Service, ABUHB & Lead Specialist Dietitian in obesity management WELSH HEALTH SURVEY WAG 2012 59% of adults were classified
More informationWELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More information* * Interpretation
LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)
More informationAnnual Max. Point Value. Program Activity STEP 1: KNOW YOUR NUMBERS
The City of Colorado Springs Reach Your Peak Wellness Program Year 10 3 Step Wellness Program November 1, 2013 October 31, 2014 Wellness Activities & Point Distribution Program Activity STEP 1: KNOW YOUR
More informationROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationRICHMOND PARK SCHOOL LIFESTYLE SCREENING REPORT Carmarthenshire County Council
RICHMOND PARK SCHOOL LIFESTYLE SCREENING REPORT 2016 Carmarthenshire County Council WHY LEAD A HEALTHY LIFESTYLE? A nutritious, well-balanced diet along with physical activity and refraining from smoking
More informationFIGHTING FAT A ROLE FOR FOOD RETAILERS
FIGHTING FAT A ROLE FOR FOOD RETAILERS In January 2016, Oliver Wyman led a session at the World Economic Forum in Davos, Switzerland, entitled Sugar, obesity, and diabetes the other global food crisis.
More information5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationLifestyle Health Assessment.
Lifestyle Health Assessment. Nuffield Health. Specialists in you. Open the conversation. At Nuffield Health all our health assessments focus on preventative health. This means that we concentrate on informing
More informationThe changes that patients make to their lifestyle, are as important a part of treatment as their medicines. 1
Healthy lifestyle The changes that patients make to their lifestyle, are as important a part of treatment as their medicines. 1 However, making lifestyle changes can be hard for any of us. We know that
More informationThe Blood Chemistry Panel Explained
The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com
More informationAdams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation
More informationAIDS and insurance. Information about the necessity of AIDS testing Implications of undergoing an AIDS test The choices available to you INSURANCE
INSURANCE AIDS and insurance Information about the necessity of AIDS testing Implications of undergoing an AIDS test The choices available to you Please read carefully NSW and TAS only What is AIDS? AIDS
More informationWellness is a state of complete harmony of BODY, MIND & SPIRIT
Wellness is a state of complete harmony of BODY, MIND & SPIRIT Index About Us Specialty Clinics Corporate Wellness Jehangir Silver & Gold Jehangir Platinum (Whole Body Screening) Jehangir Comprehensive
More informationWIN QUARTERLY UTILIZATION REPORT 7/1/2010 TO 12/31/2010. EXPERTISE PARTNERSHIP V A L U E April 20, 2011
WIN QUARTERLY UTILIZATION REPORT 7/1/2010 TO 12/31/2010 EXPERTISE PARTNERSHIP V A L U E April 20, 2011 T R E N D S A N A L Y S I S S T A T I S T I C S P L A N N I N G T O O L S Participation Mass Screening
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationThe Diabetes Prevention Program's Lifestyle Change Program. Participant Notebook
The Diabetes Prevention Program's Lifestyle Change Program Participant Notebook The Diabetes Prevention Program's Lifestyle Change Program Your name: Your Lifestyle Coach is Address: Phone: Session 1A:
More informationResults Report. Welcome to Your ABT Report! Introduction to the ABT Report
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationAchieve Your Best Health
Achieve Your Best Health for High Cholesterol paisc.com What is health coaching? Health coaching is a voluntary program for members diagnosed with certain health conditions. We take a personalized and
More informationEfficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled
Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar
More informationEducation that supports your health and your life
Alberta Healthy Living Program Education that supports your health and your life Central Zone Winter 2018 Workshop Guide The Alberta Healthy Living Program (AHLP) offers free workshops and one-on-one sessions
More informationRev. date Kaiser Foundation Health Plan of Washington
PE3620000-01-17 Rev. date 2014013 2017 Kaiser Foundation Health Plan of Washington Gestational diabetes Information to help you stay healthy during your pregnancy What is gestational diabetes? How gestational
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More informationJUST DIAGNOSED WITH DIABETES?
JUST DIAGNOSED WITH DIABETES? Being told that you have diabetes can be a real shock. And learning to live with it can be a challenge. You might be going through all sorts of emotions. It s perfectly normal
More informationYour Partnership in Health Report: Chronic Conditions ABC Company and Kaiser Permanente
Your Partnership in Health Report: s ABC Company and Kaiser Permanente Measurement Period: JUL-01-2012 through JUN-30-2013 Report Date: DEC-31-2013 Commercial All Members Partnership in Health (PIH) reports:
More informationTable of Contents. Early Identification Chart Biometric Screening Comprehensive Cardiovascular Disease Risk Assessment...
Public Safety Table of Contents Early Identification Chart... 1 Biometric Screening... 2 Comprehensive Cardiovascular Disease Risk Assessment.... 2 Recommended after Comprehensive Cardiovascular Disease
More information360+ Health Assessment.
360+ Health Assessment. Nuffield Health. Specialists in you. Open the conversation. At Nuffield Health all our health assessments focus on preventative health. This means that we concentrate on informing
More informationPERSONALIZED PREDICTIVE PREVENTIVE
PERSONALIZED PREDICTIVE PREVENTIVE What is healthy advice? 1984 What is healthy advice? T o d a y We re all different Dietary Advice Health Exercise Advice Don t eat fat Aim for 600iu of Vitamin D Your
More information