with That in Simultaneously Collected Urethra and Cervix Samples

Transcription

1 JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 1993, P /93/ $02.00/0 Copyright 1993, American Society for Microbiology Vol. 31, No. 8 Human Papillomavirus DNA in Urine Samples Compared with That in Simultaneously Collected Urethra and Cervix Samples OLA FORSLUND,l* BENGT GORAN HANSSON,l PER RYMARK,2 AND BENGT BJERRE2 Section of Clinical Virology, Department ofmedical Microbiology, 1 and Department of Obstetrics and Gynecology,2 University oflund, Malmo General Hospital, S Malmo, Sweden Received 14 January 1993/Accepted 4 May 1993 A polymerase chain reaction was used to evaluate the occurrence of human papillomavirus (HPV) DNA in urine samples compared with that in urethra and cervix samples simultaneously collected with brushes. Of 138 presumably healthy military conscripts, 12 (8%) had -positive urethra samples and 8 (5%) had HPV DNA-positive urine samples. Both the urine and urethra cell samples of five men were positive, with identical types found in the paired specimens. Seven had E-positive urethra samples only, and three had HPV DNA-positive urine samples only. Five of 7 urethra samples from males and 11 of 12 urethra samples from females, who were among patients consulting a clinic for adolescents, were positive for. Among those patients whose urethras were positive for, the corresponding urine samples of 3 of the 5 men and all the 11 women were also positive, with one or two HPV types being in common within the paired samples. Among female patients referred to a colposcopy clinic, 49%o (241 of 489) of the cervical cell samples and 38% (187 of 489) of the urine specimens were found to be positive. Of the patients whose cervixes were positive for, 65% (158 of 241) of the simultaneously collected urine samples were also positive for. On the other hand, 84% (158 of 187) of the patients with in their urine also had HPV DNA in their cervical samples. Although not all individuals with genital HPV infections could be identified as HIPV positive by analysis of urine samples, at least in epidemiological surveys in which invasive samples are difficult to obtain, such as from children, analysis ofurine could be an alternative means of identifying. More than 60 types of human papillomaviruses (HPV) have been identified. Some 25 of them have been found in genital specimens and are believed to be transmitted sexually (1, 9). detection in urine has been described in two reports (4, 5). By using the polymerase chain reaction (PCR) technique, was found in urine samples from 88% of male patients with condyloma acuminata in the meatus urethrae (4), and in the other study (5), HPV type 16 (HPV 16) DNA could be detected in urine samples from two of eight males whose wives were positive for HPV 16 DNA in their cervix uteri. Thus, if can easily be demonstrated in urine samples, this noninvasive and simple sampling approach could be considered for use in epidemiological surveys of genital HPV infections. The aim of the present study was therefore to investigate some groups of male and female patients for the presence of in their urine samples and compare those findings with those obtained for simultaneously collected urethra and/or cervical brush samples. MATERIALS AND METHODS Patients and samples. Urine samples from group I and II patients (see below) were always collected before specimens from the urethra were taken. At the time of the visit to the clinic, the patients were asked to provide urine in a plastic cup (210 ml). Urine volumes of between 10 and 200 ml were usually obtained. Approximately 10 ml of the urine was then poured into a plastic tube and was stored in a refrigerator until it was further processed on the same day. Morning urine samples were not used because such samples showed * Corresponding author a low amplification efficiency of a sequence of the 3-globin gene, which was used as an internal control of the PCR. The genitalia of the patients were not washed before the samples were obtained. Three groups of patients were enrolled in the study. Group I patients consisted of 138 military conscripts (mean age, 21 years; range, 20 to 23 years) who had been randomly selected at a campus in south Sweden. The examination was done in October A total of 143 men participated voluntarily, but 5 (3.5%) were excluded because their urine samples were negative in the 0-globin DNA test. Urine was collected from each of the men, and a urethra cell sample was taken with a specially designed brush (Accellon; Medscand, Malmo, Sweden) that was prewetted in 0.15 M NaCl. It was inserted about 1 cm into the urethra and rotated 360 degrees. The genitalia were inspected macroscopically, and when lesions were found (four patients had lesions at the posterior margin of the glans), cell scrapes were collected with a brush (Cytobrush; Medscand) that was prewetted in 0.15 M NaCl and rotated 360 degrees on the surface of the lesion. Group II patients consisted of 12 females without current menstrual bleeding plus 8 males (mean age, 19 years; range, 17 to 22 years). These patients were randomly selected from among those who were seen at a clinic for adolescents in Malmo, Sweden, between August and November Paired urine and urethra cell samples from each patient were collected and analyzed. Many patients had a history of sexually transmitted disease, genital warts, or a partner with genital warts. For sample collection from the females, a speculum was inserted into the vagina and a cell sample was taken from the endocervix by using a brush (Cytobrush) which was rotated 360 degrees. Cell samples from the

2 1976 FORSLUND ET AL. urethra were collected with a cotton-tipped sampling swab (Bio Hospital AB, Kopparberg, Sweden), which was inserted about 1 cm and rotated 360 degrees. Samples were taken from visible lesions by using a brush (Cytobrush) which was rotated 360 degrees on the surface of the wart. Three of the females had visible lesions in the vulva. The samples from all the females were strictly collected in the following order: urine, cervix, urethra, and lesion. For sample collection from the male urethra, a cotton swab was inserted approximately 1 cm and rotated 360 degrees. A brush (Cytobrush) was used to collect cells from visible lesions. Two males had lesions at the posterior margin of the glans. One male was excluded because his urine sample had a negative P-globin DNA test result. Patient group III consisted of 343 women (mean age, 37 years; range, 17 to 79 years) referred to a colposcopy clinic at Malmo General Hospital in 1990 and 1991 because of suspected cytological changes found at routine gynecological health examination. One sample was taken from the surface of the portio of each of the patients with a wooden spatula (Ayre) and one sample for cytological analysis was obtained from the endocervix of each patient with a brush (Cytobrush). Another brush (Cytobrush) was drawn three times over the surface of the portio and was then washed out in 1 ml of 0.15 M NaCl and sent for analysis. After the gynecological examination, a urine sample was obtained without prior washing of the genitalia. The first portion (approximately 10 ml) was used for analysis. Since many of the patients were seen more than of 489 paired urine and cervix samples from once, a total these 343 patients were analyzed for. A total of 512 paired samples were collected, but 23 (4.4%) of the patients were excluded from the study because their urine samples had a negative,3-globin DNA test result. The patients were divided into four groups: 315 patients with a benign diagnosis, 23 patients with condyloma acuminata (5 patients with vulva condyloma and 18 patients with portio condyloma), 39, 31, and 77 patients with cervical intraepithelial neoplasia (CIN) stages 1, 2, and 3, respectively, and 4 patients with invasive cancer. In this report, the patients with different CIN stages are recorded as one group. The diagnosis of all patients was made by one gynecologist on the basis of the combined results of the cytological, colposcopical, and histological analyses but without knowledge of the test result. The project was approved by the Committee on Ethics of the University of Lund. analysis. (i) Processing of samples. The urine specimens were centrifuged at 2,100 x g for 10 min at room temperature. The pellets were resuspended in 1.5 ml of 0.15 M NaCl, transferred to 2-ml Eppendorf tubes, and centrifuged at 4,400 x g for 5 min at room temperature, after which the pellets were stored at -20 C until they were analyzed. The urethra, cervix, and lesion samples were collected with brushes and were thereafter suspended in 0.15 M NaCl. The cell material was pelleted by centrifugation at 4,400 x g for 5 min at room temperature and was then stored at -20 C until it was tested. Before the PCR analysis, all cell pellets were treated with proteinase K as described elsewhere (7). PCR. Five microliters of each sample was added to each of four tubes containing 45,ul of the PCR mixture with various combinations of primers. PCRs with primers for HPV 6, 11, and 33 and for HPV 16 and 18 were run in two separate tubes as described elsewhere (7). PCR with primers for HPV 31 selected from the published DNA sequence (2) (E6 region; J. CLIN. MICROBIOL. primer 1 [positions 151 to 170], 5'-TAAGCTCGGCATTGGA AATA-3'; primer 2 [positions 500 to 481], 5'-CCTTCCTCC TATGTTGTGGA-3'; probe [positions 201 to 240], 5'-TAC TGCAAAGGTCAGTTAACAGAAACAGAGGTATTAGA TT-3'), HPV 35 (3) (E6 region, primer 1 [positions 80 to 99], 5'-CAGAAGTGGACAGACATTGT-3'; primer 2 [positions 300 to 281], 5'-ATGCATACTCCATATGGCTG-3'; probe [positions 151 to 190], 5'-lTTGTGCAACGAGGTAGAAG AAAGCATCCATGAAATITGT-3'), and,3-globin (internal PCR control, primers PC 03 and PC 04 and probe RS 06) (8) was run in a third tube with cycling parameters as described above for HPV 6, 11, and 33. To amplify of types other than those found with the type-specific primers, PCR of a fourth tube with consensus primers (10) was run with cycling parameters of 94 C for 4.5 min and then 40 cycles of 94 C for 30 s, 45 C for 30 s, 720 for 45 s, and finally, 72 C for 5 min. We also included 0.2% bovine serum albumin (fraction V; Boehringer Mannheim) in the PCR mixture, since it has been shown that albumin overcomes an inhibitory activity of unknown origin in archaeological samples (6). The same effect has also been shown in some samples in our laboratory. For each run in the thermal reactor, tubes with purified clones of appropriate HPV types (5 fg of HPV 16, 31, and 35 and 50 fg of HPV 6, 11, 18, and 33) and proteinase K-treated human lung fibroblasts were used as positive and negative controls, respectively. Also, a PCR tube without any template was used as an additional negative control in each run. The precautions used for the elimination of contamination are described elsewhere (7). Because we examined a large number of samples, dot blot analysis of the PCR producs and hybridization with a 32p ([a- 2p]ddATP; Amersham)-labeled (DNA 3'-End Labeling Kit; Boehringer Mannheim) internal oligonucleotide probe with a specific activity of approximately 108 cpm/,ig provided a convenient method of identifying amplified HPV DNA. Hybridization with the type-specific probes was done under conditions of high stringency as described elsewhere (7), while hybridization with a generic probe mix (10) was done under conditions of low stringency (30% formamide, hybridization at 42 C, and washing at 50 C, with, otherwise, the same conditions as were used for the type-specific probes). A sample was counted as positive if a clear-cut signal from one or more of the hybridizations with the type-specific and/or the generic probes was seen on the X-ray film after 1 to 3 days of autoradiography. In case a sample was PCR negative for the 3-globin gene, a simple phenol-free DNA extraction was performed. The sample was incubated with 400,ul of lysis buffer (10 mm Tris-HCl, 10 mm NaCl, 10 mm EDTA [ph 7.8]) plus 4% sodium dodecyl sulfate and proteinase K (200 p,g/ml; Boehringer Mannheim) for 4 h at 370C. A total of 120,ul of saturated ammonium acetate was added, and the tube was vortexed for 20 s and then centrifuged at 17,600 x g for 15 min. The supernatant was transferred to a new tube and the DNA was precipitated with 900,ul of ethanol for 30 min at -20 C. After centrifugation at 17,600 x g for 7.5 min, the resulting pellet was washed once with 500,ul of 95% ethanol. The pellet was dried briefly and was then dissolved in 100 p,l of TE buffer (10 mm Tris-HCl, 0.1 mm EDTA [ph 8.0]). Statistical analysis. Fisher's exact test and the chi-square test were used for analysis of the distribution of patients with -positive urethra or cervix samples whose paired urine samples were also positive for. The kappa test was used for agreement analysis of results

3 VOL. 31, 1993 HPV IN URINE 1977 TABLE 1. in urine samples and simultaneously collected urethra specimens from military conscripts (group I) and patients consulting a clinic for adolescents (group II) No. of patients in the following groups with the indicated result for the urethra: result for Group I Females in group II Males in group II All groups urine + - Sum + - Sum + - Sum + - Sum Positive Negative Total between urine and from simultaneously collected urethra or cervix specimens. The significance of the difference between results for urine and those for urethra or cervix specimens collected in parallel was analyzed by the use of McNemar's test (corrected for continuity). RESULTS Group I patients. DNA extraction had to be performed on 18 (13%) of the urine and 7 (5%) of the urethra samples from the military conscripts because of negative 3-globin DNA results in the initial test run. However, five (3.5%) of the urine samples were also negative after extraction and were therefore excluded from the study, together with the corresponding urethra cell samples. Of the remaining 138 men, the urethra samples of 12 (8%) and the urine samples of 8 (5%) were positive for. Five men were positive for at both sites, seven had -positive urethras only, and three had -positive urine only (Table 1). Of the 12 patients with -positive urethras, 5 had in the paired urine samples. Of the men with in both the urine and urethra cell samples, the paired specimens were found to have identical types (Table 2). Four individuals had visible lesions at the posterior margin of the glans. All lesions were positive for, but in only one patient was the same type detected at all three locations. With the consensus primers, two individuals were found to have positive urine samples only (Table 2). The results for urine were not significantly different from those for urethra cell specimens (P = 0.34), and the agreement between the two types of samples was fair (K = 0.46). Group II patients. The samples from the patients attending the clinic for adolescents were analyzed by PCR with the HPV consensus and the,b-globin primers, but the typespecific HPV primers were limited to those for HPV 6, 11, 16, 18, and 33. Five of the 7 urethra samples from the men and 11 of the 12 urethra samples from the women were positive for. Of the urethra-positive patients, the corresponding urine samples of 3 of the 5 men and all 11 women were also positive, with one or two HPV types found to be common between the paired samples (Table 2). No patient had only an -positive urine sample (Table 1). All six cervical samples analyzed contained. For five of these patients, the same HPV types were identified in the cervix, urine, and urethra samples. For the sixth patient, the cervix was positive for only with the consensus primers, while type 33 was found in both urine and the urethra. Three females had lesions in the vulva that contained two or three types which were also found in the urine specimens. A sample had been collected from the cervix of one of them, and it was shown to contain HPV 16 DNA, just as was found in the lesion, urine, and urethra samples (Table 2). Two of the men had HPV DNA-positive condylomata at the posterior margin of the glans. From one of these patients, of the same type was also detected in the urethra brush sample (Table 2). The agreement between results for urine and urethra specimens from the males and the females were fair TABLE 2. HPV types in urine and simultaneously collected urethra, cervix, and lesion samples Patient HPV type in: no.' Urine Urethra Cervix Lesion Xb NEGC 7 35 NEG 18, 35 8 X NEG 9 NEG X 10 NEG X 11 NEG NEG NEG NEG X 15 NEG NEG NEG NEG NEG 139 6, 16 6, , , X NCd NC NC 148 6, 11 6, 11, 18 NC 6, 11, , 16 11, 16 NC 11, NEG NEG NC , NEG NEG NEG NEG 157 NEG NEG 16, 18 a Patients 1 to 138, military conscripts (group I); patients 139 to 150, females consulting a clinic for adolescents (group II); patients 151 to 157, males consulting a clinic for adolescents (group II). Patients 139 to 157 were not tested for HPV 31 or HPV 35. b X, was detected with consensus primers only. c NEG, negative result. d NC, no sample was collected.

4 1978 FORSLUND ET AL. J. CLIN. MICROBIOL. TABLE 3. in urine samples and simultaneously collected cervix specimens from patients referred to a colposcopy clinic (group III) No. of patients with following diagnosis and the indicated result for the cervix: result for Benign Condyloma CIN Cervical cancer All diagnoses urine + - Sum + - Sum + - Sum + - Sum + - Sum Positive Negative Total (K = 0.46) and excellent (K = 1.0), respectively. For group I and II patients combined, the results for urine were not significantly different from those for urethra samples (P = 0.15), and the agreement between the two kinds of samples was good (K = 0.74). Group III patients. DNA extraction had to be performed on 56 (11%) of the urine and 19 (3.7%) of the cervix samples because of initially negative p-globin DNA tests. Twentythree (4.4%) of the urine samples were still 0-globin DNA negative after extraction and were therefore excluded from the study, together with the cervix samples that had been collected in parallel. Of the remaining paired samples, HPV DNA was found in 49% (241 of 489) of the cervix samples and 38% (187 of 489) of the urine samples. The fraction of patients with -positive cervix samples whose simultaneously collected urine specimens were also positive for was 55% (56 of 101) for patients with a benign diagnosis, 83% (15 of 18) for patients with condyloma acuminata, 71% (85 of 119) for patients with CIN and 67% (2 of 3) for patients with invasive cervical cancer. In total, 66% (158 of 241) of the patients with -positive cervix samples had corresponding urine samples that were HPV DNA positive (Table 3). in the urine from patients with -positive cervix samples was significantly more frequently found in patients with CIN and cancer than in the group of patients with a benign diagnosis (P < 0.05). The fraction of patients with -positive urine and cervix samples was 72% (56 of 78) for patients with a benign diagnosis, 88% (15 of 17) for patients with condyloma acuminata, 94% (85 of 90) for patients with CIN, and 100% (2 of 2) for patients with invasive cervical cancer. A total of 84% (158 of 187) of the patients with positive urine samples also had -positive cervix specimens (Table 3). The agreement between the results for paired urine and cervix samples was fair (K = 0.48) for patients with a benign diagnosis, fair (K= 0.40) for patients with condylomata, poor (K= 0.38) for patients with CIN, and fair (K =0.50) for patients with cervical cancer. However, for the whole group, the results for urine were significantly different from those for cervix samples (P < 0.001), and the agreement between urine and cervix samples was fair (K = 0.54). Among the 158 patients with -positive cervix and urine samples, one or two identical HPV types were found in 143 (91%) of the paired specimens (Table 4). Six percent (29 of 489) of the patients were found to have -positive urine samples only (Table 3). Most of these patients (22 patients) belonged to the group with a benign diagnosis. Nine of the patients with -positive urine only contained HPV DNA 16, including one patient with a double infection (HPV 16 and 18) and one patient with a triple infection (HPV 16, 31, and 35). Ten urine samples were positive for of either of the 6, 31, 33, or 35 types, and 10 were positive with the consensus primers only. DISCUSSION Although not all individuals with genital HPV infections can be identified by analysis of urine samples, at least in epidemiological surveys in which invasive sampling is difficult to perform, such as in children, testing of urine for HPV DNA could be considered. The occurrence of in urine samples from all groups of patients except the females in group II was found to be less than that in urethra or cervix samples. The reason for this could be a low efficiency of PCR because of the presence of inhibitory substances in the urine or the loss of during the processing of the urine samples or that the urine samples were truly negative. On the other hand, when the urine samples were found to be HPV DNA positive, the parallel urethra (groups I and II) or cervix (group III) samples from 86% (19 of 22) and 84% (158 of 187) of the patients, respectively, were also found to be positive. Of the 17 males whose urethras were positive, paired urine samples of only 8 (47%) were found to be positive. However, the simultaneously collected urine samples from all 11 urethra-positive females from group II were found to be positive. Thus, in urine samples from individuals with positive urethra samples was found significantly more frequently in females (group II) than in males (groups I and II) (P < 0.01). If there is a lower copy number in the male epithelial cell layer of the urethra than in the female epithelial cell layer, a negative result in the HPV analysis of some urine samples might occur, although the corresponding urethra brush sample would be positive. In some cases, urine from women can probably be contaminated with HPV-infected cells from the cervix and vagina, with the potential risk of generating false-positive results in the urine samples. TABLE 4. Distributions of typed and untyped HPV findings among 158 -positive cervix and urine samples collected in parallel from patients in group IIa No. of patients result for urine Typed HPV Untyped HPV Sum Typed HPV 143a Untyped HPV Total a One or two identical HPV types were found in the simultaneously collected cervix and urine samples.

5 VOL. 31, 1993 was detected in the urine of three males in group I, but it was not found in their urethra samples. One of them harbored HPV 35 in a penile lesion and the urine sample, but was not detected in the urethra sample. From the two other men, of unknown type was detected in the urine only. Theoretically, in these patients the HPV infection could be located higher up in the urethra and a sample from the infected site could not be obtained with the brush sampler. Six percent (29 of 491) of the patients in group III were found to have positive urine samples only. Either there was no ongoing cervical HPV infection among these women or, less likely, they harbored the infection but the area reached by the sampling brush was free of infected cells. Some of these women might also have had cervical infections which had regressed, while the infection still persisted in other sites such as the urethra. It is noteworthy that after proteinase K digestion, 13% (18 of 143) and 11% (56 of 512) of the urine samples from patients in groups I and III, respectively, were found to be,-globin DNA negative. However, by a simplified DNA extraction, the number of 3-globin DNA-negative urine samples was reduced to 3.5% (5 of 143) and 4.4% (23 of 512) in the two groups, respectively. All urethra and cervix cell samples which were negative in the initial 3-globin DNA test became positive after DNA extraction. The results indicate that there might be inhibitors that are especially common in urine or that the DNA in some urine samples could be degraded and not be suitable for PCR. It is less probable that the DNA contents of these urine samples were too low to be detected by the 3-globin DNA test. It is possible that DNA extraction of the urine specimens with phenol-chloroform would further reduce the number of 3-globin DNA-negative samples. has previously been demonstrated in urine samples from patients with condylomata in the meatus urethrae (4) and two of eight men without clinical symptoms of HPV infections but whose wives had HPV 16 infections in their cervix uteri (5). However, the results of the present study show that the frequency of -positive urine samples is lower than that of urethra or cervix samples collected in parallel. Also, our data reveal that the agreement between results for urine and urethra specimens varies from fair to excellent, and when the parallel specimens are from the cervix, the agreement varies from poor to fair. For paired urine and urethra specimens, there was no significant difference in the results, but a significant difference was found for urine and cervix specimens obtained in parallel (P < 0.001). The difference in the HPV DNA results between urine and cervix samples could be explained by the fact that cells from two different sites were collected. The analysis of urine samples needs to be improved before urine can replace brush samples. It is HPV IN URINE 1979 possible that a greater amount of urethral cells in the urine sample could improve the sensitivity of the test. Thus, the first portion of the urine stream should be used and the time interval from the previous urination should be as long as possible. To our knowledge, this is the first report dealing with HPV DNA detection in urine compared with that in simultaneously collected cell samples from the urethra and/or cervix and, when found, from warts on the penis or vulva. ACKNOWLEDGMENTS We are grateful to Erik Nordenfelt for critical reading of the manuscript. The project was supported by grants from the Malmo General Hospital Cancer Foundation and the local program for defeat of human immunodeficiency virus and AIDS. REFERENCES 1. De Viuliers, E. M Heterogeneity of the human papillomavirus group. J. Virol. 63: Goldsborough, M. D., D. DiSilvestre, G. F. Temple, and A. T. Lorincz Nucleotide sequence of human papillomavirus type 31: a cervical neoplasia-associated virus. Virology 171: Marich, J. E., A. V. Pontsler, S. M. Rice, K. A. McGrav, and T. W. Dubensky The phylogenetic relationship and complete nucleotide sequence of human papillomavirus type 35. Virology 186: Melchers, W. J. G., R. Schift, E. Stoltz, J. Lindeman, and W. G. V. Quint Human papillomavirus detection in urine samples from male patients by the use of polymerase chain reaction. J. Clin. Microbiol. 27: Nakazawa, A., M. Inoue, M. Fujita, 0. Tanizawa, and A. Hakura Detection of human papillomnavirus type 16 in sexual partners of patients having cervical cancer by polymerase chain reaction. Jpn. J. Cancer Res. 82: Paabo, S., J. A. Gifford, and A. C. Wilson Mitochondrial DNA sequences from a 7000 year old brain. Nucleic Acids Res. 16: Rymark, P., 0. Forslund, B. G. Hansson, and K. Lindholm Genital HPV infection not a local but a regional infection. Experience from a female teenage group. Genitourin. Med. 69: Saiki, R. K., S. Scharf, F. Faloona, K. B. Mullis, G. T. Horn, H. A. Erlich, and N. Arnheim Enzymatic amplification of P-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230: Syijinen, K Epidemiology of human papillomavirus (HPV) infections and their associations with genital squamous cell cancer. APMIS 97: Ting, Y., and M. M. Manos Detection and typing of genital human papillomaviruses, p In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, Inc., San Diego, Calif.