Screening non-classical 21-hydroxylase gene deficiency from patients diagnosed as polycystic ovary syndrome by gene assay HU Jie, JIAO Kai *

Transcription

1 Med J Chin PLA, Vol. 41, No. 3, March 1, [ ] (PCOS) 21- (NC-21OHD) PCOS Ferriman-Gallway ( mf-g ) 3 mf-g 0~2 A 3~5 B 6 C30 DNA 5 CYP21A2 8 (ACTH) PCOS 5 V281L/ insT(P1) V281L/I230M(P2) V281L/Normal(P3 P4 P5) C % B 3.3% P1NC-21OHD P3 P4 P5 P2 I230M P2 NC- 21OHD ACTH P1 ACTH PCOS NC-21OHD PCOS mf-g 6NC-21OHD [ ] 21-Ferriman-Gallway [] R [] A [ ] (2016) [DOI] /j.issn Screening non-classical 21-hydroxylase gene deficiency from patients diagnosed as polycystic ovary syndrome by gene assay HU Jie, JIAO Kai * Department of Endocrinology, Tangdu Hospital of Fourth Military Medical University, Xi an , China * Corresponding author, tdjkai@fmmu.edu.cn [Abstract] Objective To screen non-classical 21-hydroxylase deficiency (NC-21OHD) from patients diagnosed as polycystic ovary syndrome (PCOS) by gene assay. Methods Ninety-eight patients with PCOS were enrolled according to 2003 Rotterdam criteria from Department of Endocrinology, Tangdu Hospital of Fourth Military Medical University, and they were divided into three groups according to the modified Ferriman-Gallway (mf-g) score as follows: group A with score 0-2; group B with score 3-5, and group C with score 6. Meanwhile, 30 healthy subjects from the Medical Center of the Hospital were recruited as control group. Peripheral blood of all subjects were collected for extracting DNA, the CYP21A2 gene were amplified by 5 pairs of specific primers, and then the PCR products were sequenced by Shanghai Sangon Co. The subjects would accept test for serum cortisol and adrenocorticotropic hormone (ACTH) at 8:00am if their CYP21A2 was proved to be abnormal. Results Thirty subjects of control group had no any defects in CYP21A2, but 5 of 98 patients with PCOS were proved to be deficient in CYP21A2, and the genotypes were V281L/ insT (P1), V281L/I230M (P2), V281L/Normal (P3, P4, P5), respectively, and all of them were heterozygous mutations. The incidences of NC-21OHD in group C and B were 28.6% and 3.3%, respectively. Genotype P1 had been identified to belong to NC-21OHD, which was consistent with its clinical phenotype. All genotypes P3, P4 and P5 belonged to carriers. But for P2, since I230M hadn't been reported in literature, the patient with V281L/I230M couldn't be classified now. Serum biochemical results showed that only in P1 the cortisol was close to the normal lower level, and ACTH was close to the normal upper limit of the reported level in the literature, and the remainders were all normal. Conclusions Although PCOS and NC-21OHD are [ ] [ ] () [ ] tdjkai@fmmu.edu.cn

2 very similar in clinical manifestations, they are different completely in the pathogenesis and treatment. So it is necessary to accurately screen NC-21OHD out from the patients diagnosed as PCOS, especially from those with polytrichosis and mf-g 6, in order to avoid wrong diagnosis. [Key words] polycystic ovary syndrome; non-classical 21-hydroxylase deficiency; genotype; modified Ferriman-Gallway score (polycystic ovary syndrome PCOS) [1-3] 1935 [4] 6%~20% [5] [6] ( ) PCOS PCOS (non-classic congenital adrenal hyperplasia NCAH) NCAH (congenital adrenal hyperplasia CAH) CAH 90%~95% 21- (21-hydroxylase 21-OH) ( ) 21- (non-classical 21-hydroxylase deficiency NC-21OHD) 1/1000 [7] PCOS PCOS NC-21OHD PCOS NC-21OHD NC-21OHD 21- PCOSNC- 21OHD [8] PCOS ( ) [ 2~9mm 12 ( ) 10ml] PCOS Ferriman-Gallway (mf-g) [9] 9 0~4 5 F-G 98 PCOS 3 mf-g 0~2 (A )50 3~5 (B )34 6 (C )14 30 (TDLL ) (BMI) (WHR) 12h (OGTT) (FPG) (Fins) (HOMA-IR) HOMA- IR=FPG Fins/22.5 (LH) (FSH) (E 2 ) (T) (ACTH) GE Voluson E PCOS DNA DNA NCBI GenBank CYP21A2 CYP21A1P Primer CYP21A2 DNAmanCYP21A SPSS 17.0 x±s LSD-t P<0.05

3 Med J Chin PLA, Vol. 41, No. 3, March 1, Tab.1 Sequences of five pairs of primers Primer Location Sequence (5' 3') 1F TCTCGCCATGCTGCTCCT 1R TGGAGGGTGGGAACTGATG 2F CCGGACCTGTCCTTGGGAGACTACT 2R AAGTTGTCGTCCTGCCAGAAAAG 3F CTTTTCTGGCAGGACGACAACTTA 3R GAGGCTCTCCTGCAGAGGGTGAA 4F AGCCTCGTGGCAGGCCAGTG 4R TTCGTGGTCTAGCTCCTCCTGCA 5F CCTGAGGTGCGTCCTGGGG 5R GCCTCCACCACATTTTCACGG 2.1 mf-g mf-g ( P >0.05) B BMI WHR A (P<0.05) B HOMA-IR (P<0.05) mf-g 6 C T (P<0.05) B C LH LH/ FSH A (P<0.05 P<0.01) (P>0.05 2) 2 mf-g Tab.2 Comparison of physical and biochemical data among patients with different mf-g scores Item Group A (n=50) Group B (n=34) Group C (n=14) Age (year) 22.76± ± ±4.30 BMI (kg/m 2 ) 25.21± ±6.70 (1) 27.48±6.93 WHR 0.84± ±0.08 (1) 0.87±0.07 HOMA-IR 2.86± ±1.33 (1) 2.81±1.53 (3) E 2 (pg/ml) 73.71± ± ±26.05 T (ng/ml) 0.44± ± ±0.35 (1) LH (mu/ml) 9.43± ±4.12 (1) 13.23±5.85 (2) FSH (mu/ml) 6.73± ± ±2.83 LH/FSH 1.49± ±0.76 (2) 1.76±0.68 (1) Follicles 13.78± ± ±1.80 Maximum diameter 8.02± ± ±1.05 (mm) BMI. Body mass index; WHR. Waist hip ratio; HOMA-IR. Homeostasis model of assessment for insulin resistance index; E 2. Estradiol; T. Testosterone; LH. Luteinizing hormone; FSH. Follicle stimulating hormone. (1)P<0.05, (2)P<0.01 compared with group A; (3)P<0.05 compared with group B 2.2 BMI WHR HOMA-IR BMI WHR HOMA-IR ( r = P <0.001) LH T E 2 LH/FSH (P>0.05) PCOS 5 V281L/ insT 1 (P1) V281L/I230M 1 (P2) V281L/Normal 3 (P3 P4 P5) PCR CYP21A2 P1 18 8~ cm ~37d mf-g 9 (2 ) (1 )(2 ) (3 ) (1 ) (global acne grading system GAGS) 20 P cm 10 22~23 35~50d mf-g 7 (1 ) (1 ) (1 ) (1 ) (2 ) (1 ) P3 P4 10~11 12~13 1~2 P3 2 4 P ~60d mf-g 6 7 P3 (1 ) (1 ) (1 ) (2 ) (1 ) P4(3 ) (2 ) (2 ) P5 13~14 mf-g 5 (2 ) (1 ) (1 ) (1 ) GAGS 34

4 Exon7 c inst Exon7 p.v281l(g>t)g/t 434bp P1 A Exon6 p.i230m(a>g)a/g 480bp Exon7 p.v281l(g>t)g/t P2 434bp B Exon7 p.v281l(g>t)g/t 434bp P3, P4, P5 C 1 5 PCR( ) ( ) Fig.1 Representative electropherograms (right panel) and gene sequencing peak graph (left panel) of five patients with genetic mutations A. Left panel: P1's two mutations are both in the exon 7, the first mutation inserts atinc , the second mutation c.841g>t, changes the 281st valine to leucine. Right panel: PCR fragment is 434bp. B. Left panel: the first mutation c.690a>g in exon 6 in P2, changes the 230th isoleucine to methionine, the second mutation is same with P1's second mutation. Right panel: PCR fragments are 480bp and 434bp respectively. C. Left panel: P3, P4 and P5's mutations are all c.841g>t, changes the 281st valine to leucine. Right panel: PCR fragment is 434bp. The green curves label the nucleotide A, blue curves label the nucleotide C, black curves label the nucleotide G, and the red curves label the nucleotide T 5 3 (60%) 2 (40%) B 3 (60%) PCOS T 0.48±0.28ng/ml 5 T 5 8 ACTH P1 ACTH Tab.3 The genotypes, biochemical and clinical characteristics of 5 cases with abnormal 21-hydroxylase gene and phenotype Item P1 P2 P3 P4 P5 Diagnosis age (year) Height (cm) T(ng/ml) Cortisol (8:00) (ng/ml) ACTH(8:00) (pg/ml) mf-g score Acne (Yes/No) Yes No No No Yes OA (Yes/No) No Yes Yes Yes No PCO (Yes/No) No Yes No Yes Yes Genotype V281L/ insT V281L/I230 V281L/Normal V281L/Normal V281L/Normal T. Testosterone; ACTH. Adrenocorticotropic hormone; mf-g score. Modified Ferriman-Gallway score; OA. Ligo-/anovulation; PCO. Polycystic ovary. T reference: ng/ml; Cortisol reference: ng/ml; ACTH reference: 9-80pg/ml

5 Med J Chin PLA, Vol. 41, No. 3, March 1, PCOS mf-g 6 mf-g [10] 3~ % [11] PCOS mf-g 248.1% 30 CYP21A2 98 PCOS 5 V281L/ inst 1 (P1) V281L/I230M 1 (P2) V281L 3 (P3 P4 P5) CYP21 P1 V281L 20%~50% inst V281L 2009 Neocleous [12] CAH 21- V281L inst/v281l instp2 V281L I230M 689T>C 230 [13] V281L/I230T NC- 21OHD 8.5%~9.4% 30 I230M P2 P3 P4 P5 V281L mf-g % 3~5 3.3% P2 21-OHD PCOS NC-21-OHD 0.20% PCOS NC-21- OHD (2.2%) [14] 5 (60%) (40%) (60%) PCOS 5 T PCOS 58 ACTH P1 ACTH 21-OHD ACTH 17- (17-OHP) [15-16] 17-OHP>6nmol/L ACTH 17-OHP >33nmol/L 21- [17] 17-OHP NCAH NCAH PCOS P1 c inst PCOS ACTH 17-OHP ACTH NC-21-OHD [1] Huang LJ, Lu Y, Zheng JH, et al. Relationship of the fat metabolic parameters and androgen level of umbilical cord blood in newborns of mothers with polycystic ovary syndrome[ J]. Tianjin Med J, 2015, 43(5): [,,,. [J]., 2015, 43(5): ] [2] Tian B, Wu Y, Li QF, et al. Correlation between FABP2 gene Ala54Thr polymorphism and polycystic ovary syndrome[ J]. Med J Chin PLA, 2014, 39(1): [,,,. FABP2 Ala54Thr [J]., 2014, 39(1): ] [3] Yu Q, Jin LN. Polycystic ovary syndrome and metabolic disturbances[ J]. Chin J Pract Intern Med, 2011, 31(4): [,. [J]., 2011, 31(4): ] [4] Zhang HR, Zhang YC, Wang AM, et al. Expression and significance of serum ghrelin level and ovarian tissue growth substance in a rat model of polycystic ovary syndrome[ J]. Med J Chin PLA, 2012, 37(2): [,,,. [J]., 2012, 37(2):

6 ] [5] Wang BJ, Guo YH, Zhang HH, et al. Effects of up-regulation of PPAR on expression of P450arom mrna and T transforming effects in ovarian granulosa cells from patients with PCOS[ J]. J Zhengzhou Univ (Med Sci), 2015, 50(6): [,,,. PPAR PCOS P450arom mrna T [J]. ( ), 2015, 50(6): ] [6] Jayasena CN, Franks S. The management of patients with polycystic ovary syndrome[ J]. Nat Rev Endocrinol, 2014, 10(10): [7] Witchel SF. Non-classic congenital adrenal hyperplasia[ J]. Steroids, 2013, 78(8): [8] Rotterdam ESHRE/ASRM-Sponsored PCOS Consensus Workshop Group. Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome[ J]. Fertil Steril, 2004, 81(1): [9] Azziz R. The evaluation and management of hirsutism[ J]. Obstet Gynecol, 2003, 101(5 Pt 1): [10] Zhao XM, Ni RM, Huang J, et al. Study on the facial and body terminal hair growth in women in Guangdong by using modified Ferriman-Gallwey scoring system[ J]. Chin J Obstet Gynecol, 2013, 48(6): [,,,. Ferriman-Gallwey [J]., 2013, 48(6): ] [11] Zhao JL, Chen ZJ, Shi YH, et al. Investigation of body hair assessment of Chinese women in Shandong region and its preliminary application in polycystic ovary syndrome patients[ J]. Chin J Obstet Gynecol, 2007, 42(9): [,,,. [J]., 2007, 42(9): ] [12] Neocleous V, Ioannou YS, Bartsota M, et al. Raremutations in the CYP21A2 gene detected in congenital adrenal hyperplasia[ J]. Clin Biochem, 2009, 42(13-14): [13] Tardy V, Menassa R, Sulmont V, et al. Phenotype-genotype correlations of 13 Rare CYP21A2 mutations detected in 46 patients affected with 21-Hydroxylase deficiency and in one carrier[ J]. J Clin Endocrinol Metab, 2010, 95(3): [14] Escobar-Morreale HF, Sanchón R, San Millán JL. A prospective study of the prevalence of nonclassical congenital adrenal hyperplasia among women presenting with hyperandrogenic symptoms and signs[ J]. J Clin Endocrinol Metab, 2008, 93(2): [15] Admoni O, Israel S, Lavi I, et al. Hyperandrogenism in carriers of CYP21 mutations: the role of genotype[ J]. Clin Endocrinol (Oxf), 2006, 64(6): [16] Bidet M, Bellanne-Chantelot C, Galand-Portier MB, et al. Clinical and molecular characterization of a cohort of 161 unrelated women with nonclassical congenital adrenal hyperplasia due to 21-hydroxylase deficiency and 330 family members[ J]. J Clin Endocrinol Metab, 2009, 94(5): [17] Speiser PW, Azziz R, Baskin LS, et al. Congenital adrenal hyperplasia due to steroid 21-hydroxylase deficiency: an endocrine society clinical practice guideline[ J]. J Clin Endocrinol Metab, 2010, 95(9): ( ) ( )