[DOI] /j.issn , China
|
|
- Howard Todd
- 5 years ago
- Views:
Transcription
1 Med J Chin PLA, Vol. 41, No. 5, May 1, HBsAg HBs S N- [ ] (HBV)HBsAg+ HBs S (MHR) N- HBsAg+ HBs 284 HBsAg+ HBs 314 HBsAg HBV S 1 MHR N- N- S/S HepG2 HBsAg+ HBs MHR N- 11.3%(32/284) HBsAg 2.9%(9/314)(P<0.01) HBsAg+ HBs 72 (HCC) N- 46.9%(15/32) 22.6%(57/252)(P<0.01) 1 s tst NST+s TSM NST sp120 +G145D % 2.0% 2.5% 2 s gts NSS N- 17.6% sp120 +G145D 31% HBsAg 99% N- HBsAg N- sp120 +G145D HBsAg HBV S MHR N- HBsAg+ HBs HCC S MHR N- +sp120 +sg145d HBsAg [ ] S N- [ ] R [ ] A [ ] (2016) [DOI] /j.issn Implications of newly-added N-glycosylation mutation of hepatitis B virus S-gene in patients with coexistence of HBsAg and antihbs LU Shan-shan 1, LI Xiao-dong 2, LUO Sheng-dong 3, QIAO Yan 1, XU Zhi-hui 2, LIU Yan 2, LI Bo-an 2, XU Dong-ping 2*, LI Jin 4* 1 Graduate School of Guilin Medical University, Guilin, Guangxi , China 2 Research Center for Clinical and Translational Medicine, 4 Department of Medical Administration, 302 Hospital of PLA, Beijing , China 3 State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing , China * Corresponding author. XU Dong-ping, xudongping302@sina.com; LI Jin, lijin302@hotmail.com This work was supported by the National Natural Science Foundation of China ( , , ) [Abstract] Objective To analyze the characteristics of newly added N-glycosylation mutation in major hydrophilic region (MHR) of HBV S gene in patients with coexistence of HBsAg and antihbs, and reveal the generation mechanism and clinical implications of the coexistence. Methods HBV S genes from 284 patients with HBsAg+antiHBs and 314 patients with single HBsAg were amplified respectively for sequence analysis. A chronic hepatitis B (CHB) patient with HBsAg+antiHBs in MHR was found to harbor a novel double N-glycosylation mutation and selected for further study. Recombinant vectors harboring the novel mutant or control PreS/S genes were constructed and transfected in HepG2 cells respectively for phenotypic analysis, and the effects of the mutations on HBV duplication and antigenicity were investigated. Results The detection rate of MHR N-glycosylation mutation was significantly higher in HBsAg+antiHBs group than in single HBsAg group (11.3% vs. 2.9%, P<0.01, respectively). In HBsAg+antiHBs cohort, the proportion of hepatocellular carcinoma (HCC) patients accounted for 46.9%(15/32) in patients with N-glycosylation mutation at the time of testing; by contrast, the number was 22.6%(57/252) in patients with non-n-glycosylation mutation (P<0.01). N-glycosylation mutational pattern of the novel strain was s tst NST+s TSM NST concomitant with sp120 [ ] ( ) [ ] [ ] ( ) ( ) ( ) ( ) [ ] xudongping302@sina.com lijin302@hotmail.com
2 deletion+g145d mutation. The novel mutants accounted for 98.0%, 2.0% and 2.5%, respectively, of viral clones in three sequential serum samples. Mutants with single N-glycosylation mutation s gts NSS without sp120 deletion+g145d were detected in sample 2, accounting for 17.6% of viral clones. Compared to the wild-type, the novel mutant had an increase of 31% in replication capacity, but a decrease of 99% in HBsAg level. Immunofluorescence showed that elimination of the two additional N-glycosylation mutations only partly restored HBsAg detection by antihbs, suggesting that sp120 deletion+g145d mutation also attenuated HBsAg antigenicity. Conclusions Additional N-glycosylation mutation in MHR of HBV S gene is associated with coexisting HBsAg+antiHBs, and the twoparameterstogethermightbeabetterriskfactor for HCC occurrence. Combination of two additional N-glycosylation mutation, sp120 deletion and sg145d mutation may co-play a role in silence of HBsAg antigenicity. [Key words] hepatitis B virus; S gene; mutation; N-glycosylation; antigenicity (HBV) HBsAg HBs HBs HBsAg HBs [1-2] HBV HBsAg HBs HBsAg+ HBs HBV DNA HBsAg+ HBs HBsAg HBs [3-4] HBV S HBV HBsAg+ HBs [5-6] HBV S (nt ) 226 (aa) S S (major hydrophilic region MHR aa ) N- s nct N- NXT/S(X P ) N- 216 HBsAg+ HBs S MHR 47 N- ( N- ) MHR N- HBs HBsAg [7] 284 HBsAg+ HBs HBV S N- 1 N- sp120 +G145D S N- HBsAg+ HBs HBsAg+ HBs 314 HBsAg HBV HBsAg+ HBs ±14.8 (CHB)99 (LC)113 (HCC)72 HBsAg ( ) ( )COI HBs 48.6( )U/L HBV DNA log 10 (4.8±2.2)U/ml 314 HBsAg ±13.6 CHB 108 LC 103 HCC 103 HBsAg ( )COI HBs HBV DNA log 10 (5.6±1.6)U/ml 1 S MHR N- CHB S HBsAg HBV DNA HBsAg HBs HBV DNA U/ml HCC ID Date ALT (U/L) AST (U/L) 1 S12931 Tab.1 Clinical indices of sample S12931 HBsAg (U/ml) Anti-HBs (U/L) HBeAg (COI) Anti-HBe (COI) Anti-HBc (COI) HBV DNA (U/ml) Diagnosis * CHB CHB * <40 HCC <40 HCC < <40 HCC *Represents the individual with the clinical information, but without serum; CHB. Chronic hepatitis B; HCC. Hepatocellular carcinoma
3 Med J Chin PLA, Vol. 41, No. 5, May 1, DNA HBV DNA SFDA PCR ( ) U/ml HBsAg Roche Elecsys Roche Cobas e U/ml peasy-t1 Simple Trans-T1 His FITC HRP Hind Xho I BstE Sph NEB pcdna3.1(-)/myc-his A Invitrogen ptriex-mod-1.1hbv Zoulim X-treme GENE HD Roche HBsAg Santa PCR HBV S 284 HBsAg+ HBs 314 HBsAg HBV DNA PCR S ( ZL U/ml) 1 Rtup3/ SB1R 2 Rtup4/SB2R PCR (nt ) 2 2 PCR Tab.2 PCR amplification primers Primer Sequence(5' 3') Site Rtup3 AGTCAGGAAGACAGCCTACTCC nt Rtup4 TTCCTGCTGGTGGCTCCAGTTC nt PSup3 TCGCAGAAGATCTCAATCTCG nt SB1R AGGTGAAGCGAAGTGCACAC nt Up-BstE ATGGTCACCATATTCTTGGGAACAAG nt SB2R TTCCGCAGTATGGATCGGCAG nt yef3 CCTGCTCAAACCAGCTCTATGT nt yer3 ACATAGAGCTGGTTTGAGCAGG nt TuF1 AGGATCATCAACCACCAGCACG nt TuR1 TCCCGTGCTGGTGGTTGATGAT nt TuF2 TGCTCCAGCAACCTCTACGTTTC nt TuR2 GAAACGTAGAGGTTGCTGGAGC nt His-Up GGCTCGAGATGGAGAGCACAACATCAGG nt His-Down GGAAGCTTCCAGATGTATGCCCAAAGAC nt HBV S/S GI: (S12931)3 DNA PCR S/S PSup3/SB1R 2 Up-BstE /SB2R PCR (nt ) T 40~ ptriex-mod-1.1hbv BstE Sph 1 N- (M1) (WT) 2 N- (M2) ptriex-mod1.1-hbv ptriex-m1 ptriex-w T ptriex-m PCR HBV S s ( )s N- ptriex-m1 Up-BstE /TuR1 TuF1/SB2R Up-BstE /TuR2 TuF2/SB2R PCR BstE Sph PCR ptriex ptriex-m1'a ptriex-m1'b ptriex-m1'a Up-BstE /TuR2 TuF2/SB2R BstE Sph ptriex-m1'c ptriex-m2 Up-BstE /yer3 yef3/sb2r BstE Sph PCR ptriex-m2'a pcdna3.1/myc-his(-)a ptriex-m1/m1'a/m1'b/m1'c TriEx-M2/M2'a His-Up/His-Down HBV S (nt ) Hind Xho PCR pcdna3.1/myc-his(-)a His-M1/M1'a/M1'b/M1'c/M2/M2'a ptriex-w T His-WT DNA HBsAg HBV ptriex HepG2 3d HBV [8] PCR 20ml DNase PCR HBV DNA HBsAg ( cobas E601) Western blotting HBV S His-M1 HepG2 HBV S HepG / 6 24h h 10min 12%SDS- PAGE 5% His 1.5h PBST HRP 0.5h ECL Tanon His HepG2 36h PNGase F
4 d 6 HepG2 7 His 48h 100ml 4% 10min 100ml 0.2% Trixon-100 5min PBS 5% BSA 30min His ( 1:200) HBsAg ( 1:200)37 1h PBS FITC ( 1:200)37 30min PBS 50% N- 284 HBsAg+ HBs MHR N- 11.3%(32/284) 314 HBsAg 2.9%(9/314) (P<0.01) HBsAg+ HBs 72 (HCC) N- 46.9%(15/32) 22.6%(57/252 P<0.01) 32 N- 3 CHB LC HCC HBsAg 103 HCC 6 N- 2.2 N- 3 8 (1) 7 HBV DNA ( 10 9 copies/ml) N- 98.0% 2.0% 2.5% 2 sg130n+t131s s gts NSS sp120 +G145D 2.3 S/S ptriex-mod-1.1hbv S pcdna3.1(-)-myc-his A M1 st116n+p120deletion+g130a+t131n +G145D s nst NST N- M1'a M1'b M1'c s nst NST M2 sg130n+t131s s nss M2'a WT 2.4 HBV HBV DNA HBV HBV WT M1 31%(P<0.05) ( 1A) HBV DNA M1 M1'a M1'b M1'c WT 88% 46% 43% 35%(P<0.05 1B) M2 M2'a 5 (1) HBV DNA ( 10 6 copies/ml) 4 (1) (1) (1) M1 M1'a M1'b M1'c M2 M2'a WT A M1 M1'a M1'b M1'c M2 M2'a WT B 1 HBV (A) (B) HBV DNA Fig.1 Quantitation of HBV DNA in intracellular replicative intermediates (A) and supernatant (B) M1. st116n+p120deletion+g130a+t131n+g145d; M1'a. sp120deletion+g130a+t131n+g145d; M1'b. st116n+p120deletion+g130a+ G145D; M1'c. sp120deletion+g130a+g145d; M2. sg130n+t131s; M2'a. T131S; WT. Wild-type. (1)P<0.05 compared with wild-type 2.5 HBsAg ptriex-mod-1.1hbv HBsAg M1 M1'a M1'b M1'c HBsAg M2 M2'a HBsAg WT ( 2) 2.6 HBV S Western blotting His-M1 HepG2 His HBsAg-His 12h 24h ( 3A) His 7 His HBsAg-His 1 3kD( 3B) 27kD ( 3C) HBs M1 M1'a M1'b M1'c HBsAg-His M2 M2'a HBsAg- His WT ( 3D) 2.7 His HBs
5 Med J Chin PLA, Vol. 41, No. 5, May 1, HBsAg (U/ml) M1 M1'a M1'b M1'c M2 M2'a WT 2 HBsAg Fig.2 Quantitation of HBsAg in supernatant M1. st116n+p120deletion+g130a+t131n+g145d; M1'a. sp 120deletion+G130A+T131N+G145D; M1'b. st116n+p120deletion +G130A+G145D; M1'c. sp120deletion+g130a+g145d; M2. sg130n+t131s; M2'a. T131S; WT. Wild-type 36kD 33kD 27kD 36kD 33kD 27kD 12h 24h 36h 48h 60h 72h M1 M1'a M1'b M1'c M2 M2'a WT NC PNGaseF Plasmids M1'c M1 M1'a M1'b M1'c M2 M2'a M2'2 NC 27kD A B C HBsAg-His M1 M1'a M1'b M1'c M2 M2'a WT NC His 7 D HBs M1 3 HBsAg-His Western blotting M1'a M1'b M1'c Fig.3 Expression of intracellular HBsAg-His fusion proteins WT (Western blotting) M2 M2'a WT ( 4) A. Dynamical expression of HBsAg-His fusion protein of M1 mutant using anti-his; B. Expression of seven HBsAg-His fusion proteins using anti-his; C. Expression of seven deglycosylated HBsAg-His fusion proteins using anti-his; D. Expression of seven HBsAg-His fusion proteins 3 using antihbs. M1. st116n+p120deletion+g130a+t131n+g145d; M1'a. sp120deletion+g130a+t131n+g145d; M1'b. st116n+p120 HBV S S HBsAg S deletion+g130a+g145d; M1'c. sp120deletion+g130a+g145d; M2. sg130n+t131s; M2'a. T131S; WT. Wild-type M1 M1'a M1'b M1'c M2 M2'a WT Anti-His Anti-HBsAg 4 HBsAg-His Fig.4 Immunofluorescence analysis of HBsAg-His fusion proteins M1. st116n+p120deletion+g130a+t131n+g145d; M1'a. sp120deletion+g130a+t131n+g145d; M1'b. st116n+p120deletion+g130a+ G145D; M1'c. sp120deletion+g130a+g145d; M2. sg130n+t131s; M2'a. T131S; WT. Wild-type S HBs S MHR (aa ) HBsAg G145R [9] NXT/S(X P)N- N- N- 3kD HBsAg+ HBs HBV S N- [10-13] HBsAg+ HBs HCC [14-15] N- HBsAg HBs
6 DNA HCC [16] HBsAg+ HBs HBV S MHR N- HBsAg+ HBs HCC N- N- N HCC HBsAg+ HBs MHR N- HCC s tst NST+ s tsm NST+sP120 +G145D HBs HBsAg HBsAg Western blotting HBsAg HBs N- HBsAg WT s gts NSS N- sp120 +G145D HBsAg WT N- sp120 +G145D -HBs HBsAg sp120t sg145d HBsAg [17-19] HBsAg HBsAg -HBs HBsAg HBV DNA [20-21] N- HBsAg HBV DNA HBsAg HBV S MHR N- HBsAg+ HBs HCC HCC HBsAg MHR N- sp120 sg145 [1] Yuan Q, Wu CX, Liu FF, et al. Clinical analysis of occult hepatitis B virus infection in 110 HBsAg-negative patients[ J]. Med J Chin PLA, 2015, 40(3): [,,,. HBsAg HBV :110 [J]., 2015, 40 (3): ] [2] Wang Y, Yan YP, Du J, et al. Tne dynamic changes in serologic HBV markers in infants born by HBsAg-carrying mothers[ J]. Med J Chin PLA, 2011, 36(10): [,,,. HBsAg HBV [J]., 2011, 36(10): ] [3] Yu YQ, Zhang WH. Progress in antiviral therapy to prevent HBV recurrence in patients of post-liver transplantation[ J]. Chin J PractInternMed,2014, 34(6): [,. [J]., 2014, 34(6): ] [4] Guo WS, Liu Q, Guo YH, et al. Serological survey of hepatitis B among adult population in Henan[ J]. J Zhengzhou Univ (Med Sci), 2014, 49(1): [,,, [J]. ( ), 2014, 49(1): ] [5] DingF,YuHG,LiYX,et al. Sequence analysis of the HBV S protein in Chinese patients with coexisting HBsAg and anti- HBs[ J]. J Med Virol, 2015, 87(12): [6] Lada O, Benhamou Y, Poynard T, et al. Coexistence of hepatitis B surface antigen (HBsAg) and anti-hbs antibodies in chronic hepatitis B virus carriers: influence of "a" determinant variants[ J]. J Virol, 2006, 80(6): [7] YuDM,LiXH,MomV,et al. N-glycosylation mutations within hepatitis B virus surface major hydrophilic region contribute mostly to immune escape[ J]. J Hepatol, 2014, 60(3): [8] JiD,LiuY,SiLL,et al. Variable influence of mutational patterns in reverse-transcriptase domain on replication capacity of hepatitis B virus isolates from antiviral-experienced patients[ J]. Clin Chim Acta, 2011, 412(3-4): [9] Kajiwara E, Tanaka Y, Ohashi T, et al. HepatitisBcausedbya hepatitis B surface antigen escape mutant[ J]. J Gastroenterol, 2008, 43(3): [10] Liu W, Hu T, Wang X, et al. Coexistence of hepatitis B surface antigen and anti-hbs in Chinese chronic hepatitis B virus patientsrelatingtogenotypecandmutationsinthesandp gene reverse transcriptase region[ J]. Arch Virol, 2012, 157(4): [11] Wang L, Liu H, Ning X, et al. Sequence analysis of the S gene region in HBV DNA from patients positive for both HBsAg and HBsAb tests[ J]. Hepatol Res, 2010, 40(12): [12] Chen Y, Qian F, Yuan Q, et al. Mutations in hepatitis B virus DNA from patients with coexisting HBsAg and anti-hbs[ J]. J Clin Virol, 2011, 52(3): [13] Brunetto MR. Chance and necessity of simultaneous HBsAg and anti-hbs detection in the serum of chronic HBsAg carriers[ J]. J Hepatol, 2014, 60(3): [14] Seo SI, Choi HS, Choi BY, et al. Coexistence of hepatitis B surface antigen and antibody to hepatitis B surface may increase the risk of hepatocellular carcinoma in chronic hepatitis B virus infection: a retrospective cohort study[ J]. J Med Virol, 2014, 86(1): [15] Jang JS, Kim HS, Kim HJ, et al. Association of concurrent hepatitis B surface antigen and antibody to hepatitis B surface antigen with hepatocellular carcinoma in chronic hepatitis B virus infection [ J]. J Virol, 2009, 81(9): [16] Pollicino T, Cacciola I, Saffioti F, et al. Hepatitis B virus PreS/ S gene variants: pathobiology and clinical implications[ J]. J Hepatol, 2014, 61(2): [17] Tian Y, Xu Y, Zhang Z, et al. The amino acid residues at positions 120 to 123 are crucial for the antigenicity of hepatitis B surface antigen[ J]. J Clin Microbiol, 2007, 45(9): [18] Wu C, Deng W, Deng L, et al. Amino acid substitutions at positions 122 and 145 of hepatitis B virus surface antigen
7 Med J Chin PLA, Vol. 41, No. 5, May 1, (HBsAg) determine the antigenicity and immunogenicity of HBsAg and influence in vivo HBsAg clearance[ J]. J Virol, 2012, 86(8): [19] Colson P, Borentain P, Motte A, et al. Clinical and virological significance of the co-existence of HBsAg and anti-hbs antibodies in hepatitis B chronic carriers[ J]. Virology, 2007, 367(1): [20] Huang CH, Yuan Q, Chen PJ, et al. Influence of mutations in hepatitis B virus surface protein on viral antigenicity and phenotype in occult HBV strains from blood donors[ J]. J Hepatol, 2012, 57(4): [21] Chen JH, Liu Y, Xu ZH, et al. Characteristics of S gene mutation in patients with occult HBV infection[ J]. Med J Chin PLA, 2015, 40(3): [,,,. S [J]., 2015, 40(3): ] ( ) ( )
Clinical and Virological Characteristics of Chronic Hepatitis B Patients with Coexistence of HBsAg and Anti-HBs
RESEARCH ARTICLE Clinical and Virological Characteristics of Chronic Hepatitis B Patients with Coexistence of HBsAg and Anti-HBs Yong Liu 1,2, Le Zhang 1,2, Jin-Yong Zhou 1,2, Jinshun Pan 1,2, Wei Hu 1,
More informationY. Xiang*, P. Chen*, J.R Xia and L.P. Zhang
A large-scale analysis study on the clinical and viral characteristics of hepatitis B infection with concurrence of hepatitis B surface or E antigens and their corresponding antibodies Y. Xiang*, P. Chen*,
More informationMutants and HBV vaccination. Dr. Ulus Salih Akarca Ege University, Izmir, Turkey
Mutants and HBV vaccination Dr. Ulus Salih Akarca Ege University, Izmir, Turkey Geographic Distribution of Chronic HBV Infection 400 million people are carrier of HBV Leading cause of cirrhosis and HCC
More informationHEPATITIS B: are escape mutants of concern?
VACCINATION: AN EVOLUTIONARY ENGINE FOR SPECIES? Fondation Mérieux Conference Centre Veyrier-du-Lac, France November 25-27, 2013 HEPATITIS B: are escape mutants of concern? Alessandro ZANETTI Department
More informationPathological Features and Prognosis in Chronic Hepatitis B Virus Carriers
The Journal of International Medical Research 2011; 39: 71 77 Pathological Features and Prognosis in Chronic Hepatitis B Virus Carriers ZH LU, W CHEN, ZC JU, H PEI, XJ YANG, XB GU AND LH HUANG Department
More informationPrevention Of Liver Fibrosis and Cancer in Africa
HIGH INCIDENCE OF A HEPATITIS B VIRUS PRES2 DELETION IN WEST AFRICA AMONG HBV CHRONIC CARRIERS : ASSOCIATION WITH HEPATOCELLULARCARCINOMA Prevention Of Liver Fibrosis and Cancer in Africa Isabelle CHEMIN
More informationDiagnostic Methods of HBV and HDV infections
Diagnostic Methods of HBV and HDV infections Zohreh Sharifi,ph.D Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine Hepatitis B-laboratory diagnosis Detection
More informationA Novel Recombinant Virus Reagent Products for Efficient Preparation Of Hepatitis B Animal Models
About FivePlus Beijing FivePlus Molecular Medicine Institute was established in 2005. The company has been dedicating itself to continuous innovation of viral vectors. The meaning of FivePlus is based
More informationNatural History of HBV Infection
Natural History of HBV Infection Joseph JY Sung MD PhD Institute of Digestive Disease Department of Medicine & Therapeutics Prince of Wales Hospital The Chinese University of Hong Kong HBV Infection 2
More informationNatural History of Chronic Hepatitis B
Natural History of Chronic Hepatitis B Anna SF Lok, MD Alice Lohrman Andrews Professor in Hepatology Director of Clinical Hepatology Assistant Dean for Clinical Research University of Michigan Ann Arbor,
More informationHBV PUBLIC HEALTH IMPLICATIONS
جزايری دکتر سيد محمد آزمايشگاه ھپاتيت B -دانشکده بھداشت ويروس شناسی- گروه دانشگاه علوم پزشکی تھران کنگره ارتقا کيفيت- ١٣٩٢ HBV PUBLIC HEALTH IMPLICATIONS 2 billion people have been infected by HBV worldwide.
More informationRole of Hepatitis B Virus Genotypes in Chronic Hepatitis B Exacerbation
BRIEF REPORT Role of Hepatitis B Virus Genotypes in Chronic Hepatitis B Exacerbation Man-Fung Yuen, 1 Erwin Sablon, 2 Danny Ka-Ho Wong, 1 He-Jun Yuan, 1 Benjamin Chun-Yu Wong, 1 Annie On-On Chan, 1 and
More informationRegulation of T cell proliferation by JMJD6 and PDGF-BB during chronic. hepatitis B infection
Supplemental Materials Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic hepatitis B infection Cai-Feng Chen 1#, Xia Feng 2#, Hui-Yu Liao 2#, Wen-Jing Jin 1, Jian Zhang 3, Yu Wang
More informationDiagnostic Methods of HBV infection. Zohreh Sharifi,ph.D of Virology Research center, Iranian Blood Transfusion Organization (IBTO)
Diagnostic Methods of HBV infection Zohreh Sharifi,ph.D of Virology Research center, Iranian Blood Transfusion Organization (IBTO) Hepatitis B-laboratory diagnosis Detection of HBV infection involves
More informationWhats new on HBsAg and other markers for HBV infection? Christoph Höner zu Siederdissen
Whats new on HBsAg and other markers for HBV infection? Christoph Höner zu Siederdissen Why diagnostic markers are important They are the basis for clinical decision makings treatment or no treatment?
More informationClinical Management of Hepatitis B WAN-CHENG CHOW DEPARTMENT OF GASTROENTEROLOGY & HEPATOLOGY SINGAPORE GENERAL HOSPITAL
Clinical Management of Hepatitis B WAN-CHENG CHOW DEPARTMENT OF GASTROENTEROLOGY & HEPATOLOGY SINGAPORE GENERAL HOSPITAL The World Health Organisation recent initiatives on HBV infection Launching of the
More informationHepatitis B virus core-related antigen is a serum prediction marker for hepatocellular carcinoma
Editorial Hepatitis B virus core-related antigen is a serum prediction marker for hepatocellular carcinoma Kazunori Kawaguchi, Masao Honda, Shuichi Kaneko Department of Gastroenterology, Kanazawa University
More informationCornerstones of Hepatitis B: Past, Present and Future
Cornerstones of Hepatitis B: Past, Present and Future Professor Man-Fung Yuen Queen Mary Hospital The University of Hong Kong Hong Kong 1 Outline Past Natural history studies Development of HBV-related
More informationCharacterization of Hepatitis B Virus (HBV) Among Liver Patients in Kenya
Characterization of Hepatitis B Virus (HBV) Among Liver Patients in Kenya By MISSIANI OCHWOTO (Medical Research officer, KEMRI) Julius Oyugi 2, Dufton Mwaengo 2, James Kimotho 1 Carla Osiowy 3 and Elijah
More informationA preliminary report on the influence of baseline cellular immunity to the therapeutic responses of peg-interferon
146 2009 9 4 3 Journal of Microbes and Infection, September 2009, Vol. 4, No. 3 e 2a 1, 2, 1, 1, 1, 1, 1, 1 1., 200025; 2., 200032 : ( CHB) ( IFN), IFN IFN, e ( HBeAg) CHB 19, 14, IFN- 2a 180 g, 1, 48,
More informationJournal of Microbes and Infection,June 2007,Vol 2,No. 2. (HBsAg)2 , (PCR) 1762/ 1764
68 2007 6 2 2 Journal of Microbes and Infection,June 2007,Vol 2,No. 2 2 S 1 1 1 2 2 3 1 (HBsAg)2 ( YIC) S 5 30g 60g YIC ( HBV) DNA > 2 log10 e (HBeAg), 6 DNA, 1 YIC 1, (PCR) (0 ) (44 ) HBV DNA S 2, S a
More informationIdentification of hepatitis B virus DNA reverse transcriptase variants associated with partial response to entecavir
Title Identification of hepatitis B virus DNA reverse transcriptase variants associated with partial response to entecavir Author(s) Wong, DKH; Fung, JYY; Lai, CL; Yuen, RMF Citation Hong Kong Medical
More informationBasics of hepatitis B diagnostics. Dr Emma Page MRCP MD(Res) Locum Consultant Sexual Health & Virology
Basics of hepatitis B diagnostics Dr Emma Page MRCP MD(Res) Locum Consultant Sexual Health & Virology Basics of hepatitis B diagnostics Background Epidemiology Morphology Life-cycle Diagnostic markers
More informationManagement of Chronic Hepatitis B in Asian Americans
Management of Chronic Hepatitis B in Asian Americans Myron J Tong; UCLA, CA Calvin Q. Pan; Mount Sinai, NY Hie-Won Hann; Thomas Jefferson, PA Kris V. Kowdley; Virginia Mason, WA Steven Huy B Han; UCLA,
More informationTreatment of chronic hepatitis B 2013 update
22 February 213 Treatment of chronic hepatitis B 213 update Pietro Lampertico 1st Gastroenterology Unit Fondazione IRCCS Cà Granda - Ospedale Maggiore Policlinico Università di Milano EASL 212 Clinical
More informationHBsAg(+) mothers is a transient
Perinatal HBV viremia in newborns of HBsAg(+) mothers is a transient phenomenon that does not necessarily imply HBV infection transmission Vana Papaevangelou (Greece) National and Kapodistrian University
More informationAn Update HBV Treatment
An Update HBV Treatment Epidemiology Natural history Treatment Daryl T.-Y. Lau, MD, MPH Associate Professor of Medicine Director of Translational Liver Research Division of Gastroenterology BIDMC, Harvard
More informationNATURAL HISTORY OF HEPATITIS B
NATURAL HISTORY OF HEPATITIS B AND DIAGNOSTIC: STATE OF THE ART O. BAHRI LABORATORY OF MEDICAL BIOLOGY AZIZA OTHMANA HOSPITAL TUNIS, TUNISIA The 2 nd Congress of The Federation of Arab Societies of Clinical
More informationManagement of chronic hepatitis B : recent advance in the treatment of antiviral resistance
anagement of chronic hepatitis B : recent advance in the treatment of antiviral resistance / 김강모 연수강좌 anagement of chronic hepatitis B : recent advance in the treatment of antiviral resistance 김강모 울산대학교의과대학서울아산병원소화기내과
More informationHow to use pegylated Interferon for Chronic Hepatitis B in 2015
How to use pegylated Interferon for Chronic Hepatitis B in 215 Teerha Piratvisuth NKC Institute of Gastroenterology and Hepatology Prince of Songkla University, Thailand ASIAN-PACIFIC CLINICAL PRACTICE
More informationViral Hepatitis Diagnosis and Management
Viral Hepatitis Diagnosis and Management CLINICAL BACKGROUND Viral hepatitis is a relatively common disease (25 per 100,000 individuals in the United States) caused by a diverse group of hepatotropic agents
More informationCURRENT TREATMENT. Mitchell L Shiffman, MD Director Liver Institute of Virginia Bon Secours Health System Richmond and Newport News, Virginia
CURRENT TREATMENT OF HBV Mitchell L Shiffman, MD Director Liver Institute of Virginia Bon Secours Health System Richmond and Newport News, Virginia CHRONIC HBV INFECTION DEMOGRAPHICS IN THE USA Estimated
More informationChronic Hepatitis B Infection
Chronic Hepatitis B Infection Mohssen Nassiri Toosi, MD Imam Khomeinin Hospital Tehran University of Medical Sciences Chronic Hepatitis B Infection Virus : HBs Ag Positive Host Liver Health Chronic Hepatitis
More informationAcute Hepatitis B Virus Infection with Recovery
Hepatitis B: Clear as Mud Melissa Osborn, MD, MSCR Assistant Professor Emory University School of Medicine Atlanta, GA 1 Objectives 1. Distinguish the various stages in the natural history of chronic hepatitis
More informationHepatitis B. ECHO November 29, Joseph Ahn, MD, MS Associate Professor of Medicine Director of Hepatology Oregon Health & Science University
Hepatitis B ECHO November 29, 2017 Joseph Ahn, MD, MS Associate Professor of Medicine Director of Hepatology Oregon Health & Science University Disclosures Advisory board Gilead Comments The speaker Joseph
More informationThe Alphabet Soup of Viral Hepatitis Testing
The Alphabet Soup of Viral Hepatitis Testing August 18, 2011 Patricia Slev, PhD, DABCC Medical Director, Serologic Hepatitis and Retrovirus Laboratory, ARUP Laboratories Assistant Professor of Pathology,
More informationHBV : Structure. HBx protein Transcription activator
Hepatitis B Virus 1 Hepatitis B Virus 2 Properties of HBV a member of the hepadnavirus group Enveloped, partially double-stranded DNA viruses, smallest DNA virus Replication involves a reverse transcriptase
More information4th International HIV/Viral Hepatitis Co-Infection Meeting
4th International HIV/Viral Hepatitis Co-Infection Meeting The Rocky Road to Viral Hepatitis Elimination: Assuring access to antiviral therapy for ALL co-infected patients from low to high income settings
More informationJ.C. WANG, L.L. HE, Q. CHEN 1. Introduction. Abstract. BACKGROUND: Either combination. European Review for Medical and Pharmacological Sciences
European Review for Medical and Pharmacological Sciences Comparison of re-treatment outcomes of lamivudine plus adefovir or entecavir in chronic hepatitis B patients with viral relapse after cessation
More informationTo test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
More informationTherapeutic immunization strategies in chronic hepatitis B
Therapeutic immunization strategies in chronic hepatitis B Mengji Lu Institut für Virologie Universitätsklinkum Essen Falk Symposium Berlin, 04. October 2005 The aim of therapeutic immunization to achieve
More informationReceived 30 May 2004/Returned for modification 6 August 2004/Accepted 12 August 2004
JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 2004, p. 5036 5040 Vol. 42, No. 11 0095-1137/04/$08.00 0 DOI: 10.1128/JCM.42.11.5036 5040.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved.
More informationHepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
More informationDynamic analysis of lymphocyte subsets of peripheral blood in patients with acute self-limited hepatitis B
Vol.2, No.7, 736-741 (2010) doi:10.4236/health.2010.27112 Health Dynamic analysis of lymphocyte subsets of peripheral blood in patients with acute self-limited hepatitis B Bo Liu, Jun Li*, Yaping Han,
More informationHBV Core and Core-Related Antigen Quantitation in Chinese Patients with. Chronic Hepatitis B Genotype B and C Virus Infection
Title page HBV Core and Core-Related Antigen Quantitation in Chinese Patients with Chronic Hepatitis B Genotype B and C Virus Infection Short Title: Quantitation of HBc and HBcrAg in Chinese patients Akinori
More informationAlla ricerca del virus nascosto (quando il virus dell epatitie B si occulta )
Alla ricerca del virus nascosto (quando il virus dell epatitie B si occulta ) Giovanni Raimondo Epatologia Clinica e Biomolecolare Policlinico Universitario di Messina UI/ml pg/ml HBsAg HBeAg + anti-hbe
More informationXiao-Ling Chi, Mei-Jie Shi, Huan-Ming Xiao, Yu-Bao Xie, and Gao-Shu Cai. Correspondence should be addressed to Xiao-Ling Chi;
Evidence-Based Complementary and Alternative Medicine Volume 2016, Article ID 3743427, 6 pages http://dx.doi.org/10.1155/2016/3743427 Research Article The Score Model Containing Chinese Medicine Syndrome
More informationOccult Hepatitis B Infection: why, who and what to do?
Occult Hepatitis B Infection: why, who and what to do? MF Yuen, MD, PhD Chair of Gastroenterology and Hepatology Department of Medicine The University of Hong Kong Queen Mary Hospital, Hong Kong Who? Different
More informationHepatitis B screening and surveillance in primary care
Hepatitis B screening and surveillance in primary care Catherine Stedman Associate Professor of Medicine, University of Otago, Christchurch Gastroenterology Department, Christchurch Hospital Disclosures
More informationTitle:Identification of a novel microrna signature associated with intrahepatic cholangiocarcinoma (ICC) patient prognosis
Author's response to reviews Title:Identification of a novel microrna signature associated with intrahepatic cholangiocarcinoma (ICC) patient prognosis Authors: Mei-Yin Zhang (zhangmy@sysucc.org.cn) Shu-Hong
More informationHepatitis B Update. Jorge L. Herrera, M.D. University of South Alabama Mobile, AL. Gastroenterology
Hepatitis B Update Jorge L. Herrera, M.D. University of South Alabama Mobile, AL Deciding Who to Treat Is hepatitis B a viral disease or a liver disease? Importance of HBV-DNA Levels in the Natural History
More informationEfficacy of combined hepatitis B immunoglobulin and hepatitis B vaccine in blocking father-infant transmission of hepatitis B viral infection
Efficacy of combined hepatitis B immunoglobulin and hepatitis B vaccine in blocking father-infant transmission of hepatitis B viral infection L.-H. Cao 1, Z.-M. Liu 1, P.-L. Zhao 1, S.-C. Sun 2, D.-B.
More informationA Message to Presenters
A Message to Presenters As a healthcare professional speaking on behalf of Bristol-Myers Squibb (BMS), any presentation you make on our behalf must be consistent with the current FDA-approved product labeling
More informationThe ABC s (and D & E s) of the Viral Hepatitides Part 2 DIAGNOSTIC TESTS 3/7/2013
The ABC s (and D & E s) of the Viral Hepatitides Part 2 Thomas Novicki PhD DABMM Clinical Microbiologist Division of Laboratory Medicine novicki.thomas@marshfieldclinic.org Objectives 2 1. Explain the
More informationSupplementary materials: Predictors of response to pegylated interferon in chronic hepatitis B: a
Supplementary materials: Predictors of response to pegylated interferon in chronic hepatitis B: a real-world hospital-based analysis Yin-Chen Wang 1, Sien-Sing Yang 2*, Chien-Wei Su 1, Yuan-Jen Wang 3,
More informationIdentified OAS3 gene variants associated with coexistence of HBsAg and anti- HBs in chronic HBV infection
Received: 1 January 2018 Accepted: 22 February 2018 DOI: 10.1111/jvh.12899 ORIGINAL ARTICLE Identified OAS3 gene variants associated with coexistence of HBsAg and anti- HBs in chronic HBV infection S.
More informationViral Hepatitis. Dr Melissa Haines Gastroenterologist Waikato Hospital
Viral Hepatitis Dr Melissa Haines Gastroenterologist Waikato Hospital Viral Hepatitis HAV HBV HCV HDV HEV Other viral: CMV, EBV, HSV Unknown Hepatitis A Hepatitis A Transmitted via the faecal-oral route
More informationViral hepatitis. The word hepatitis means inflammation of the liver. There are five main types of viral hepatitis: A, B, C, D, E
Viral hepatitis The word hepatitis means inflammation of the liver There are five main types of viral hepatitis: A, B, C, D, E Hepatitis A and E are typically caused by ingestion of contaminated food or
More informationRelation between serum quantitative HBsAg, ALT and HBV DNA levels in HBeAg negative chronic HBV infection
Relation between serum quantitative HBsAg, ALT and HBV DNA levels in HBeAg negative chronic HBV infection xxxxxxxxxxxxxxx Özgür Günal 1, Şener Barut 1, İlker Etikan 2, Fazilet Duygu 1, Umut Tuncel 3, Mustafa
More informationAnalysis of Reverse Transcriptase Gene Mutations in the Hepatitis B Virus at a University Hospital in Korea
Original Article Diagnostic Genetics Ann Lab Med 2014;34:230-234 http://dx.doi.org/10.3343/alm.2014.34.3.230 ISSN 2234-3806 eissn 2234-3814 Analysis of Reverse Transcriptase Gene Mutations in the Hepatitis
More informationSupplementary Information
Supplementary Information HBV maintains electrostatic homeostasis by modulating negative charges from phosphoserine and encapsidated nucleic acids Authors: Pei-Yi Su 1,2,3, Ching-Jen Yang 2, Tien-Hua Chu
More informationYuen, MF; Sablon, E; Yuan, HJ; Hui, CK; Wong, DKH; Doutreloigne, J; Wong, BCY; Chan, AOO; Lai, CL
Title Author(s) Relationship between the development of precore and core promoter mutations and hepatitis B e antigen seroconversion in patients with chronic hepatitis B virus Yuen, MF; Sablon, E; Yuan,
More informationIsolated Hepatitis B Core Antibody
NORTHWEST AIDS EDUCATION AND TRAINING CENTER Isolated Hepatitis B Core Antibody Nina Kim, MD MSc Associate Professor of Medicine November 13, 2014 Isolated Core Antibody Virology & terminology Definition
More informationOriginal Article Application of AFP whole blood one-step rapid detection kit in screening for HCC in Qidong
Am J Cancer Res 2017;7(6):1384-1388 www.ajcr.us /ISSN:2156-6976/ajcr0048028 Original Article Application of AFP whole blood one-step rapid detection kit in screening for HCC in Qidong Jie Jin 1*, Xiao-yan
More informationManagement of Hepatitis B - Information for primary care providers
Management of Hepatitis B - Information for primary care providers July 2018 Chronic hepatitis B (CHB) is often a lifelong condition. Not everyone infected needs anti-viral therapy. This document outlines
More informationHepatitis B: A Preventable Cause of Liver Cancer. Saira Khaderi MD, MPH Assistant Professor of Surgery Associate Director, Project ECHO June 17, 2016
Hepatitis B: A Preventable Cause of Liver Cancer Saira Khaderi MD, MPH Assistant Professor of Surgery Associate Director, Project ECHO June 17, 2016 Overview Epidemiology HBV and cancer Screening, Diagnosis
More informationChoice of Oral Drug for Hepatitis B: Status Asokananda Konar
Choice of Oral Drug for Hepatitis B: Status 2011 Asokananda Konar Chronic hepatitis B (CHB) is a global public health challenge with an estimated 350 to 400 million people with chronic HBV infection, despite
More informationSpontaneous hepatitis B e antigen (HBeAg) seroconversion
GASTROENTEROLOGY 2007;133:1466 1474 Pre-S Deletion and Complex Mutations of Hepatitis B Virus Related to Advanced Liver Disease in HBeAg-Negative Patients CHIEN HUNG CHEN,*, CHAO HUNG HUNG,* CHUAN MO LEE,*,,
More informationHepatitis B virus X gene in the development of hepatocellular carcinoma. Citation Hong Kong Medical Journal, 2011, v. 17 n. 6, suppl. 6, p.
Title Hepatitis B virus X gene in the development of hepatocellular carcinoma Author(s) Ma, NF; Lau, SH; Hu, L; Dong, SS; Guan, XY Citation Hong Kong Medical Journal, 2011, v. 17 n. 6, suppl. 6, p. 44-47
More informationOriginally published as:
Originally published as: Ratsch, B.A., Bock, C.-T. Viral evolution in chronic hepatitis B: A branched way to HBeAg seroconversion and disease progression? (2013) Gut, 62 (9), pp. 1242-1243. DOI: 10.1136/gutjnl-2012-303681
More informationWhat have we learned from HBV clinical cohorts?
PHC 2015: Hepatitis B What have we learned from HBV clinical cohorts? Jia-Horng Kao MD, Ph D Graduate Institute of Clinical Medicine, Hepatitis Research Center, Department of Internal Medicine, National
More informationRama Nada. - Malik
- 2 - Rama Nada - - Malik 1 P a g e We talked about HAV in the previous lecture, now we ll continue the remaining types.. Hepatitis E It s similar to virus that infect swine, so its most likely infect
More informationHepatitis B Virus therapy. Maria Buti Hospital Universitario Valle Hebron Barcelona Spain
Hepatitis B Virus therapy Maria Buti Hospital Universitario Valle Hebron Barcelona Spain Disclosures Advisor: AbbVie, Boehringer Ingelheim, Bristol-Myers Squibb, Gilead Sciences, Janssen, Merck Sharp &
More informationMutation in the Precore Region of HBV in Chronic Hepatitis B Patients
Mutation in the Precore Region of HBV in Chronic Hepatitis B Patients Kader O. 1, Metwally D.E. 1, Helaly G. F. 1, ElBatouti G. A. 2, Hassan M B 3 and Elsawaf R. 1 1 Microbiology Department, Medical Research
More informationHepatocellular Carcinoma: Can We Slow the Rising Incidence?
Hepatocellular Carcinoma: Can We Slow the Rising Incidence? K.Rajender Reddy M.D. Professor of Medicine Director of Hepatology Medical Director of Liver Transplantation University of Pennsylvania Outline
More informationCryptogenic cirrhosis is a diagnosis made after excluding
DOI 10. 5001/omj.2014.23 Original Articles Prevalence and Molecular Analysis of Occult Hepatitis B Virus Infection Isolated in a Sample of Cryptogenic Cirrhosis Patients in Iran Fatemeh Akhavan Anvari,
More informationAPPROACH TO A PATIENT WITH CHRONIC HEPATITIS B INFECTION. Dr. Mohammad Zahiruddin Associate Professor Department of Medicine Dhaka Medical College
APPROACH TO A PATIENT WITH CHRONIC HEPATITIS B INFECTION Dr. Mohammad Zahiruddin Associate Professor Department of Medicine Dhaka Medical College Mr. Alam is a 32 yr old welder, who has been selected for
More informationViral hepatitis Blood Born hepatitis. Dr. MONA BADR Assistant Professor College of Medicine & KKUH
Viral hepatitis Blood Born hepatitis Dr. MONA BADR Assistant Professor College of Medicine & KKUH Outline Introduction to hepatitis Characteristics of viral hepatitis Mode of transmission Markers of hepatitis
More informationMAJOR ARTICLE JID 2008:198 (1 December) Chen et al.
MAJOR ARTICLE Combined Mutations in Pre-S/Surface and Core Promoter/Precore Regions of Hepatitis B Virus Increase the Risk of Hepatocellular Carcinoma: A Case-Control Study Chien-Hung Chen, 1,2 Chi-Sin
More informationon January 29, 2019 by guest
CVI Accepts, published online ahead of print on 21 March 2012 Clin. Vaccine Immunol. doi:10.1128/cvi.05696-11 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10
More informationPharmacologyonline 2: 3-7 (2011) Case Report Singhal et al.
A CASE REPORT OF CLI ICAL ADVERSE EVE TS OF TELBIVUDI E I HEPATITIS B PATIE TS Manmohan Singhal 1, Dhaval Patel 1, Pankaj shah 2 1 School of Pharmaceutical Sciences, Jaipur National University, Jaipur,
More informationHepatitis B virus (HBV) infection is an important. Brief Communication
Brief Communication Hepatitis B Virus Infection in Children and Adolescents in a Hyperendemic Area: 15 Years after Mass Hepatitis B Vaccination Yen-Hsuan Ni, MD, PhD; Mei-Hwei Chang, MD; Li-Min Huang,
More informationHepatitis B. What's the impact on the risk? Dr Himanshu Bhatia, Asia Chief Medical Officer ALUCA, Brisbane, Sept 2013
Hepatitis B What's the impact on the risk? Dr Himanshu Bhatia, Asia Chief Medical Officer ALUCA, Brisbane, Sept 2013 Some quick facts about Hepatitis B Worldwide: 350-400 Million are chronic infections
More informationSequence analysis for VP4 of enterovirus 71 isolated in Beijing during 2007 to 2008
16 2009 3 4 1 Journal of Microbes and Infection, March 2009, Vol. 4, No. 1 2007 2008 71 VP4 1, 2, 2, 2, 1, 2, 2, 2, 1, 2 1., 100730; 2., 100020 : 2007 2008 71 ( EV71), 2007 3 EV71( 1, 2 ) 2008 5 EV71(
More informationTitle: Reactivation of a Hepatitis B without core antibody: a case report.
JCM Accepted Manuscript Posted Online 28 January 2015 J. Clin. Microbiol. doi:10.1128/jcm.03546-14 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 1 Title: Reactivation of a Hepatitis
More informationHuman leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis
Human leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis H.-Y. Zou, W.-Z. Yu, Z. Wang, J. He and M. Jiao Institute of Clinical Medicine, Urumqi General Hospital, Lanzhou
More informationLong-term Clinical Outcomes and Risk of Hepatocellular Carcinoma in Chronic Hepatitis B Patients with HBsAg Seroclearance
Long-term Clinical Outcomes and Risk of Hepatocellular Carcinoma in Chronic Hepatitis B Patients with HBsAg Seroclearance Gi-Ae Kim, Han Chu Lee *, Danbi Lee, Ju Hyun Shim, Kang Mo Kim, Young-Suk Lim,
More informationChange of Hepatitis B Large Surface Antigen Variants after 13 Years. Universal Vaccination Program in China
JVI Accepts, published online ahead of print on 4 September 2013 J. Virol. doi:10.1128/jvi.02127-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 1 2 3 Change of Hepatitis B
More informationHepatitis B Virus infection: virology
Hepatitis B Virus infection: virology 167 Falk Symposium: Liver under constant attack from fat to viruses III Falk Gastro-Konferenz 17.-21. September 2008 Congress Centrum Mainz Maura Dandri Department
More informationAccepted Manuscript. Unexpected high incidence of hepatocellular carcinoma in patients with hepatitis C in the era of DAAs: too alarming?
Accepted Manuscript Unexpected high incidence of hepatocellular carcinoma in patients with hepatitis C in the era of DAAs: too alarming? Qing-Lei Zeng, Zhi-Qin Li, Hong-Xia Liang, Guang-Hua Xu, Chun-Xia
More informationFinal Clinical Study Report. to the Dossier SYNOPSIS. Final Clinical Study Report for Study AI463110
BMS-475 AI463 Name of Sponsor/Company: Bristol-Myers Squibb Individual Study Table Referring to the Dossier For National Authority Use Only) Name of Finished Product: Baraclude Name of Active Ingredient:
More informationLab Underwriting Puzzler. Presented by: Bill Rooney, M.D.
Lab Underwriting Puzzler Presented by: Bill Rooney, M.D. Obtaining Best Results from this presentation For best results please do the following: Select Slide Show from the menu option on top Select From
More informationAnnals of Oncology, Volume 26, Issue suppl_9, 1 December 2015, Pages ix3, Published: 19 December 2015
We Article use Navigation cookies to enhance your experience on our website. By clicking 'continue' or by continuing to use our website, you are agreeing to our use of cookies. You can change your cookie
More informationRelationship Between GSTT1 Gene Polymorphism and Hepatocellular Carcinoma in Patients from China
RESEARCH ARTICLE Relationship Between GSTT1 Gene Polymorphism and Hepatocellular Carcinoma in Patients from China Jie Chen, Liang Ma, Ning-Fu Peng, Shi-Jun Wang, Le-Qun Li* Abstract Objective: The results
More informationEstimation of Seroprevalence of Hepatitis B Virus and Hepatitis C Virus in Taiwan from a Large-scale Survey of Free Hepatitis Screening Participants
ORIGINAL ARTICLE Estimation of Seroprevalence of Hepatitis B Virus and Hepatitis C Virus in Taiwan from a Large-scale Survey of Free Hepatitis Screening Participants Chien-Hung Chen, 1 Pei-Ming Yang, 1
More informationConsensus AASLD-EASL HBV Treatment Endpoint and HBV Cure Definition
Consensus AASLD-EASL HBV Treatment Endpoint and HBV Cure Definition Anna S. Lok, MD, DSc Alice Lohrman Andrews Professor in Hepatology Director of Clinical Hepatology Assistant Dean for Clinical Research
More informationDiabetes mellitus may affect the long-term survival of hepatitis B virus-related hepatocellular carcinoma patients after liver transplantation
Submit a Manuscript: http://www.wjgnet.com/esps/ Help Desk: http://www.wjgnet.com/esps/helpdesk.aspx DOI: 10.3748/wjg.v22.i43.9571 World J Gastroenterol 2016 November 21; 22(43): 9571-9585 ISSN 1007-9327
More informationCharacterization of Occult Hepatitis B Virus Infection from Blood Donors in China
JOURNAL OF CLINICAL MICROBIOLOGY, May 2011, p. 1730 1737 Vol. 49, No. 5 0095-1137/11/$12.00 doi:10.1128/jcm.00145-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Characterization
More informationCDC website:
Hepatitis B virus CDC website: http://www.cdc.gov/ncidod/diseases/hepatitis/slideset/hep_b/slide_1.htm Relevance Key Features es of Hepatitis t B Virus 250 million people infected worldwide. In areas of
More information