MRC-Holland MLPA. Description version 05; 03 April 2019
|
|
- Roderick Bryan
- 5 years ago
- Views:
Transcription
1 SALSA MLPA probemix ME012-A1 MGMT-IDH1-IDH2 Lot A Glioblastoma, the most common malignant primary brain tumour, is characterised by aggressive behaviour and a poor survival. Hypermethylation in the promoter region of the MGMT gene, encoding for the DNA repair enzyme O 6 -methylguanine-dna methyltransferase, is an important prognostic marker and predictor for response to treatment with alkylating agents such as temozolomide (Weller M et al. 2009, J Clin Oncol. 27: ; Hegi ME et al. 2005, N Engl J Med. 352: ; Pegg AE 1990, Mutat Res. 233:165-75). Another important diagnostic and prognostic marker in glioma is the IDH1 and IDH2 mutation status (Riemenschneider MJ et al. 2010, Acta Neuropathol. 120:567-84; van den Bent MJ et al. 2010, Clin Cancer Res. 16: ). The presence of IDH1 or IDH2 mutation is suggested to associate with favourable prognosis and a longer survival of glioma patients (Sanson M et al. 2009, J Clin Oncol. 27: ; Zou P et al. 2013, PLoS One. 8(7):e68782). The IDH1/2 mutations described are not activating or inactivating, but probably result in altered enzymatic properties (Hartmann C et al. 2009, Acta Neuropathol. 118:469-74). Assessment of both the IDH1 mutation status and the MGMT methylation status is proposed to be used as a combined predictor for glioblastoma patient survival (Wick W et al. 2013, Neurology. 81: ). Combined assessment of IDH1 mutations and MGMT methylation status is suggested to predict survival in glioblastoma better than either IDH1 or MGMT alone (Molenaar RJ et al. 2014, Neuro Oncol. 16: ). This SALSA MS- probemix ME012-A1 contains six MS-MLPA probes that detect the methylation status of the MGMT gene promoter. Moreover, this probemix contains four mutation-specific probes to identify the four most predominant IDH1 (p.r132h and p.r132c) and IDH2 (p.r172k and p.r172m) point mutations in glioma. In addition, 18 reference probes that are not affected by HhaI digestion have been included in this probemix, detecting different autosomal chromosomal locations that are relatively stable in glioma samples. Besides detecting aberrant methylation, all MGMT probes present in this probemix will give information on copy number status of the sequences targeted in the analysed sample. The MS-MLPA probes in this ME012-A1 probemix detect sequences in the promoter region of the MGMT gene that are unmethylated in most blood-derived DNA samples. Upon digestion, the peak signal obtained in unmethylated samples will be very small or absent. In contrast, when tested on in vitro methylated human DNA, these probes do generate a signal. We have no data showing that methylation detected by a particular probe indeed influences the corresponding mrna levels. SD054 Sample DNA Please note that the mutation-specific probes have only been tested on artificial sample DNA and not on positive human DNA samples with the IDH1 (p.r132h=c.395g>a and p.r132c=c.394c>t) or IDH2 (p.r172k=c.515g>a and p.r172m=c.515g>t) point mutations! This SD054 sample DNA is provided with each probemix vial and can be used in data binning in the fragment analysis and as a positive control for the mutation-specific probes (see page 3). This SALSA MS- probemix can be used to detect aberrant methylation of one or more sequences of the MGMT gene. Methylation levels can be different for different tissues. If possible, use identically treated test and reference samples (same tissue type and extraction method). This SALSA MS- probemix can also be used to detect deletions/duplications of one or more sequences in the aforementioned gene and to detect the presence of the aforementioned point mutations in a DNA sample. Heterozygous deletions of recognition sequences should give a 35-50% reduced relative peak height of the amplification product of that probe. Note that a mutation or polymorphism in the sequence detected by a probe can also cause a reduction in relative peak height, even when not located exactly on the ligation site! In addition, some probe signals are more sensitive to sample purity and small changes in experimental conditions. Therefore, deletions and duplications detected by MLPA should always be confirmed by other methods. Not all deletions and duplications detected by MLPA will be pathogenic; users should always verify the latest scientific literature when interpreting their findings. Finally, note that small (point) mutations cannot be detected by this SALSA MS- test. We have no information on what percentage of defects in these genes is caused by deletions/duplications of complete exons. SALSA MS- probemixes and reagents are sold by for research purposes and to demonstrate the possibilities of the MLPA technique. They are not CE/FDA certified for use in diagnostic procedures. Purchase of the SALSA MS- test probemixes and reagents includes a limited license to use these products for research purposes. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 1 of 11
2 The use of this SALSA MS- probemix and reagents requires a thermocycler with heated lid and sequence type electrophoresis equipment. Different fluorescent PCR primers are available. The MLPA technique has been first described in Nucleic Acid Research 30, e57 (2002). The MS-MLPA method for the detection of both copy numbers and methylation changes was described in Nucleic Acid Research 33, e128 by Nygren et al. in More information Website : info@mlpa.com (information & technical questions); order@mlpa.com (for orders) Mail : bv; Willem Schoutenstraat 1, 1057 DL Amsterdam, the Netherlands Related SALSA probemixes P088 Oligodendroglioma 1p-19q: Contains probes for the 1p, 19q and 9p21.3 regions, and IDH1/2 point mutations. P105 Glioma-2: Contains probes for the detection of EGFR deletions (that result in EGFRvIII); and probes for the PTEN, CDKN2A, TP53, PDGFRA, NFKBIA and CDK4-MIR26A2-MDM2 genes. P370 BRAF-IDH1-IDH2: Contains probes to detect genomic duplications leading to the KIAA1549-BRAF and SRGAP3-RAF1 fusion genes, and identify BRAF, IDH1/2 point mutations. Methylation-specific MLPA Please note that each MS-MLPA reaction generates two samples that need analysis by capillary electrophoresis: one undigested sample for copy number detection and one digested sample for methylation detection. A modification of the MLPA technique, MS-MLPA allows the detection of both copy number changes and unusual methylation levels of different sequences in one simple reaction. MLPA probes for methylation quantification are similar to normal MLPA probes, except that the sequence detected by the MS-MLPA probe contains the sequence recognised by the methylation-sensitive restriction enzyme HhaI. Similar to ordinary MLPA reactions, the MS-MLPA protocol starts with sample DNA denaturation and overnight hybridization. The reaction then is split into two tubes. One tube is processed as a standard MLPA reaction. This reaction provides information on copy number changes. The other tube of the MLPA hybridization reaction is incubated with the methylation-sensitive HhaI endonuclease while simultaneously, the hybridised probes are ligated. Hybrids of (unmethylated) probe oligonucleotides and unmethylated sample DNA are digested by the HhaI enzyme. Digested probes will not be exponentially amplified by PCR and hence will not generate a signal when analysed by capillary electrophoresis. In contrast, if the sample DNA is methylated, the hemi-methylated probe-sample DNA hybrids are prevented from being digested by HhaI and the ligated probes will generate a signal. The MS-MLPA technique should always be internally validated before use in your laboratory. Results of MS- MLPA are highly dependent on the HhaI enzyme used. HhaI enzymes that are resistant to heat inactivation are NOT compatible with the MS-MLPA technique and will give aberrant results. These include, but may not be limited to, Thermo Fisher Scientific enzymes HhaI, ANZA 59 HhaI, and FastDigest HhaI. We recommend using Promega s HhaI enzyme (R6441) as this is the only restriction enzyme that has been validated for use with MS-MLPA by. More information about MS-MLPA can be found in the MS-MLPA protocol. Please note that this product can not be used with an alternative protocol in which the genomic DNA is first digested with HhaI, followed by MLPA reactions on both digested and undigested genomic DNA. Digestion control probes The target sequences of the digestion control probes are unmethylated in most blood-derived DNA samples. The signals of the digestion control probes should be absent upon complete digestion by HhaI. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 2 of 11
3 Data analysis The ME012-A1 MGMT-IDH1-IDH2 probemix contains 31 MLPA probes with amplification products between 121 nt and 317 nt. This includes four probes specific for the IDH1 p.r132h (c.395g>a), IDH1 p.r132c (c.394c>t), IDH2 p.r172k (c.515g>a) and IDH2 p.r172m (c.515g>t) point mutations, which will only generate a signal when the corresponding mutation is present. Please note that background signals of the mutation-specific probes can be observed above the threshold for probe recognition in some cases. Users should always compare the peak height of the mutation-specific probes in mutation-positive samples to the peak height in reference samples. In addition, it contains nine control fragments generating an amplification product smaller than 110 nt: four DNA Quantity fragments (Q-fragments) at nt, three DNA Denaturation control fragments (D-fragments) at nt, one X-fragment at 100 nt and one Y-fragment at 105 nt. More information on how to interpret observations on these control fragments can be found in the MLPA protocol. SD054 Sample DNA The SD054 Sample DNA provided with this probemix can be used as Binning DNA sample for binning of four mutation-specific probes: IDH1 probe L16492 at 203 nt (p.r132h=c.395g>a), IDH1 probe L29107 at 225 nt (p.r132c=c.394c>t), IDH2 probe L29002 at 145 nt (p.r172k=c.515g>a) and IDH2 probe L29001 at 151 nt (p.r172m=c.515g>t). Inclusion of one reaction with SD054 DNA in MLPA experiments is recommended as it can be used to aid in data binning of the peak pattern using Coffalyser.NET software and as an artificial positive control for the specific point mutations. Please note that SD054 DNA consists of female DNA mixed with a plasmid DNA that contains the target sequences detected by the above mentioned probes + the sequence of the 105 nt chromosome Y specific control fragment. The amount of plasmid DNA used (relative to the genomic DNA) results in a relative probe signal for the 105 nt probe on this female DNA which is identical to the relative probe signal obtained on male DNA samples. As a result, the 100 and 105 nt control fragments indicate the presence of two copies chromosome X and one copy chromosome Y and one copy of the mutation-specific probes (heterozygous mutation). The product description of the SD054 can be found on This product is for research use only. The analysis of MS-MLPA probemixes consists of two parts: 1) determining copy numbers by comparing different undigested samples, and 2) determining methylation patterns by comparing each undigested sample to its digested counterpart (MS-MLPA probemixes only). The second part is unique for MS-MLPA probemixes and serves to semi-quantify the percentage of methylation within a given sample. 1) Copy number analysis - Selection of reference probes First select suitable reference probes for copy number detection. These are probes detecting relatively quiet regions in the particular type of tumour studied. The reference probes selected will therefore depend on the application. Probes that are suitable to use for reference in many types of tumour are indicated in Table 1. - Intra-sample data normalisation For analysis of MLPA results, not the absolute fluorescence values but intra-normalised data are used (relative peak heights). The data generated in the undigested sample should first be normalised intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. This Normalisation Constant can then be used for sample to reference sample comparison. - Inter-sample normalisation (comparison with reference samples) The final probe ratio, or ploidy status, of each probe in each sample is calculated by dividing a) the Normalisation Constant of each probe obtained on the undigested test sample by b) the average Normalisation Constant of that probe obtained on the undigested reference samples. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 3 of 11
4 2) Methylation analysis - Selection of reference probes Use the reference probes for methylation as marked in Table 1. All reference probes used for methylation analysis do not contain a HhaI site. - Intra-sample data normalisation For analysis of MLPA results, not the absolute fluorescence values but intra-normalised data are used (relative peak heights). The data generated in the digested sample should first be normalised intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. This Normalisation Constant can then be used for sample to reference sample comparison. - Methylation analysis (comparison with reference samples) The methylation status of each MS-MLPA probe* in each sample is calculated by dividing a) the Normalisation Constant of each probe obtained on the digested test sample by b) the Normalisation Constant of each MS-MLPA probe obtained on the corresponding undigested sample. Multiplying this value by 100 gives an estimation of the percentage of methylation. Aberrant methylation can then be identified by comparing the methylation status of one or more MS-MLPA probes in the sample in question to that obtained on reference samples. Interpretation of methylation results on blood and tissue derived DNA samples This probemix is intended for determining if the DNA sequences targeted by the methylation-specific probes show differential methylation as compared to the reference samples. This requires the determination of a baseline level of methylation, which can be used to determine if the methylation level in a test sample is significantly different from the reference samples. The baseline methylation level must be determined for every individual methylation-specific probe, and is applicable for one particular experiment. This is important because the level of methylation in samples from healthy individuals depends on the probe s target sequence and its location in the CpG island, the tissue type and, in certain cases, even on the age of the individual. The detection of methylation can also be influenced by impurities in the DNA sample that alter the activity of the HhaI enzyme. The presence of such impurities may differ between tissue types and DNA extraction methods. To determine the baseline methylation level, it is required to test a sufficient number ( 3) of reference samples from healthy individuals. These samples should be derived from the same tissue type, handled using the same procedure (e.g. FFPE vs. fresh frozen), and prepared using the same DNA extraction method. The baseline methylation level is then calculated by taking the average value of final ratios of the reference samples per probe and adding two times the standard deviation. The table below contains an example. Note that each individual methylation-specific probe should have a separate baseline methylation level and those values should not be averaged between the probes. Probe Reference sample 1 Reference sample 2 Reference sample 3 Average Standard deviation Baseline level (mean+2 stdev) Methylation-specific probe Methylation-specific probe Methylation-specific probe To determine if a test sample has a significantly increased methylation level for a particular probe, compare the methylation ratio of the probe with the baseline level. Methylation ratio of a probe in test sample > baseline: methylation is increased. Methylation ratio of a probe in test sample baseline: methylation is not increased. Interpretation of methylation positive samples is dependent on the application used. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 4 of 11
5 *Note: An MS-MLPA probe targets a single specific HhaI site in a CpG island; if methylation is absent for a particular CpG-site, this does not necessarily mean that the whole CpG island is unmethylated! Data normalisation should be performed within one experiment. Only samples purified by the same method should be compared. Confirmation of most exons deletions and amplifications can be done by e.g. Southern blotting, long range PCR, qpcr, FISH. Warning: MLPA analysis on tumour samples provides information on the average situation in the cells from which the DNA sample was purified. Gains or losses of genomic regions or genes may not be detected if the percentage of tumour cells is low. Furthermore, there is always a possibility that one or more reference probes do show a copy number alteration in a sample. Normal copy number variation in healthy individuals is described in the database of genomic variants: When in doubt, users should always verify the latest updates of the database and scientific literature when interpreting their findings. Note that Coffalyser, the MLPA analysis tool developed at, can be downloaded free of charge from our website This probemix was developed at. Info/remarks/suggestions for improvement: info@mlpa.com. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 5 of 11
6 Table 1. SALSA MS-MLPA ME012-A1 MGMT-IDH1-IDH2 probemix Length (nt) SALSA MLPA probe HhaI site Expected signal reduction (%) Probe details Chromosomal position (hg18) Reference Target Q-fragments: DNA quantity; only visible with less than 100 ng sample DNA D-fragments: Low signal of 88 or 96 nt fragment indicates incomplete denaturation 100 X-fragment: Specific for the X chromosome 105 Y-fragment: Specific for the Y chromosome 121 Reference probe L p MGMT probe S1100-L % 10q Reference probe L p MGMT probe L % 10q IDH2 probe L p.r172k (c.515g>a) 15q IDH2 probe L p.r172m (c.515g>t) 15q Reference probe L p MGMT probe L % 10q Reference probe L q MGMT probe L % 10q Reference probe L p Ж GRIN2A probe Depurination SP0891-L28910 control 190 MGMT probe L % 10q Reference probe L q IDH1 probe L p.r132h (c.395g>a) 2q # SLC9A2 probe L % HhaI digestion control ± MGMT probe L % 10q IDH1 probe L p.r132c (c.394c>t) 2q Reference probe L q Reference probe L q Reference probe L p Reference probe L q Reference probe L q Reference probe L q Reference probe L p Reference probe L q Reference probe L p Reference probe L q Reference probe L q # ESCO2 probe L % HhaI digestion control Reference probe L p12 ± SNP rs (C>T) is described at the HhaI recognition site (GCGC) of MGMT probe at 215 nt. When T allele is present in the patient sample, it can inhibit HhaI digestion and thereby affect the probe signal. In case this probe indicates hypermethylation of its target sequence in combination with no methylation for the other MGMT probes, it is recommended to sequence the region targeted by this probe. Mutation-specific probe. This probe will only generate a signal when the indicated mutation is present. It has been tested on artificial test DNA but not on positive human samples! Please note that background signals of the mutationspecific probes can be observed above the threshold for probe recognition in some cases. Users should always compare the peak height of the mutation-specific probes in mutation-positive samples to the peak height in reference samples. Ж This probe consists of three parts and has two ligation sites. Important information on this probe can be found in Table 2c. # Digestion control: warns for insufficient digestion. Upon digestion, this probe should not give a signal. Note: The identity of the genes detected by the reference probes is available in Table 2b. Please notify us of any mistakes: info@mlpa.com. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 6 of 11
7 Table 2. ME012 probes arranged according to chromosomal location Table 2a. MGMT and IDH1/2 probes Length (nt) SALSA MLPA probe Gene / exon Ligation site MV location (HG18) SALSA probemix ME012 MGMT-IDH1-IDH2 Page 7 of 11 HhaI site Distance to next probe IDH1, at 2q33.3. Ligation sites are indicated according to the NM_ sequence, and the exon numbering is according to the NG_ sequence. The p.r132h mutation has been detected by sequencing in 664 samples, and the p.r132c mutation in 29 samples (92.7%, and 4.1% of total 716 detected IDH1 mutations, respectively) in a cohort of 1010 WHO grade II and III astrocytomas, oligodendrogliomas and oligoastrocytomas (Hartmann C et al. 2009, Acta Neuropathol. 118:469-74). The probes at 203 nt and 225 nt will only give a signal when respectively the p.r132h and p.r132c mutation is present in the sample. Please note that background signals of the mutation-specific probes can be observed above the threshold for probe recognition in some cases. Users should always compare the peak height of the mutation-specific probes in mutationpositive samples to the peak height in reference samples. IDH1, exon 6; L kb p.r132h = c.395g>a IDH1, exon 6; L reverse p.r132c = c.394c>t MGMT, at 10q26.3. Ligation sites are indicated according to the NM_ sequence, with the MGMT start codon at nt in exon 1. Two methylation hot spots in the promoter region of the MGMT gene, at -249 to -103 nt and +107 to +196 nt in respect to the transcription start site, are suggested to denote silencing of the MGMT gene (Qian XC and Brent TP. 1997, Cancer Res. 57:3672-7). This ME012-A1 probemix includes six methylation-specific MLPA probes targeting CpG sites within and surrounding the above mentioned two methylation hot spots. CpG methylation at specific sites are suggested to provide different prognostic value. The probe at 126 nt covers the cg site that is suggested to have a strong association with patient survival, according to Bady P et al. (2012, Acta Neuropathol. 124:547-60). Please see figure 1 for more specific information on the location of methylation-specific probes in the promoter region of the MGMT gene L28960 upstream 400 nt before exon 1 reverse; 432 nt before ATG kb L26793 upstream 326 nt before exon 1; 358 nt before ATG kb 126 S1100-L27104 upstream 206 nt before exon 1 reverse; 238 nt before ATG kb L28999 exon reverse; 28 nt after ATG kb 215 ± L27780 downstream 73 nt after exon 1; 151 nt after ATG kb L15736 downstream 154 nt after exon 1 reverse; 232 nt after ATG IDH2, at 15q26.1. Ligation sites are indicated according to the NM_ sequence and the exon numbering is according to the NG_ sequence. The p.r172k mutation has been detected by sequencing in 20 samples, and the p.r172m mutation in 6 samples (64.5%, and 19.3% of total 31 detected IDH2 mutations, respectively) in a cohort of 1010 WHO grades II and III astrocytomas, oligodendrogliomas and oligoastrocytomas (Hartmann C. et al. 2009, Acta Neuropathol. 118:469-74). The probes at 145 nt and 151 nt will only give a signal when respectively the p.r172k and p.r172m mutation is present in the sample. Please note that background signals of the mutation-specific probes can be observed above the threshold for probe recognition in some cases. Users should always compare the peak height of the mutation-specific probes in mutationpositive samples to the peak height in reference samples. IDH2, exon 5; L kb p.r172k = c.515g>a IDH2, exon 5; L p.r172m = c.515g>t ± SNP rs (C>T) is described at the HhaI recognition site (GCGC) of MGMT probe at 215 nt. When T allele is present in the patient sample, it can inhibit HhaI digestion and thereby affect the probe signal. In case this probe indicates hypermethylation of its target sequence in combination with no methylation for the other MGMT probes, it is recommended to sequence the region targeted by this probe. Mutation-specific probe. This probe will only generate a signal when the indicated mutation is present. It has been tested on artificial test DNA but not on positive human samples! Note: Exon numbering used here may differ from literature! Please notify us of any mistakes: info@mlpa.com.
8 Table 2b. Reference probes Length Location MV location SALSA MLPA probe Gene (nt) (hg18) (HG18) L29005 CDC73 1q L26642 DYSF 2p L29004 GBE1 3p L24815 KCNAB1 3q L27455 ATP8A1 4p L28909 NIPBL 5p L28789 MCCC2 5q L24065 PKHD1 6p L28788 EYS 6q L29007 EYA1 8q L11573 SETX 9q L24018 ANO5 11p L29022 BEST1 11q L29026 FGF23 12p L29006 HEXA 15q L22445 PLCG2 16q L29009 AKAP10 17p L29008 MYO5B 18q Table 2c. Control probes Length (nt) SALSA MLPA probe Gene Location MV location (HG18) L25113 SLC9A2 2q L29021 ESCO2 8p Ж SP0891- L28910 GRIN2A 16p Ж This probe consists of three parts and has two ligation sites. Probe details HhaI digestion control 1: warns for insufficient HhaI digestion in MS-MLPA reaction. Upon successful digestion this probe should not give a signal. Moreover, HhaI digestion of this probe is independent of the methylation state of the target DNA, as the GCGC site is located on the stuffer of the probe. HhaI digestion control 2: warns for insufficient HhaI digestion in MS-MLPA reaction. Upon successful digestion this probe should not give a signal. The HhaI digestion of this probe depends on the methylation state of the target DNA, as the GCGC site is located in the sample DNA. Sample DNA depurination control: reduced signal of this probe indicates that sample DNA is depurinated. An extremely low signal of this probe might indicate a very poor sample DNA quality; please critically review your MLPA results in this case. Table 3. Sequences detected by the MGMT and IDH1/2 probes Length (nt) SALSA MLPA probe Gene Complete or partial (24 nt adjacent to ligation site) sequences detected by the probes L28960 MGMT CGGGCGTGCAAGCGACCTGCCACGT-GCCCGAGTGGTCCTGAAAGCGCGCGGGGGTCGTAG CCTGTGACAGGAAAAGGTACGGGCCATTTGGCAAACTAAG L26793 MGMT GCACAGAGCCTCAGGCGGAAGCTGGGAAGGCGCCGCCCGGCTTGTACCGG GGCCTGAGGCAGTCTGCGCATCCTCGCTGGA- 126 S1100-L27104 MGMT CGCCGGCACGCCGGCCCTGGTCCTCCGGCAGCGCCGCTGCCCTGTGC L28999 MGMT ACCGCGAGGACCTGCGGGCGTCGGGACGCAA-AGCGTTCTAGGGGCGCGGGCTGTCCCAGCATATCCGG L27780 MGMT CTCGGGACGGTGGCAGCCTCGAGTGGT-CCTGCAGGCGCCCTCACTTCGCCGTCGGGTGT L15736 MGMT GAAAGGCTGGGCAACACCTGGGAGGCACTT-GGGGCGCACCTGGAGCTCGCCCGGGATGGGT L16492 IDH1 CATCATAGGTCA-TCATGCTTATGG L29107 IDH1 ATAAGCATGACA-ACCTATGATGAT L29002 IDH2 CACCATTGGCAA-GCACGCCCATGG L29001 IDH2 CACCATTGGCAT-GCACGCCCATGG The HhaI sites are marked with grey. Ligation sites are marked with -. Mutation-specific nucleotides are marked in bold. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 8 of 11
9 MGMT probes in ME012-A ggtctctgctggtctgggggtccctgactaggggagcggcaccaggaggggagagactcgcgctccgggc 1 tcagcgtagccgccccgagcaggaccgggattctcactaagcgggcgccgtcctacgacccccgcgcgct ttcaggaccactcgggcacgtggcaggtcgcttgcacgcccgcggactatccctgtgacaggaaaaggta cgggccatttggcaaactaaggcacagagcctcaggcggaagctgggaaggcgccgcccggcttgtaccg 5 gccgaagggccatccgggtcaggcgcacagggcagcggcgctgccggaggaccagggccggcgtgccggc 6+7 gtccagcgaggatgcgcagactgcctcaggcccggcgccgccgcacagggcatgcgccgacccggtcggg cgggaacaccccgcccctcccgggctccgccccagctccgcccccgcgcgccccggccccgcccccgcgc gctctcttgcttttctcaggtcctcggctccgccccgctctagaccccgccccacgccgccatccccgtg cccctcggccccgcccccgcgccccggatatgctgggacagcccgcgcccctagaacgctttgcgtcccg ACGCCCGCAGGTCCTCGCGGTGCGCACCGTTTGCGACTTGgtgagtgtctgggtcgcctcgctcccggaa 15 Gagtgcggagctctccctcgggacggtggcagcctcgagtggtcctgcaggcgccctcacttcgccgtcg 16 ggtgtggggccgccctgacccccacccatcccgggcgagctccaggtgcgccccaagtgcctcccaggtg 17 ttgcccagcctttccccgggcctggggttcctggactaggct Figure 1. Nucleotide sequence of the promoter region of MGMT gene: HG18 chr10: (HG19 chr10: ). Sequence targeted by MS-MLPA probes present in ME012-A Underlined nucleotides probemix. CTC Translation start site for MGMT. ATG Transcription start site (NM_ ) for MGMT. gcgc HhaI sites 1 to 17. g Cg (Bady et al. 2012, Acta Neuropathol 124:547-60). Covered with MGMT probe at 126 nt (S1100-L27104). Cg (Bady et al. 2012, Acta Neuropathol 124:547-60). g Not possible to cover (no HhaI site). Methylation hotspot -249 to -103 nt from CTC transcription site (Qian XC Dark grey highlight and Brent TP. 1997, Cancer Res. 57:3672-7). This hotspot is covered with MGMT probe at 126 nt (S1100-L27104). Methylation hotspot +107 to +196 nt from CTC transcription site (Qian XC Light grey highlight and Brent TP. 1997, Cancer Res. 57:3672-7). This hotspot is covered with MGMT probe at 215 nt (12250-L27780). Yellow highlight SNPs according to dbsnp version 142. CAPITAL nucleotides MGMT exon 1 (NM_ ). Blue nucleotides CpG island according to the UCSC Genome Browser ( Repeat region according to the UCSC Genome Browser Pink nucleotides ( Note: For a colour version of Figure 1, see the pdf version of this product description on MGMT probes in the ME012-A1 probemix (lot A1-1215): Probe L28960 (142 nt) is sensitive to methylation of HhaI sites 3+4 (reverse). Probe L26793 (190 nt) is sensitive to methylation of HhaI site 5. Probe S1100-L27104 (126 nt) is sensitive to methylation of HhaI site 7+8 (reverse) + covers Cg Probe L28999 (160 nt) is sensitive to methylation of HhaI site 14 (reverse). Probe L27780 (215 nt) is sensitive to methylation of HhaI site 16. Probe L15736 (172 nt) is sensitive to methylation of HhaI site 17 (reverse). SALSA probemix ME012 MGMT-IDH1-IDH2 Page 9 of 11
10 SALSA MS-MLPA probemix ME012-A1 MGMT-IDH1-IDH2 sample pictures Figure 2. Capillary electrophoresis pattern of a sample of approximately 50 ng undigested human male control DNA analysed with SALSA MLPA probemix ME012-A1 MGMT-IDH1-IDH2 (lot A1-1215) for the quantification of copy number of the MGMT gene and detection of IDH1/2 mutation status. Figure 3. Capillary electrophoresis pattern of a sample of approximately 50 ng digested human male control DNA analysed with SALSA MLPA probemix ME012-A1 MGMT-IDH1-IDH2 (lot A1-1215) to determine the methylation status of the MGMT gene. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 10 of 11
11 Figure 4. Capillary electrophoresis pattern of SD054 sample DNA (approximately 50 ng human female control DNA) analysed with SALSA MLPA probemix ME012-A1 MGMT-IDH1-IDH2 (lot A1-1215). The locations of the four mutation-specific-probes at 145 nt, 151 nt, 203 nt and 225 nt are indicated (with an arrow). Implemented Changes the following has been altered compared to the previous product description version(s). Version April 2019 (16) - Information on interpretation of methylation results added on page 4. Version January 2019 (16) - ME011 is taken out from the list of related probemixes as it no longer contains probes for MGMT. - References to ME011 probemix are taken out from Table 1 and 2a (MGMT probes present in both ME012 and ME011-B). - Information about the possibility of back ground signals for mutation specific probes has been added to Table 1 and 2a. - For uniformity, the chromosomal positions and bands in this document are now all based on hg18 (NCBI36). - Small changes of probe lengths in Tables 1, 2a, 2b and 3 in order to better reflect the true lengths of the amplification products. - Various minor textual changes through the document. Version December 2016 (16) - Warning regarding HhaI enzymes that are resistant to heat inactivation added under Methylation-specific MLPA section. Version January 2016 (15) - Product description adapted to a new product version (version number changed, lot number added, changes in Table 1 and Table 2, new pictures included). The older version of this document is available for the test labs. - Ligation sites of the probes targeting the MGMT gene updated according to new version of the NM_reference sequence. - Small changes of probe lengths in Table 1 and 2 in order to better reflect the true lengths of the amplification products. - Information about SD054 added on page 1 and 3. Version 01 (13) - Not applicable, new document. SALSA probemix ME012 MGMT-IDH1-IDH2 Page 11 of 11
SALSA MLPA probemix P315-B1 EGFR
SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional
More informationMRC-Holland MLPA. Description version 08; 30 March 2015
SALSA MLPA probemix P351-C1 / P352-D1 PKD1-PKD2 P351-C1 lot C1-0914: as compared to the previous version B2 lot B2-0511 one target probe has been removed and three reference probes have been replaced.
More informationSALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted.
mix P169-C2 HIRSCHSPRUNG-1 Lot C2-0915. As compared to version C1 (lot C1-0612), the length of one has been adjusted. Hirschsprung disease (HSCR), or aganglionic megacolon, is a congenital disorder characterised
More informationMRC-Holland MLPA. Description version 29; 31 July 2015
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0114. As compared to the previous B2 version (lot 0813 and 0912), 11 target probes are replaced or added, and 10 new reference probes are included. P082
More informationSALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407
SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 The Mismatch Repair (MMR) system is critical for the maintenance of genomic stability. MMR increases the fidelity of DNA
More informationMRC-Holland MLPA. Description version 30; 06 June 2017
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0517, C1-0114. As compared to the previous B2 version (lot B2-0813, B2-0912), 11 target probes are replaced or added, and 10 new reference probes are
More informationMRC-Holland MLPA. Description version 18; 09 September 2015
SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the
More informationMRC-Holland MLPA. Description version 14; 28 September 2016
SALSA MLPA probemix P279-B3 CACNA1A Lot B3-0816. As compared to version B2 (lot B2-1012), one reference probe has been replaced and the length of several probes has been adjusted. Voltage-dependent calcium
More informationMRC-Holland MLPA. Description version 12; 13 January 2017
SALSA MLPA probemix P219-B3 PAX6 Lot B3-0915: Compared to version B2 (lot B2-1111) two reference probes have been replaced and one additional reference probe has been added. In addition, one flanking probe
More informationSALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes
More informationP323-B1 CDK4-HMGA2-MDM2
SALSA MLPA probemix P323-B1 CDK4-HMGA2-MDM2 Lot B1-0714, B1-0711. As compared to previous test version (lot A1-0508), this probemix has been completely redesigned. Probes for HMGA2 and several other genes
More informationMRC-Holland MLPA. Description version 06; 23 December 2016
SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated
More informationMRC-Holland MLPA. Related SALSA MLPA probemixes P190 CHEK2: Breast cancer susceptibility, genes included: CHEK2, ATM, PTEN, TP53.
SALSA MLPA probemix P056-C1 TP53 Lot C1-0215 & lot C1-0214. As compared to version B1 (lot B1-1011) most of the reference and flanking probes have been replaced and several have been added. Furthermore,
More informationSALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0716, D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent
More informationMRC-Holland MLPA. Description version 07; 26 November 2015
SALSA MLPA probemix P266-B1 CLCNKB Lot B1-0415, B1-0911. As compared to version A1 (lot A1-0908), one target probe for CLCNKB (exon 11) has been replaced. In addition, one reference probe has been replaced
More informationMRC-Holland MLPA. Description version 28; 4 January 2018
SALSA MLPA probemix ME011-B3 Mismatch Repair genes Lot B3-1017 and B3-0715. As compared to the previous version B2 (lot B2-0614), one probe has a small change in length but no change in the sequence detected.
More informationMRC-Holland MLPA. Description version 08; 18 November 2016
SALSA MLPA probemix P122-D1 NF1 AREA Lot D1-1016. As compared to lot C2-0312, four probes in the NF1 area and one reference probe have been removed, four reference probes have been replaced and several
More informationMRC-Holland MLPA. Description version 08; 07 May 2015
mix P185-C1 Intersex Lot C1-0611: As compared to the previous version B2 (lot B2-0311), s for CYP21A2 have been removed and s for the CXorf21 gene as well as additional s for NR0B1, NR5A1 and the Y chromosome
More informationMRC-Holland MLPA. Description version 06; 07 August 2015
SALSA MLPA probemix P323-B1 CDK4-HMGA2-MDM2 Lot B1-0711. As compared to version A1 (test version sent to test labs), this product has been completely redesigned. Probes for HMGA2 and several other genes
More informationNew: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.
SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:
More informationMRC-Holland MLPA. Description version 29;
SALSA MLPA KIT P003-B1 MLH1/MSH2 Lot 1209, 0109. As compared to the previous lots 0307 and 1006, one MLH1 probe (exon 19) and four MSH2 probes have been replaced. In addition, one extra MSH2 exon 1 probe,
More informationSALSA MLPA probemix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four probes have been adjusted.
mix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four s have been adjusted. The sex-determining region on chromosome Y (SRY) is the most important
More informationMRC-Holland MLPA. Description version 19;
SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL
More informationMost severely affected will be the probe for exon 15. Please keep an eye on the D-fragments (especially the 96 nt fragment).
SALSA MLPA probemix P343-C3 Autism-1 Lot C3-1016. As compared to version C2 (lot C2-0312) five reference probes have been replaced, one reference probe added and several lengths have been adjusted. Warning:
More informationMRC-Holland MLPA. Description version 13;
SALSA MLPA probemix P027-C1 Uveal Melanoma Lot C1-0211: A large number of probes have been replaced by other probes in the same chromosomal regions as compared to previous lots, and several reference probes
More informationSALSA MLPA KIT P050-B2 CAH
SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to
More informationMRC-Holland MLPA. Description version 23; 15 February 2018
SALSA MLPA probemix P225-D2 PTEN Lot D2-0315. As compared to the previous version (lot D1-0613), one probe has a small change in length but no change in the sequence detected. PTEN is a tumour suppressor
More informationSALSA MLPA KIT P060-B2 SMA
SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the
More informationSALSA MLPA probemix P372-B1 Microdeletion Syndromes 6 Lot B1-1016, B
SALSA MLPA probemix P372-B1 Microdeletion Syndromes 6 Lot B1-1016, B1-0613. The purpose of the P372 probemix is to further investigate results found with the P245 Microdeletion Syndromes-1A probemix. The
More informationPRADER WILLI/ANGELMAN
SALSA MS-MLPA probemix ME028-B2 PRADER WILLI/ANGELMAN Lot B2-0811: As compared to version B1 (lot B1-0609, B1-1108), the 88 and 96 nt control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME
More informationSALSA MLPA probemix P371-A1 Microdeletion Syndromes 5 Lot A1-0509
mix P371-A1 Microdeletion Syndromes 5 Lot A1-0509 The purpose of the P371 mix is to further investigate results found with the P245 Microdeletion mix. The P245 mix provides a possibility to screen samples
More informationMRC-Holland MLPA. Description version 52; 22 July 2015
SALSA MS-MLPA probemix ME028-B2 Prader-Willi/Angelman Lot B2-0413, lot B2-0811. As compared to version B1 (lot B1-0609), the control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME (PWS) and
More informationSALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A
SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A1-1011. This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix enables you to quantify genes
More informationSALSA MLPA Probemix P014-B1 Chromosome 8 Lot B and B
SALSA MLPA Probemix P014-B1 Chromosome 8 Lot B1-0916 and B1-0713. Copy number changes of the human chromosome 8 are common in many types of tumours. In most cases, losses of 8p sequences and gains of 8q
More informationSALSA MLPA probemix P175-A3 Tumour Gain Lot A3-0714: As compared to the previous version A2 (lot A2-0411), nine probes have a small change in length.
SALSA MLPA probemix P175-A3 Tumour Gain Lot A3-0714: As compared to the previous version A2 (lot A2-0411), nine probes have a small change in length. This SALSA probemix is for basic research only! This
More informationSALSA MLPA probemix P383-A1 T-ALL Lot A
SALSA MLPA probemix P383-A1 T-ALL Lot A1-0213. T-lineage acute lymphoblastic leukaemia (T-ALL) is a clonal malignant disorder of immature T-cells, which accounts for about 15% of paediatric and 25% of
More informationSALSA MLPA KIT P078-B1 Breast Tumour Lot 0210, 0109
SALSA MLPA KIT P078-B1 Breast Tumour Lot 0210, 0109 This P078-B1 Breast Tumour probemix contains probes for several genes (including ERBB2, BIRC5, MYC, TOP2A, ESR1, MTDH, CCND1, CCNE1, EGFR and C11orf30)
More informationProduct Description SALSA MS-MLPA Probemix ME011-C1 Mismatch Repair Genes To be used with the MS-MLPA General Protocol.
Product Description SALSA MS- Probemix ME011-C1 Mismatch Repair Genes To be used with the MS-MLPA General Protocol. Version C1. As compared to the previous version (lot B3-1017), this probemix has been
More informationMRC-Holland MLPA. Description version 23; 26 January 2017
SALSA MLPA probemix ME024-B2 9p21 CDKN2A/2B region Lot B2-0615. As compared to the previous version B1 (lot B1-0411), one flanking probe is redesigned, two reference probes are replaced, and several probes
More informationProduct Description SALSA MLPA probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol.
Product Description SALSA probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol. Version C1. As compared to version B3, the probes for the BRCA2 upstream region and exons 8, 11, 12, 19
More informationProduct Description SALSA MLPA Probemix P055-D1 PAH To be used with the MLPA General Protocol.
Product Description SALSA Probemix P055-D1 PAH To be used with the MLPA General Protocol. Version D1. For complete product history see page 7. Catalogue numbers: P055-025R: SALSA MLPA probemix P055 PAH,
More informationProduct Description SALSA MS-MLPA Probemix ME028-C1 Prader-Willi/Angelman To be used with the MS-MLPA General Protocol.
Product Description SALSA MS- Probemix ME028-C1 Prader-Willi/Angelman To be used with the MS-MLPA General Protocol. Version C1. For complete product history see page 9. Catalogue numbers: ME028-025R: SALSA
More informationProduct Description SALSA MLPA Probemix P027-C2 Uveal melanoma To be used with the MLPA General Protocol.
Product Description SALSA Probemix P027-C2 Uveal melanoma To be used with the MLPA General Protocol. Version C2. As compared to version C1, three reference probes have been replaced and the lengths of
More informationProduct Description SALSA MLPA Probemix P138-C1 SLC2A1-STXBP1 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P138-C1 SLC2A1-STXBP1 To be used with the MLPA General Protocol. Version C1. For complete product history see page 7. Catalogue numbers: P138-025R: SALSA MLPA probemix
More informationMRC-Holland MLPA. Description version 10; 06 April 2018
Description version ; 6 April 8 mix P36-B Y-Chromosome Microdeletions Lot B-5. As compared to version A (Lot A-), all probes f DPY9L, one probe f RBMYCP and one probe f KDM5D have been removed, and one
More informationProduct Description SALSA MLPA Probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol. Version C1. As compared to version B3, the probes for the BRCA2 upstream region and exons 8, 11, 12, 19
More informationMRC-Holland MLPA. Description version 15;
probemix P036-E1 HUMAN TELOMERE-3 Lot E1-0910, E1-1208, E1-0808. As compared to version D2 (lot D2-0408), the probes for 1p and 4q have been replaced. Approximately 3-8% of all cases of mental retardation
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationSALSA MLPA KIT P036-E1 HUMAN TELOMERE-3 Lot 0808: As compared to the previous version (P036-D2), the probes for 1p and 4q have been replaced.
SALSA MLPA KIT P036-E1 HUMAN TELOMERE-3 Lot 0808: As compared to the previous version (P036-D2), the probes for 1p and 4q have been replaced. MENTAL RETARDATION is caused by aberrant copy numbers of subtelomeric
More informationKarl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz
Expanding on WHO guideline compliant molecular testing of central nervous system tumors by low density whole genome sequencing. Karl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz
More informationProduct Description SALSA MLPA Probemix P015-F2 MECP2 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P015-F2 MECP2 To be used with the MLPA General Protocol. Version F2. Compared to version F1, two reference probes have been replaced and the 118 nt Y fragment has been
More informationSupplemental Data: Detailed Characteristics of Patients with MKRN3. Patient 1 was born after an uneventful pregnancy. She presented in our
1 2 Supplemental Data: Detailed Characteristics of Patients with MKRN3 Mutations 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Patient 1 was born after an uneventful pregnancy. She presented
More informationCorporate Medical Policy
Corporate Medical Policy Analysis of MGMT Promoter Methylation in Malignant Gliomas File Name: Origination: Last CAP Review: Next CAP Review: Last Review: analysis_of_mgmt_promoter_methylation_in_malignant_gliomas
More informationProduct Description SALSA MLPA probemix P002-D1 BRCA1 To be used with the MLPA General Protocol.
Product Description SALSA probemix P002-D1 BRCA1 To be used with the MLPA General Protocol. Version D1. As compared to version C2, 12 extra BRCA1 probes and 3 probes for exon 24 have been included, and
More informationExamining large groups of cancer patients to identify ways of predicting which therapies cancers might respond to.
Stratified Medicine Examining large groups of cancer patients to identify ways of predicting which therapies cancers might respond to. Looking in detail at cancer cells and their genetic make up. Permit
More informationProduct Description SALSA MLPA Probemix P002-D1 BRCA1 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P002-D1 BRCA1 To be used with the MLPA General Protocol. Version D1. For a complete product history see page 11. Catalogue numbers: P002-025R: SALSA MLPA probemix P002
More informationA clinical perspective on neuropathology and molecular genetics in brain tumors
A clinical perspective on neuropathology and molecular genetics in brain tumors M.J. van den Bent Erasmus MC Cancer Institute Rotterdam, the Netherlands Disclosures Member speakersbureau: MSD Consultancy:
More informationGenomic analysis of childhood High grade glial (HGG) brain tumors
Genomic analysis of childhood High grade glial (HGG) brain tumors Linda D Cooley Children s Mercy, Kansas City The Children s Mercy Hospital, 2017 Genomic analysis of childhood High grade glial (HGG) brain
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More information2015 EUROPEAN CANCER CONGRESS
2015 EUROPEAN CANCER CONGRESS 25-29 September 2015 Vienna, Austria SUMMARY The European Cancer Congress (ECC 2015) combined the 40th European Society for Medical Oncology (ESMO) congress with the 18th
More informationMolecular diagnostics of gliomas: state of the art
Acta Neuropathol (2010) 120:567 584 DOI 10.1007/s00401-010-0736-4 REVIEW Molecular diagnostics of gliomas: state of the art Markus J. Riemenschneider Judith W. M. Jeuken Pieter Wesseling Guido Reifenberger
More informationPrecision medicine for gliomas
Precision medicine for YAZMIN ODIA, MD MS LEAD PHYSICIAN OF MEDICAL NEURO-ONCOLOGY DISCLOSURES Novocure: Advisory Board for Optune in No other financial conflicts of interest Glioma OVERVIEW INFILTRATIVE,
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationAmoyDx TM BRAF V600E Mutation Detection Kit
AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationOverView Circulating Nucleic Acids (CFNA) in Cancer Patients. Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA
OverView Circulating Nucleic Acids (CFNA) in Cancer Patients Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA cfna Blood Assays Cell-free nucleic acids as biomarkers in cancer patients.
More informationThe New WHO Classification and the Role of Integrated Molecular Profiling in the Diagnosis of Malignant Gliomas
The New WHO Classification and the Role of Integrated Molecular Profiling in the Diagnosis of Malignant Gliomas Stefan Prokop, MD Neuropathology Fellow Hospital of the University of Pennsylvania Background
More informationIllumina Trusight Myeloid Panel validation A R FHAN R A FIQ
Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol
More informationgliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from
More informationA complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis
APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,
More informationEnterprise Interest None
Enterprise Interest None Heterogeneous chromosomal profiles in a unique series of DIPG in children and young adults European Congress of Pathology Amsterdam, 6 th September 2017 Charlotte Dufour, Romain
More informationReporting TP53 gene analysis results in CLL
Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationThe mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge
The mutations that drive cancer Paul Edwards Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge Previously on Cancer... hereditary predisposition Normal Cell Slightly
More informationFor in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are
More informationChemotherapy in malignant brain tumors
Chemotherapy in malignant brain tumors Frank Zimmermann Institut für Radioonkologie Universitätsspital Basel Petersgraben 4 CH 4031 Basel zimmermannf@uhbs.ch Tumor types Neuro-epithelial tumors - Glioblastoma
More informationIDH1 R132H/ATRX Immunohistochemical validation
IDH1 R132H/ATRX Immunohistochemical validation CIQC/DSM 2016 12 June 2016 0835-0905 Stephen Yip, M.D., Ph.D., FRCPC University of British Columbia Disclosure Statement I have nothing to disclose I will
More informationS1 Appendix: Figs A G and Table A. b Normal Generalized Fraction 0.075
Aiello & Alter (216) PLoS One vol. 11 no. 1 e164546 S1 Appendix A-1 S1 Appendix: Figs A G and Table A a Tumor Generalized Fraction b Normal Generalized Fraction.25.5.75.25.5.75 1 53 4 59 2 58 8 57 3 48
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
SW Thames Regional Genetics Laboratory, Jenner Wing, SGUL Cranmer Terrace London SW17 0RE Contact: Mr John Short Tel: +44 (0) 208 725 5332 Fax: +44 (0) 208 725 3440 E-Mail: swtrgl@stgeorges.nhs.uk Website:
More informationExpert-guided Visual Exploration (EVE) for patient stratification. Hamid Bolouri, Lue-Ping Zhao, Eric C. Holland
Expert-guided Visual Exploration (EVE) for patient stratification Hamid Bolouri, Lue-Ping Zhao, Eric C. Holland Oncoscape.sttrcancer.org Paul Lisa Ken Jenny Desert Eric The challenge Given - patient clinical
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationDiagnostic application of SNParrays to brain cancers
Diagnostic application of SNParrays to brain cancers Adriana Olar 4/17/2018 No disclosures 55 yo M, focal motor seizure T2 T1-post C DIAGNOSIS BRAIN, LEFT FRONTAL LOBE, BIOPSY: - DIFFUSE GLIOMA, OLIGODENDROGLIAL
More information5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff
5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff National molecular screening of patients with lung cancer for a national trial of multiple novel agents. 2000 NSCLC patients/year (late
More informationVariant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18
Variant interpretation exercise ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Format of exercise Compile a list of tricky variants across solid cancer and haematological malignancy.
More informationp.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
More informationClinical significance of genetic analysis in glioblastoma treatment
Clinical significance of genetic analysis in glioblastoma treatment Department of Neurosurgery, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan Koji Yoshimoto Can we get prognostic
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More informationSUPPLEMENTARY FIGURES: Supplementary Figure 1
SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic
More informationNature Genetics: doi: /ng.2995
Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: GAIN,
More information2017 Diagnostic Slide Session Case 3
2017 Diagnostic Slide Session Case 3 Andrew Gao, MD Lili-Naz Hazrati, MD, PhD Cynthia Hawkins, MD, PhD Hospital for Sick Children and University of Toronto, Toronto, Canada Disclosures: none Clinical History
More informationEXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%)
Dr Kate Goodhealth Goodhealth Medical Clinic 123 Address Road SUBURBTOWN NSW 2000 Melanie Citizen Referring Doctor Your ref Address Dr John Medico 123 Main Street, SUBURBTOWN NSW 2000 Phone 02 9999 9999
More informationCurrent and future applications of Molecular Pathology. Kathy Walsh Clinical Scientist NHS Lothian
Current and future applications of Molecular Pathology Kathy Walsh Clinical Scientist NHS Lothian Molecular Pathology in Solid tumours Cancer type Genes tested Purpose Associated treatments Non small cell
More informationNucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis
Nucleic Acid Testing - Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Gross alterations in DNA content of tumors (ploidy) Gain/Loss of nucleic acids Markers of Clonality Oncogene/Tumor
More informationMolecular Diagnosis. Nucleic acid based testing in Oncology
Molecular Diagnosis Nucleic acid based testing in Oncology Objectives Describe uses of NAT in Oncology Diagnosis, Prediction, monitoring. Genetics Screening, presymptomatic testing, diagnostic testing,
More informationCopy number and somatic mutations drive tumors
Detection of copy number alterations, ploidy and loss of heterozygosity across the genome in FFPE specimens Utility for diagnosis and treatment with comparison to FISH-based and as a complement to sequencing
More informationGliomas in the 2016 WHO Classification of CNS Tumors
Gliomas in the 2016 WHO Classification of CNS Tumors Hindi N Al-Hindi, MD, FCAP Consultant Neuropathologist and Head Section of Anatomic Pathology Department of Pathology and Laboratory Medicine King Faisal
More information