Monitoring of Hawaiian Invertebrates for White Spot Syndrome Virus. David Albert Dr. Jo-Ann Leong Dr. Teresa Lewis

Size: px
Start display at page:

Download "Monitoring of Hawaiian Invertebrates for White Spot Syndrome Virus. David Albert Dr. Jo-Ann Leong Dr. Teresa Lewis"

Transcription

1 Monitoring of Hawaiian Invertebrates for White Spot Syndrome Virus David Albert Dr. Jo-Ann Leong Dr. Teresa Lewis

2 What is White Spot Syndrome Virus (WSSV) Enveloped, rod shaped Double stranded DNA virus 70 to 150 nm X 275 to 380 nm 305,107 bp (Yang et. al. J. of Virology, Dec 2001) Viability of free virus in sea water is 3-4 days Mortality in Penaeid shrimp reaches 90% to 100% in 3 to 7 days Images obtained from web site of Dr. Philip C. Loh of the University of Hawaii at Manoa Department of Microbiology

3 What is White Spot Syndrome Virus (WSSV) TIME LINE White Spot was first described in Penaeus monodon in Taiwan This disease caused a 70% reduction in shrimp production in China WSSV quickly spreads to other shrimp growing regions of Asia White spot disease detected in the U.S. at a farm in Texas 1995-Present -- Appeared in every major shrimp producing area of the world

4 Hawaii Dept. of Agriculture April 14, 2004

5 The Problem: Vector for introduction of WSSV into Kauai unknown WSSV may have been introduced into Hawaii by frozen shrimp products WSSV is both detectable and infectious in frozen shrimp imports (Nunan et al., 1998) WSSV also infects a wide variety of crabs, copepods, and other arthropods (Cai et al. 1995; Chang et al. 1998; Lightner et al. 1998; Wang et al. 1998).

6 Natural and Experimental Hosts of WSSV Penaeus monodon Penaeus semisulcatus Penaeus merguiensis Penaeus indicus Penaeus chinensis Penaeus penicillatus Penaeus japonicus Penaeus vannamei Penaeus stylirostris Penaeus setiferus Penaeus occidentalis Penaeus aztecus Penaeus duorarum Penaeus californiensis Metapenaeus ensis Trachypenaeus curviostris Exopalaemon orientalis Macrobrachium rosenbergii Ocronectes punctimanus Procambarus clarkii Charybdis feriatus Charybdis granulata Charybdis annulata Charybdis lucifera Doclea hybrida Grapsus albolineatus Halimede ochtodes Liagore rubronaculata Lithodes maja Matuta miersi Paradorippe granulata Parthenope prensor Philyra syndactyla Podophthalmus vigil Portunus pelagicus Portunus sanguinolentus Scylla serrata Thalamita danae Panulirus versicolor Panulirus penicillatus Panulirus ornatus Panulirus longipes Cherax quadricarinatus Calappa philargius Calappa lophos

7 Research Objectives: 1) Validate a PCR amplification assay for WSSV in the laboratory at HIMB 2) Determine assay sensitivity with known positive samples 3) Run PCR assays for the following samples a) Frozen shrimp products from five stores in Hawaii b) Captured wild crabs/lobster/shrimp from: i) Kauai at Ceatech site ii) Kauai Hanalei Bay iii) Kauai Nawiliwili Bay c) Captured wild crabs/lobsters/shrimp from: i) Kaneohe Bay ii) Waikiki near the aquarium iii) Sand Island near the landfill d) Negative control shrimp from Chen Lu Farms, Kahuku

8 Objective 1: Validate a PCR assay 1. Obtain a positive control WSSV 1 st step PCR on grocery store shrimp WSSV 2 nd step PCR Lane 1: DNA Ladder Lane 2: No template control Lane 3-5: Commodity shrimp from India Lane 6-9: Commodity shrimp from Thailand

9 WSSV Plasmid 4 sequence CTAAAATAGTGCCTAAGAGATTCGACGGAGTTGACCCAGCCTTCCCTGCCGCTCTCTCACCTGCGTCTATCTCACCTCAT GCTTTCTTCCATGGATTCCCATACAAAGTCATCTTTCATGGACAACATCAAATTGCACATGACTGATACTCAATGCTTCT TCAAGAACATTGAACGATTTGAGAAATTCTTGGGAAGATATGGGGACGAATACGCCATGTCCCACAAGCAAAATTGTAAC TGCCCCTTCCATCTCCACCACACTTTTACTCCCTCAGATAACGAGCATCTGGTATCCTCTTTCGCATTCGCCCGCCCAGA AGTCTCCATGGAAGAAATTAGAGCCACACCCTATCAGGCCAACAAGCTTATTAGTGACAAACATTACGTGATGAACATGT CCAAGATCGATTCTAGAGTAACAGGATCTTCCCTCCTTAAGAAGGTTAGCGAATGGACTGAAATGAGAATGAACTCCAAC TTTAATGGAACATTTGAACCATCAAGACTCGCCCTCTCCAACTCTGGCATGACAACGGCAGGAGTCAACCTCGACGTTAT TGTCAAACCAAATAATGCAAGAAGTGTACTAGGAATATTGGAATGTCATCGCCAGCACGTGTGCACCGCCGACGCCAAGG GAACTGTCGCTTCAGCCATGCCAGCCGTCTTCCAGGCAACCGATGGAAACGGTAACGAATCTGAACTGATCCAGAATGCT CTGCCAAGGAACAGATACATCCAAAAGAGCACAATGAACGCTCAAACTGTCGTGTTTGCTAATGTTTTGGAACACTTATC GCCGATCTTGGAAAGGTTATCGTGAACGAACTGGCCGGCACCATCGCTGATCTGTACCAAAAGCGTATATGAAAACACCA AGGAAATGATGATAGACTAGGCTCTGACGACTCTTCAATCTAATAATATGGAGGAGTAGAATCAATGGATTATGGAGATA GCGAACACAATCCAACAATGGTTCGGTCT Distribution of 38 Blast Hits on the Query Sequence Score E Sequences producing significant alignments: (bits) Value gi gb AF Shrimp white spot syndrome virus gi gb AF AF White spot syndrome viru gi gb AF AF White spot syndrome viru gi gb AF AF White spot syndrome viru gi gb U PMU50923 Penaeus monodon nonoccluded gi emb AJ WSP White spot syndrome ba

10 Objective 2: Determine sensitivity Serial dilutions of cloned positive control WSSV 1 st Step WSSV 2 nd Step Lane 1: DNA Ladder Lane 2-9: serial dilution 10 6 through 10-1

11 Research Objective Results 3a: Perform PCR assay on frozen commodity shrimp Stores: Foodland, Safeway, Star Market, and Nanko s Country of origin: Thailand Vietnam India Mexico Viral presence: POSITIVE POSITIVE POSITIVE Not Detected

12 Objective 3b: Ceatech Ceatech quarantined by Hawaii Department of Agriculture Estimated $2 million in lost revenue 20 million shrimp buried 48 ponds drained into Kinikini Ditch No clear indication of how this virus was introduced into the farm Multiple sampling trips were taken by members of the Department of Agriculture (DOA) and Department of Land and Natural Resources (DLNR) P. vannamei were found outside the confines of the farm No samples have tested positive for WSSV

13 Objective 3b: Ceatech Location Name Across the street from CEATECH Hatchery PMRF culvert PMRF mouth of Kinikini Ditch Kinikini Ditch near intersection of ditches Kinikini Ditch Kinikini Ditch near farm drain Number of samples Species collected Palaemon debilis Litopenaeus vannemei Litopenaeus vannemei Ghost Crab sp? No samples found No samples found No samples found

14 Objective 3c: Kaneohe Bay Collection sites: Coconut Island and Heeia State park Heeia State Park Coconut Island

15 Objective 3c: Kaneohe Bay Animals Collected and Tested: Thalamita crenata Blue crab 2 nd step positive Portunus sanguinolentus Blood-spotted crab Not detected Pachygrapsus sp. rock crabs 2 nd step positive Palaemon debilis O pae 2 nd step positive

16 Objective 3c: Waikiki Aquarium Following the recommendations of Dr. Jim Brock, purchase of SPF shrimp for use as feed began several years ago. No testing for viral diseases was done on shrimp prior to Dr. Brock s recommendation Recent testing of shrimp feed from Kauai was negative for WSSV Prior to the release of several slipper lobster back into the wild a specimen was tested for WSSV No significant loses of animals ever recorded Slipper, Spiny and Reef lobsters Various endemic crabs Opa e Cleaner shrimp Harlequin shrimp

17 Research Objectives: Future Plans Work with Tony Montgomery to sample Sand Island sites Return to Kauai to continue monitoring around CEATECH Continue sampling of Kaneohe Bay Develop a bioassay to study the susceptibility of local crustaceans to WSSV Perform transmission trials per os under quarantine conditions

18 Notifiable Diseases of Crustaceans: Taura syndrome (viral/penaeid shrimp) White spot disease (viral/penaeid shrimp and other decapod crustaceans) Yellowhead disease (viral/penaeid shrimp) Other Significant Diseases of Crustaceans: Tetrahedral baculovirosis (Baculovirus penaei) (viral/penaeid shrimp) Spherical baculovirosis (Penaeus monodon-type baculovirus) Infectious hypodermal and haematopoietic necrosis (viral/penaeid shrimp) Crayfish plague (Aphanomyces astaci) (fungal/freshwater crayfish) Spawner-isolated mortality virus disease (viral/penaeid shrimp)

19 Conclusions: We now have a valid PCR amplification assay for WSSV at HIMB Sensitivity of this 2-step assay is on the order of 1 viral particle/µl Commodity shrimp sold in grocery stores and bait shops contain WSSV Samples taken of local crustaceans in Kaneohe Bay have tested POSITIVE for WSSV The impact on local crustacea in Kauai remains undetermined Much more work needs to be done

20 Anuenue Fisheries Research Center Dee Montgomery-Brock Department of Land and Natural Resources Tony Montgomery Waikiki Aquarium Jerry Crow Dr. Andrew Rossiter

Experimental infection of twenty species of Indian marine crabs with white spot syndrome virus (WSSV)

Experimental infection of twenty species of Indian marine crabs with white spot syndrome virus (WSSV) DISEASES OF AQUATIC ORGANISMS Vol. 57: 157 161, 2003 Published December 3 Dis Aquat Org NOTE Experimental infection of twenty species of Indian marine crabs with white spot syndrome virus (WSSV) A. S.

More information

National and international impacts of white spot disease of shrimp

National and international impacts of white spot disease of shrimp Bull. Eur. Ass. Fish Pathol., 22(2) 2002, 58 National and international impacts of white spot disease of shrimp Barry Hill Centre for Environment, Fisheries and Aquaculture Science, Weymouth, UK Introduction

More information

Tissue distribution of white spot syndrome virus (WSSV) in shrimp and crabs

Tissue distribution of white spot syndrome virus (WSSV) in shrimp and crabs Tissue distribution of white spot syndrome virus (WSSV) in shrimp and crabs *Guang-Hsiung Kou, Shao-En Peng, Ya-Lin Chiu, Chu-Fang Lo Department of Zoology, National Taiwan University, Taipei, Taiwan,

More information

How to prevent and control viral diseases in shrimp culture

How to prevent and control viral diseases in shrimp culture How to prevent and control viral diseases in shrimp culture Shrimp Farming in Thailand Farming Area: 80,000 Hectares No. of Farms: 35,000 Geographical Spreading: Eastern (20%) Southern (40%) Central (40%,

More information

Taura Syndrome Virus Disease in Farm-Reared Penaeus monodon in Thailand

Taura Syndrome Virus Disease in Farm-Reared Penaeus monodon in Thailand Kasetsart J. (Nat. Sci.) 41 : 319-323 (2007) Taura Syndrome Virus Disease in Farm-Reared Penaeus monodon in Thailand Chalor Limsuwan and Niti Chuchird* ABSTRACT Taura syndrome virus (TSV) has caused major

More information

Current status of transboundary fish diseases in Thailand: Occurrence, surveillance, research and training

Current status of transboundary fish diseases in Thailand: Occurrence, surveillance, research and training Current status of transboundary fish diseases in Thailand: Occurrence, surveillance, research and training Kanchanakhan, Somkiat Date published: 2004 To cite this document : Kanchanakhan, S. (2004). Current

More information

Differences in susceptibility of palaemonid shrimp species to yellow head virus (YHV) infection

Differences in susceptibility of palaemonid shrimp species to yellow head virus (YHV) infection DISEASES OF AQUATIC ORGANISMS Vol. 64: 5 12, 2005 Published April 6 Dis Aquat Org Differences in susceptibility of palaemonid shrimp species to yellow head virus (YHV) infection Siwaporn Longyant 1, Paisarn

More information

White Spot Disease in Mozambique

White Spot Disease in Mozambique White Spot Disease in Mozambique Experiences and lessons learned A.P. BALOI (1), M. LE GROUMELLEC (2) (1) Ministry of Fisheries, National Institute for Fish Inspection, Mozambique. (2) OIE Consultant on

More information

Challenges for Providing Diagnostic Service: White Spot Disease (WSD)

Challenges for Providing Diagnostic Service: White Spot Disease (WSD) Regional Meeting of OIE Reference Centres in Asia and the Pacific6-7 February 2017, Tokyo, Japan Challenges for Providing Diagnostic Service: White Spot Disease (WSD) Grace Chu-Fang Lo National Cheng Kung

More information

Outline. 1. Management organizations in Japan. 2. Prevention measures against fish disease invasion and spread. 3. Nishikigoi export program

Outline. 1. Management organizations in Japan. 2. Prevention measures against fish disease invasion and spread. 3. Nishikigoi export program Health certification for ornamental fish in Japan Nanae Karakawa Fish and Fishery Products Safety Office, Food Safety and Consumer Affairs Bureau, Ministry of Agriculture, Forestry and Fisheries (MAFF),

More information

A critical review on White Spot Syndrome Virus (WSSV): A potential threat to shrimp farming in Bangladesh and some Asian countries

A critical review on White Spot Syndrome Virus (WSSV): A potential threat to shrimp farming in Bangladesh and some Asian countries International Journal of Microbiology and Mycology IJMM pissn: 2309-4796 http://www.innspub.net Vol. 6, No. 1, p. 39-48, 2017 Open Access REVIREW PAPER A critical review on White Spot Syndrome Virus (WSSV):

More information

The Viability of Taura Syndrome Virus in Low-salinity Water

The Viability of Taura Syndrome Virus in Low-salinity Water Kasetsart J. (Nat. Sci.) 39 : 406-410 (2005) The Viability of Taura Syndrome Virus in Low-salinity Water Niti Chuchird and Chalor Limsuwan ABSTRACT Taura syndrome virus (TSV) could survive up to 10 days

More information

15. Zoosanitary information I, the undersigned official inspector, hereby certify that the aquatic animals above satisfy the following requirements.

15. Zoosanitary information I, the undersigned official inspector, hereby certify that the aquatic animals above satisfy the following requirements. Certificate number: HEALTH CERTIFICATE FOR LIVE CRUSTACEANS EXPORTED FROM KOREA TO JAPAN 1. Competent Authority: 2. Consignor Name: Address: 3. Consignee Name: Address: 4. Place of origin Name: Farm address

More information

< Attachment 2 > 1.A) The country, zone, compartment or establishment is free of the target disease:

< Attachment 2 > 1.A) The country, zone, compartment or establishment is free of the target disease: Certificate number: Health Certificate for Live Crustaceans Exported from Thailand to Japan 1. Competent Authority: 2. Consignor 3. Consignee 4. Place of origin 5. Place of destination 6.Port of Embarkation:

More information

Sampling and evaluation of white spot syndrome virus in commercially important Atlantic penaeid shrimp stocks

Sampling and evaluation of white spot syndrome virus in commercially important Atlantic penaeid shrimp stocks DISEASES OF AQUATIC ORGANISMS Vol. 59: 179 185, 2004 Published June 11 Dis Aquat Org Sampling and evaluation of white spot syndrome virus in commercially important Atlantic penaeid shrimp stocks Robert

More information

Short communication. C W Tung, C S Wang and S N Chen

Short communication. C W Tung, C S Wang and S N Chen Short communication Histological and electron microscopic study on Macrobrachium muscle virus (MMV) infection in the giant freshwater prawn, Macrobrachium rosenbergii (de Man), cultured in Taiwan C W Tung,

More information

2. Review of literature

2. Review of literature ebiew ~( ~iterature 2. Review of literature 2.1 Shrimp aquaculture Global capture production In 2006 was about 92 million tonnes which is a decrease of 2.2 million tonnes in comparison with 2005. Nearly

More information

Abstract: During the June until September 2005 two hundred shrimp Penaeus. Delvar and Mond) along the coast of Bushehr province.

Abstract: During the June until September 2005 two hundred shrimp Penaeus. Delvar and Mond) along the coast of Bushehr province. Prevalence of white spot syndrome virus (WSSV) in the cultured shrimp Penaeus indicus along the coast of Bushehr Province M.afsharnasab 1, A, dashtyannasab 2 and V, yeganeh 2 Email:mafsharnasab@yahoo.com

More information

However, 31.2% showed resistance to cotrimaxasole, 91.6% to sulphafurazole and 65.8% to sulphadiazine (Otta, 1997).

However, 31.2% showed resistance to cotrimaxasole, 91.6% to sulphafurazole and 65.8% to sulphadiazine (Otta, 1997). 416 I. Karunasagar, S. K. Otta et al. (1994) reported mass mortality of P. monodon larvae due to chloramphenicol resistant strains of V. harveyi. Later studies showed that V harveyi is capable of forming

More information

Identification of Stressors that Affect White Spot Syndrome Virus (WSSV) Infection and Outbreak in Pond Cultured Penaeus monodon

Identification of Stressors that Affect White Spot Syndrome Virus (WSSV) Infection and Outbreak in Pond Cultured Penaeus monodon The Israeli Journal of Aquaculture - Bamidgeh, IIC:63.2011.616, 7 pages The IJA appears exclusively as a peer-reviewed on-line open access journal at http://www.siamb.org.il Sale of IJA papers is strictly

More information

The University of Arizona 4/17/2008

The University of Arizona 4/17/2008 World Organisation for Animal Health Overview of Diseases and Health Management Issues Related to Farmed Shrimp Carlos R. Pantoja, Donald V. Lightner, Bonnie T. Poulos, Linda Nunan, Kathy F.J. Tang, Rita

More information

Introductions and movement of Penaeus vannamei and Penaeus stylirostris in Asia and the Pacific

Introductions and movement of Penaeus vannamei and Penaeus stylirostris in Asia and the Pacific RAP publication 2004/10 Introductions and movement of Penaeus vannamei and Penaeus stylirostris in Asia and the Pacific Matthew Briggs, Simon Funge-Smith, Rohana Subasinghe and Michael Phillips FOOD AND

More information

Summary and Conclusions

Summary and Conclusions s The present investigation has been designed to identify the various endemic diseases and their control measure prevailing in selected cultured shrimps, L. vannamei.and P. monodon. The study has envisaged

More information

Introductions and movement of Penaeus vannamei and Penaeus stylirostris in Asia and the Pacific RAP PUBLICATION 2004/10

Introductions and movement of Penaeus vannamei and Penaeus stylirostris in Asia and the Pacific RAP PUBLICATION 2004/10 Introductions and movement of Penaeus vannamei and Penaeus stylirostris in Asia and the Pacific RAP PUBLICATION 2004/10 RAP Publication 2004/10 Introductions and movement of Penaeus vannamei and Penaeus

More information

Infectious Myonecrosis Virus (IMNV) in Pacific White Shrimp (Litopenaeus vannamei) in Indonesia

Infectious Myonecrosis Virus (IMNV) in Pacific White Shrimp (Litopenaeus vannamei) in Indonesia SEAFDEC International Workshop on Emerging Fish Diseases in Asia 255 Infectious Myonecrosis Virus (IMNV) in Pacific White Shrimp (Litopenaeus vannamei) in Indonesia Taukhid1* and Yani Lestari Nur aini2

More information

Proposal to Introduce Whiteleg Shrimp (Litopenaeus vannamei) to the Kingdom of Saudi Arabia for Aquaculture Development

Proposal to Introduce Whiteleg Shrimp (Litopenaeus vannamei) to the Kingdom of Saudi Arabia for Aquaculture Development Final Draft Proposal to Introduce Whiteleg Shrimp (Litopenaeus vannamei) to the Kingdom of Saudi Arabia for Aquaculture Development Prepared for Saudi Aquaculture Society by J. Richard Arthur, Victoria

More information

Biosecurity Aquaculture, South Africa

Biosecurity Aquaculture, South Africa Stakeholder Consultation on Progressive Management Pathway (PMP) to Improve Aquaculture Biosecurity World Bank Headquarters, Washington, D.C. 10-12 April 2018 Biosecurity Aquaculture, South Africa Kevin

More information

Examination for Viral Inactivation of WSSV (White Spot Syndrome Virus) Isolated in Malaysia Using Black Tiger Prawn (Penaeus monodon)

Examination for Viral Inactivation of WSSV (White Spot Syndrome Virus) Isolated in Malaysia Using Black Tiger Prawn (Penaeus monodon) JARQ 4 (1), 93 97 (26) http://www.jircas.affrc.go.jp Examination for Viral Inactivation of WSSV (White Spot Syndrome Virus) Isolated in Malaysia Using Black Tiger Prawn (Penaeus monodon) Norihisa OSEKO

More information

INFECTIOUS MYONECROSIS VIRUS (IMNV) IN PACIFIC WHITE SHRIMP, Litopenaeus vannamei IN INDONESIA

INFECTIOUS MYONECROSIS VIRUS (IMNV) IN PACIFIC WHITE SHRIMP, Litopenaeus vannamei IN INDONESIA Infectious myonecrosis virus... (Taukhid) INFECTIOUS MYONECROSIS VIRUS (IMNV) IN PACIFIC WHITE SHRIMP, Litopenaeus vannamei IN INDONESIA Taukhid *), and Yani Lestari Nur aini **) ABSTRACT The aquaculture

More information

Update on the strategy planning for Infectious myonecrosis (IMN) disease

Update on the strategy planning for Infectious myonecrosis (IMN) disease Second Interregional Workshop of FAO TCP/INT/3501 Update on the strategy planning for Infectious myonecrosis (IMN) disease Kathy F.J. Tang Tucson, Arizona, USA Components of a contingency plan Technical

More information

Transboundary Aquatic Animal Diseases: History and Impacts in ASEAN Aquaculture

Transboundary Aquatic Animal Diseases: History and Impacts in ASEAN Aquaculture Network of Aquaculture Centres in Asia-Pacific Transboundary Aquatic Animal Diseases: History and Impacts in ASEAN Aquaculture Eduardo M. Leaño Network of Aquaculture Centres in Asia-Pacific Bangkok, Thailand

More information

The Terms of Reference were adopted and the final version is shown in Annex III.

The Terms of Reference were adopted and the final version is shown in Annex III. Original: English February 2015 REPORT OF THE FIRST MEETING OF OIE AD HOC GROUP ON SUSCEPTIBILITY OF CRUSTACEAN SPECIES TO INFECTION WITH OIE LISTED DISEASES 1 Paris, 10 12 February 2015 The OIE ad hoc

More information

Study on the Pathogenesis of the White Spot Syndrome Virus (WSSV) on Juvenile Penaeus monodon in Vietnam

Study on the Pathogenesis of the White Spot Syndrome Virus (WSSV) on Juvenile Penaeus monodon in Vietnam 248 The Israeli Journal of Aquaculture Bamidgeh 61(3), 2009 Study on the Pathogenesis of the White Spot Syndrome Virus (WSSV) on Juvenile Penaeus monodon in Vietnam Cuong Van Doan, Anh Thi Tuyet Pham,

More information

Confirmatory testing of the viral status of Penaeus monodon (Black Tiger shrimp) populations in the Fiji Islands

Confirmatory testing of the viral status of Penaeus monodon (Black Tiger shrimp) populations in the Fiji Islands Final report for Mini-project MS0401: Confirmatory testing of the viral status of Penaeus monodon (Black Tiger shrimp) populations in the Fiji Islands Salote Waqairatu Dr. Timothy Pickering The University

More information

Biju V. N* and B. Gunalan. Abstract

Biju V. N* and B. Gunalan. Abstract Volume: 2; Issue: 12; December -2016; pp 1019-1025. ISSN: 2454-5422 Prevalence of white faeces syndrome in Penaeus (Litopenaeus) vannamei farms in Nagapattinam district Biju V. N* and B. Gunalan Centre

More information

2. Viral diseases of shrimp in the Philippines

2. Viral diseases of shrimp in the Philippines Research Signpost 37/661 (2), Fort P.O. Trivandrum-695 023 Kerala, India Biotechnological Advances in Shrimp Health Management in the Philippines, 2015: 19-44 ISBN: 978-81-308-0558-0 Editors: Christopher

More information

D. V. Lightner, R. R. Williams, T. A. Bell, R. M. Redman, and L. A. Perez A. Introduction

D. V. Lightner, R. R. Williams, T. A. Bell, R. M. Redman, and L. A. Perez A. Introduction ICES mar. Sei. Symp., 194: 97-105. 1992 A collection of case histories documenting the introduction and spread of the virus disease IHHN in penaeid shrimp culture facilities in Northwestern Mexico D. V.

More information

Environmental impact of the establishment of exotic prawn pathogens in Australia

Environmental impact of the establishment of exotic prawn pathogens in Australia Environmental impact of the establishment of exotic prawn pathogens in Australia a consultancy report to AQIS Prepared for: Australian Quarantine and Inspection Service GPO Box 858 Canberra ACT 2601 Australia

More information

World Animal Health Information and Analysis Department Copyright OIE, 2015

World Animal Health Information and Analysis Department Copyright OIE, 2015 Copyright OIE, 2015 World Animal Health Information and Analysis Department information.dept@oie.int WORLD ORGANISATION FOR ANIMAL HEALTH (OIE) 12, rue de Prony, 75017 Paris, France Tel: (33-1) 44 15 18

More information

Studies on the Effect of Unilateral Eyestalk Ablation in Maturation of Gonads of a Freshwater Prawn Macrobrachium dayanum

Studies on the Effect of Unilateral Eyestalk Ablation in Maturation of Gonads of a Freshwater Prawn Macrobrachium dayanum World Journal of Zoology 6 (2): 159-163, 2011 ISSN 1817-3098 IDOSI Publications, 2011 Studies on the Effect of Unilateral Eyestalk Ablation in Maturation of Gonads of a Freshwater Prawn Macrobrachium dayanum

More information

The Open Access Israeli Journal of Aquaculture Bamidgeh

The Open Access Israeli Journal of Aquaculture Bamidgeh The Open Access Israeli Journal of Aquaculture Bamidgeh As from January 2010 The Israeli Journal of Aquaculture - Bamidgeh (IJA) will be published exclusively as an on-line Open Access (OA) quarterly accessible

More information

INTRODUCTION. KEY WORDS: Viral transmission. White spot syndrome virus. Penaeus monodon. Crab. Krill. DISEASES OF AQUATIC ORGANISMS Dis Aquat Org

INTRODUCTION. KEY WORDS: Viral transmission. White spot syndrome virus. Penaeus monodon. Crab. Krill. DISEASES OF AQUATIC ORGANISMS Dis Aquat Org Vol. 32: 79-85,1998 DISEASES OF AQUATIC ORGANISMS Dis Aquat Org l Published March 5 Experimental transmission of white spot syndrome virus (WSSV) from black tiger shrimp Penaeus monodon to the sand crab

More information

A White Spot Disease - like syndrome in the Pacific Blue Shrimp (Litopenaeus stylirostris) as a form of bacterial shell disease

A White Spot Disease - like syndrome in the Pacific Blue Shrimp (Litopenaeus stylirostris) as a form of bacterial shell disease Aquaculture MARCH 2000; 183 (1-2) : 25-30 http://dx.doi.org/ 10.1016/S0044-8486(99)00284-7 @ 2004 Elsevier B.V. All rights reserved Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle de l

More information

EFFECTS OF ACUTE SALINITY STRESS ON OXYGEN CONSUMPTION AND AMMONIA EXCRETION RATES OF THE MARINE SHRIMP METAPENAEUS MONOCEROS

EFFECTS OF ACUTE SALINITY STRESS ON OXYGEN CONSUMPTION AND AMMONIA EXCRETION RATES OF THE MARINE SHRIMP METAPENAEUS MONOCEROS JOURNAL OF CRUSTACEAN BIOLOGY, 22(1): 45 52, 2002 EFFECTS OF ACUTE SALINITY STRESS ON OXYGEN CONSUMPTION AND AMMONIA EXCRETION RATES OF THE MARINE SHRIMP METAPENAEUS MONOCEROS Bindu R. Pillai and A. D.

More information

Model of white spot syndrome virus (WSSV) epidemics in Litopenaeus vannamei

Model of white spot syndrome virus (WSSV) epidemics in Litopenaeus vannamei DISEASES OF AQUATIC ORGANISMS Vol. 50: 199 209, 2002 Published July 29 Dis Aquat Org Model of white spot syndrome virus (WSSV) epidemics in Litopenaeus vannamei Jeffrey M. Lotz*, M. Andres Soto** Department

More information

Impact of Eyestalk Ablation on the Androgenic Gland Activity in the Freshwater Prawn Macrobrachium rosenbergii (De Man)

Impact of Eyestalk Ablation on the Androgenic Gland Activity in the Freshwater Prawn Macrobrachium rosenbergii (De Man) World Journal of Fish and Marine Sciences 5 (4): 373-381, 2013 ISSN 2078-4589 IDOSI Publications, 2013 DOI: 10.5829/idosi.wjfms.2013.05.04.731 Impact of Eyestalk Ablation on the Androgenic Gland Activity

More information

The study of binding between VP28 of WSSV and Rab7 of

The study of binding between VP28 of WSSV and Rab7 of The study of binding between VP28 of WSSV and Rab7 of giant tiger prawn Penaeus monodon Yi-Cheng Huang, Hong Sun, Yu-San Han Institute of Fisheries Science, National Taiwan University, Taipei, Taiwan Abstract:

More information

AQUAVETPLAN. Disease Strategy

AQUAVETPLAN. Disease Strategy AUST RALIAN AQUAT IC VETERINARY EMERGENCY PLAN AQUAVETPLAN Disease Strategy White spot disease Version 2, 2013 AQUAVETPLAN is a series of technical response manuals for aquatic animal disease incursions,

More information

news from colleagues epidemiology & animal disease control programmes Self declaration by France on the recovery of its rabies-free status

news from colleagues epidemiology & animal disease control programmes Self declaration by France on the recovery of its rabies-free status epidemiology & animal disease control programmes Self declaration by France on the recovery of its rabies-free status (in accord with article 8.10.2. of the Terrestrial Animal Health Code of the OIE, 2009

More information

OIE-Listed diseases/ Criteria for listing/ Disease Notification and Reporting Obligations

OIE-Listed diseases/ Criteria for listing/ Disease Notification and Reporting Obligations OIE-Listed diseases/ Criteria for listing/ Disease Notification and Reporting Obligations Regional Seminar for OIE National Focal Points for Aquatic Animals Lisbon, Portugal, 9-11 April 2013 Dr François

More information

Susceptibility to Taura Syndrome Virus of Some Penaeid Shrimp Species Native to the Gulf of Mexico and the Southeastern United States

Susceptibility to Taura Syndrome Virus of Some Penaeid Shrimp Species Native to the Gulf of Mexico and the Southeastern United States University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications from the Harold W. Manter Laboratory of Parasitology Parasitology, Harold W. Manter Laboratory of 3-1997

More information

MARTHA ZARAIN-HERZBERG NORMA HERNANDEZ-SAAVEDRA FELIPE ASCENCIO-VALLE

MARTHA ZARAIN-HERZBERG NORMA HERNANDEZ-SAAVEDRA FELIPE ASCENCIO-VALLE JOURNAL OF THE WORLD AQUACULTURE SOCIETY Vol. 34, No. 1 March, 2003 Biological Characterization of a Less Virulent Taura Syndrome in Pacific White Shrimp Litopenaeus vannamei (Crustacea: Decapoda): Gross

More information

Agricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA

Agricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA Agricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA David L. Suarez Southeast Poultry Research Laboratory, Exotic and Emerging Avian Viral Diseases Research

More information

Electron Microscopic Evidence of Bacilliform Virus Infection in Kuruma Shrimp (Penaeus japonicus)

Electron Microscopic Evidence of Bacilliform Virus Infection in Kuruma Shrimp (Penaeus japonicus) Electron Microscopic Evidence Bacilliform Virus Infection in Kuruma Shrimp (Penaeus japonicus) Yukinori Takahashi*1, Toshiaki Itami*1, Masakazu Kondo*2, Minoru Maeda*1, Reiko Fujii*3, Susumu Tomonaga3,

More information

Influence of β- estradiol hormone and eyestalk ablation on Protein Metabolism in fresh water crab, Barytelphusa cunicularis

Influence of β- estradiol hormone and eyestalk ablation on Protein Metabolism in fresh water crab, Barytelphusa cunicularis Bioscience Discovery, 8(3): 602-607, July - 2017 RUT Printer and Publisher Print & Online, Open Access, Research Journal Available on http://jbsd.in ISSN: 2229-3469 (Print); ISSN: 2231-024X (Online) Research

More information

bacterial shell disease

bacterial shell disease Ž. Aquaculture 183 2000 25 30 www.elsevier.nlrlocateraqua-online A white spot disease-like syndrome in the Pacific blue shrimp ž Litopenaeus stylirostris/ as a form of bacterial shell disease Cyrille Goarant

More information

Vaccination of Penaeus monodon Against White Spot Syndrome Virus Using Structural Virion Proteins

Vaccination of Penaeus monodon Against White Spot Syndrome Virus Using Structural Virion Proteins Diseases in Asian Aquaculture V Vaccination of Penaeus monodon Against White Spot Syndrome Virus Using Structural Virion Proteins JEROEN WITTEVELDT, MARK JOLINK, CAROLINA ESPITA CIFUENTES, JUST M. VLAK

More information

Necrotizing Hepatopancreatitis

Necrotizing Hepatopancreatitis [DRAFT] Necrotizing Hepatopancreatitis Pathogen information 1. Causative agent 1.1. Pathogen type Obligate intracellular rickettsial-like organism 1.2. Disease name and synonyms Necrotizing Hepatopancreatitis

More information

In vivo titration of white spot syndrome virus (WSSV) in specific pathogen-free Litopenaeus vannamei by intramuscular and oral routes

In vivo titration of white spot syndrome virus (WSSV) in specific pathogen-free Litopenaeus vannamei by intramuscular and oral routes DISEASES OF AQUATIC ORGANISMS Vol. 66: 163 170, 2005 Published September 5 Dis Aquat Org NOTE In vivo titration of white spot syndrome virus (WSSV) in specific pathogen-free Litopenaeus vannamei by intramuscular

More information

Morphogenesis, Pathogenesis, Detection and Transmission Risks of White Spot Syndrome Virus in Shrimps

Morphogenesis, Pathogenesis, Detection and Transmission Risks of White Spot Syndrome Virus in Shrimps REVIEW Morphogenesis, Pathogenesis, Detection and Transmission Risks of White Spot Syndrome Virus in Shrimps Fisheries and Aquaculture Journal, Vol. 2013: FAJ-66 Fisheries and Aquaculture Journal, Vol.

More information

Prevalence of White Spot Syndrome Virus (WSSV) and Monodon Baculovirus (MBV) Infection in Penaeus monodon Postlarvae in Vietnam

Prevalence of White Spot Syndrome Virus (WSSV) and Monodon Baculovirus (MBV) Infection in Penaeus monodon Postlarvae in Vietnam Diseases in Asian Aquaculture V Prevalence of White Spot Syndrome Virus (WSSV) and Monodon Baculovirus (MBV) Infection in Penaeus monodon Postlarvae in Vietnam DANG THI HOANG OANH, NGUYEN THANH PHUONG

More information

V M I INFORMATION TO USERS

V M I INFORMATION TO USERS INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter

More information

REVIEW OF LITERATURE

REVIEW OF LITERATURE REVIEW OF LITERATURE 2. REVIEW OF LITERATURE The past three decades have witnessed remarkable expansion, intensification and diversification of the aquaculture sector which has become enormously reliant

More information

C.7 SPAWNER-ISOLATED

C.7 SPAWNER-ISOLATED C.7 SPAWNER-ISOLATED MORTALITY VIRUS DISEASE (SMVD) 4 C.7.1 Background Information C.7.1.1 Causative Agent Spawner-isolated Mortality Virus Disease (SMVD) is caused by a single-stranded icosahedral DNA

More information

A Reo-like virus associated with high mortality rates in cultured mud crab, Scylla serrata, in East China

A Reo-like virus associated with high mortality rates in cultured mud crab, Scylla serrata, in East China Diseases in Asian Aquaculture VII A Reo-like virus associated with high mortality rates in cultured mud crab, Scylla serrata, in East China JI-GANG CHEN, JI-FANG YANG, DAN LOU, XIONG JUAN and SONG-YAN

More information

CHAPTER 5. Aquatic animal health

CHAPTER 5. Aquatic animal health CHAPTER 5 Aquatic animal health The health management of finfish, crustaceans and molluscs is an essential element of maintaining aquaculture productivity, fisheries resources and biodiversity in Australia.

More information

Effects of shrimp density on transmission of penaeid acute viremia in Penaeus japonicus by cannibalism and the waterborne route

Effects of shrimp density on transmission of penaeid acute viremia in Penaeus japonicus by cannibalism and the waterborne route DISEASES OF AQUATIC ORGANISMS Vol. 47: 129 135, 2001 Published November 8 Dis Aquat Org Effects of shrimp density on transmission of penaeid acute viremia in Penaeus japonicus by cannibalism and the waterborne

More information

A Study on the Prevalence of MBV and WSSV in Wild Caught P. monodon Brood Stock in the East Coast of India

A Study on the Prevalence of MBV and WSSV in Wild Caught P. monodon Brood Stock in the East Coast of India A Study on the Prevalence of MBV and WSSV in Wild Caught P. monodon Brood Stock in the East Coast of India Authors: Y.C. Thampi Sam Raj A.K. Panda D. Kannan Speaker: Dr. A.K.Panda Rajiv Gandhi Centre for

More information

University of Southampton Research Repository eprints Soton

University of Southampton Research Repository eprints Soton University of Southampton Research Repository eprints Soton Copyright and Moral Rights for this thesis are retained by the author and/or other copyright owners. A copy can be downloaded for personal non-commercial

More information

GUIDELINES. Six-monthly report. on the absence or presence. of OIE-listed diseases

GUIDELINES. Six-monthly report. on the absence or presence. of OIE-listed diseases GUIDELINES Six-monthly report on the absence or presence of OIE-listed diseases Aquatic Animal Diseases 2 0 1 2 V e r s i o n It is highly recommended to use WAHIS for on-line notifications. The completed

More information

AACL BIOFLUX Aquaculture, Aquarium, Conservation & Legislation International Journal of the Bioflux Society

AACL BIOFLUX Aquaculture, Aquarium, Conservation & Legislation International Journal of the Bioflux Society AACL BIOFLUX Aquaculture, Aquarium, Conservation & Legislation International Journal of the Bioflux Society First report on White Spot Syndrome Virus (WSSV) infection in white leg shrimp Litopenaeus vannamei

More information

The Special Danger of Viral Pathogens in Shrimp Translocated for Aquaculture

The Special Danger of Viral Pathogens in Shrimp Translocated for Aquaculture doi: 10.2306/scienceasia1513-1874.2006.32.215 ScienceAsia 32 (2006): 215-221 The Special Danger of Viral Pathogens in Shrimp Translocated for Aquaculture Timothy W. Flegel * Centex Shrimp and National

More information

DISEASES OF AQUATIC ORGANISMS Dis. aquat. Org. Lymphoidal parvovirus-like particles in Australian penaeid prawns

DISEASES OF AQUATIC ORGANISMS Dis. aquat. Org. Lymphoidal parvovirus-like particles in Australian penaeid prawns Vol. 11: 129-134, 1991 DISEASES OF AQUATIC ORGANISMS Dis. aquat. Org. ' Published August 8 Lymphoidal parvovirus-like particles in Australian penaeid prawns Leigh Owens, Steve De Beer, Jan Smith Graduate

More information

THE HISTOLOGICAL STRUCTURE OF THE ANDROGENIC GLAND AND CELLULAR CORD OF THE MALE REPRODUCTIVE SYSTEM OF ADULT LITOPENAEUS AND RIMAPENAEUS BYRDI

THE HISTOLOGICAL STRUCTURE OF THE ANDROGENIC GLAND AND CELLULAR CORD OF THE MALE REPRODUCTIVE SYSTEM OF ADULT LITOPENAEUS AND RIMAPENAEUS BYRDI JOURNAL OF CRUSTACEAN BIOLOGY, 32(3), 351-357, 2012 THE HISTOLOGICAL STRUCTURE OF THE ANDROGENIC GLAND AND CELLULAR CORD OF THE MALE REPRODUCTIVE SYSTEM OF ADULT LITOPENAEUS AND RIMAPENAEUS BYRDI Jorge

More information

Transcriptional Analysis for Oral Vaccination of Recombinant Viral Proteins against White Spot Syndrome Virus (WSSV) in Litopenaeus vannamei

Transcriptional Analysis for Oral Vaccination of Recombinant Viral Proteins against White Spot Syndrome Virus (WSSV) in Litopenaeus vannamei J. Microbiol. Biotechnol. (2011), 21(2), 170 175 doi: 10.4014/jmb.1005.05036 First published online 26 November 2010 Transcriptional Analysis for Oral Vaccination of Recombinant Viral Proteins against

More information

Effects of Lecithin on Cholesterol Digestibility in the Prawn, Artemesia longinaris (Crustacea, Penaeidae)

Effects of Lecithin on Cholesterol Digestibility in the Prawn, Artemesia longinaris (Crustacea, Penaeidae) The Israeli Journal of Aquaculture Bamidgeh 60(1), 2008, 13-19. 13 Effects of Lecithin on Cholesterol Digestibility in the Prawn, Artemesia longinaris (Crustacea, Penaeidae) Nora S. Haran1* and Jorge L.

More information

International Journal of Research in Biological Sciences

International Journal of Research in Biological Sciences Available online at http://www.urpjournals.com International Journal of Research in Biological Sciences Universal Research Publications. All rights reserved ISSN 2249 9687 Original Article Acid phosphatase

More information

Current status of transboundary fish diseases in Singapore: Occurrence, surveillance, research and training

Current status of transboundary fish diseases in Singapore: Occurrence, surveillance, research and training Current status of transboundary fish diseases in Singapore: Occurrence, surveillance, research and training Huat, Ling Kai; Kueh, Susan & Kwang, Poh Yew Date published: 2004 To cite this document : Huat,

More information

INTERNATIONAL JOURNAL OF PHARMACY & LIFE SCIENCES

INTERNATIONAL JOURNAL OF PHARMACY & LIFE SCIENCES INTERNATIONAL JOURNAL OF PHARMACY & LIFE SCIENCES Ovarian maturation and spawning in the tiger shrimp, Penaeus monodon by serotonin and dopamine injection K. Nagur Babu, P.N. Pallavi, D.C. Reddy and N.

More information

Ovarian Maturation in the Macrobrachium nipponense by Serotonin Injection

Ovarian Maturation in the Macrobrachium nipponense by Serotonin Injection International Research Journal of Applied and Basic Sciences 2013 Available online at www.irjabs.com ISSN 2251-838X / Vol, 4 (5): 1272-1276 Science Explorer Publications Ovarian Maturation in the Macrobrachium

More information

Nutra-Kol NUTRITION SOLUTIONS

Nutra-Kol NUTRITION SOLUTIONS Nutra-Kol NUTRITION SOLUTIONS Nutra-Kol is a vibrant Australian company focusing on the nutrition and health of aquatic organisms. Nutra-Kol products include feed additives and natural health solutions

More information

Internal and External Anatomy of a Penaeid Shrimp

Internal and External Anatomy of a Penaeid Shrimp Internal and External Anatomy of a Penaeid Shrimp stomach eye stalk oesophagus antenna pereiopods Internal and external anatomy of a penaeid shrimp. hepatopancreas heart pleopods hindgut abdominal segment

More information

Viral diseases. Lio-Po, Gilda D. Date published: 2001

Viral diseases. Lio-Po, Gilda D. Date published: 2001 Viral diseases Lio-Po, Gilda D. Date published: 2001 To cite this document : Lio-Po, G. D. (2001). Viral diseases. In G. D. Lio-Po, C. R. Lavilla, & E. R. Cruz- Lacierda (Eds.), Health management in aquaculture

More information

A Short Review on Infectious Viruses in Cultural Shrimps (Penaeidae Family).

A Short Review on Infectious Viruses in Cultural Shrimps (Penaeidae Family). 9(3): 009-015 (2015) Journal of FisheriesSciences.com E-ISSN 1307-234X 2014 www.fisheriessciences.com Review Article ORIGINAL ARTICLE A Short Review on Infectious Viruses in Cultural Shrimps (Penaeidae

More information

Strategies for the Control of Viral Diseases

Strategies for the Control of Viral Diseases Strategies for the Control of Viral Diseases of Shrimp in the Americas Donald V. Lightner and R. M. Redman Department of Veterinary Science and Microbiology, University of Arizona, Tucson, Arizona 85721

More information

Journal of Advanced Scientific Research

Journal of Advanced Scientific Research Debnath P. P. et al, J Adv Sci Res, 212, 3(3): 58-63 58 Journal of Advanced Scientific Research Available online through http://www.sciensage.info/jasr ISSN 976-9595 Research Article Prevalence of White

More information

Low sequence variation among isolates of infectious hypodermal and hematopoietic necrosis virus (IHHNV) originating from Hawaii and the Americas

Low sequence variation among isolates of infectious hypodermal and hematopoietic necrosis virus (IHHNV) originating from Hawaii and the Americas DISEASES OF AQUATIC ORGANISMS Vol. 49: 93 97, 2002 Published May 10 Dis Aquat Org Low sequence variation among isolates of infectious hypodermal and hematopoietic necrosis virus (IHHNV) originating from

More information

Poultry Hydrolysates. enhance Stress Resistance in Pacific White Shrimp (Litopenaeus vannamei)

Poultry Hydrolysates. enhance Stress Resistance in Pacific White Shrimp (Litopenaeus vannamei) Poultry Hydrolysates enhance Stress Resistance in Pacific White Shrimp (Litopenaeus vannamei) Presentation at the Asia Pacific Aquaculture Ho Chi Minh City, Vietnam December 10-13th, 2013 Dr. sc. agr.

More information

Lipid requirements of shrimp

Lipid requirements of shrimp ADVANCES IN TROPICAL AQUACULTURE Tahiti, Feb. 20 March 4, 1989 AOUACOP 1FREMER Actes de Colloque 9 pp. 277-285. 28 Lipid requirements of shrimp L.R. D'ABRAMO Department of Wildlife and Fisheries. Mississippi

More information

Stimulation of Molting and Ovarian Maturation by Methyl Farnesoate in the Pacific White Shrimp Litopenaeus vannamei (Boone, 1931)

Stimulation of Molting and Ovarian Maturation by Methyl Farnesoate in the Pacific White Shrimp Litopenaeus vannamei (Boone, 1931) Original Article Fish Aquat Sci 17(1), 115-121, 2014 Stimulation of Molting and Ovarian Maturation by Methyl Farnesoate in the Pacific White Shrimp Litopenaeus vannamei (Boone, 1931) Tariq Alnawafleh,

More information

Update on developments in Aquatic Animal Health. Dr Olga Haenen. Member OIE Aquatic Animal Health Standards Commission

Update on developments in Aquatic Animal Health. Dr Olga Haenen. Member OIE Aquatic Animal Health Standards Commission Update on developments in Aquatic Animal Health Dr Olga Haenen Member OIE Aquatic Animal Health Standards Commission Outline 1. Aquatic Animal Health Standards Commission (AAC) 2. Aquaculture & trends

More information

Reo-like virus in white shrimp Penaeus vannamei (Crustacea: Decapoda): CO-occurrence with Baculovirus penaei in experimental infections

Reo-like virus in white shrimp Penaeus vannamei (Crustacea: Decapoda): CO-occurrence with Baculovirus penaei in experimental infections Vol. 8: 45-49, 1990 DISEASES OF AQUATIC ORGANISMS Dis. aquat. Org. Published March 6 Reo-like virus in white shrimp Penaeus vannamei (Crustacea: Decapoda): CO-occurrence with Baculovirus penaei in experimental

More information

OIE 12, rue de Prony Paris France Tel.: 33 (0) Fax: 33 (0)

OIE 12, rue de Prony Paris France Tel.: 33 (0) Fax: 33 (0) Original: English February 2018 REPORT OF THE MEETING OF THE OIE AQUATIC ANIMAL HEALTH STANDARDS COMMISSION Paris, 14 21 February 2018 The OIE Aquatic Animal Health Standards Commission (hereinafter referred

More information

Caroline H. Seibert, Aguinaldo R. Pinto* Submitted: July 12, 2011; Approved: June 07, ABSTRACT

Caroline H. Seibert, Aguinaldo R. Pinto* Submitted: July 12, 2011; Approved: June 07, ABSTRACT Brazilian Journal of Microbiology (2012): 857-864 ISSN 1517-8382 CHALLENGES IN SHRIMP AQUACULTURE DUE TO VIRAL DISEASES: DISTRIBUTION AND BIOLOGY OF THE FIVE MAJOR PENAEID VIRUSES AND INTERVENTIONS TO

More information

Protein Expression and Microscopic Evidence of White Spot Syndrome Virus (WSSV) in Tiger prawns Penaeus monodon

Protein Expression and Microscopic Evidence of White Spot Syndrome Virus (WSSV) in Tiger prawns Penaeus monodon Protein Expression and Microscopic Evidence of White Spot Syndrome Virus (WSSV) in Tiger prawns Penaeus monodon Bhatt, S.S. a*, Chavda, D. V. a and Sreepada, R. A. b a B.R. Doshi School of Biosciences,

More information

Evaluation of Vibrio control

Evaluation of Vibrio control Evaluation of Vibrio control with a multi-species probiotic in shrimp aquaculture Competence Center Microbials Competence Center Microbials Evaluation of Vibrio control with a multi-species probiotic in

More information

Spawning advanced and delayed control photoperiod control temperature control

Spawning advanced and delayed control photoperiod control temperature control Spawning advanced and delayed control photoperiod control temperature control Photoperiod control Day Length and Temperature 30 25 Water Temperature (C) 20 15 10 Day Length (h) 5 0 Advancing or delaying

More information

Electrophoretic (SDS-PAGE) studies on muscle albumin proteins of the male and female deep water mud shrimp Solenocera melantho (De Man, 1907)

Electrophoretic (SDS-PAGE) studies on muscle albumin proteins of the male and female deep water mud shrimp Solenocera melantho (De Man, 1907) EUROPEAN ACADEMIC RESEARCH Vol. II, Issue 10/ January 2015 ISSN 2286-4822 www.euacademic.org Impact Factor: 3.1 (UIF) DRJI Value: 5.9 (B+) Electrophoretic (SDS-PAGE) studies on muscle albumin proteins

More information

Apparent digestibility of selected feedstuffs by mud crab, Scylla serrata

Apparent digestibility of selected feedstuffs by mud crab, Scylla serrata Aquaculture 216 (2003) 253 261 www.elsevier.com/locate/aqua-online Apparent digestibility of selected feedstuffs by mud crab, Scylla serrata Mae R. Catacutan a, *, Perla S. Eusebio a, Shin-ichi Teshima

More information

*[ Received 25 June 2015 ; revised 21 December 2015

*[  Received 25 June 2015 ; revised 21 December 2015 Indian Journal of Geo Marine Sciences Vol. 46 (07), July 2017, pp. 1440-1446 Haematological parameters as predictive indicators of stress induced mortality in Pacific White Shrimp Penaeus vannamei (Boone,

More information