The rabbit femoral artery was prepared and each arterial ring was permeabilized
|
|
- Morgan Patrick
- 6 years ago
- Views:
Transcription
1 Online Supplement Nakmura et al. cgmp-dependent relaxation of smooth muscle Materials and Methods Measurement of tension The rabbit femoral artery was prepared and each arterial ring was permeabilized with α-toxin as described. 1 The levels of tension obtained with Ca 2+ -free and 10 µmol/l Ca 2+ ( mn) were assigned to be 0% and 100%, respectively. Antibodies Mouse anti-mlc antibody was purchased from Sigma and mouse anti-phospho-ser19 of MLC antibody was prepared as described. 2 Rabbit anti-phospho-ser695 MBS antibody [ps695ab] raised against ARQSRRpSTQG and anti-diphospho-ser695/thr696 MBS antibody [ps695/pt696ab] raised against RQSRRpSpTQG were prepared by Genemed Synthesis. All antibodies were affinity purified and other antibodies were prepared as described. 1 Western blotting The phosphorylation of MLC, MBS or CPI17 in arterial strips was determined as described. 1 Purification of proteins The cdna clone of human Rho-kinase, rat MBS, and bovine cgmp-dependent protein kinase (PKG) were kindly supplied by Dr T. Leung (University of Singapore), Dr. P. Cohen (University of Dundee, U.K.), and Dr. F. Hofmann (Technische Universitat, Germany), respectively. The mutagenesis was performed according to the manufacturer's protocol (Stratagene). The cdnas were subcloned into pfastbacht baculovirus transfer vector, and the recombinant proteins were expressed in Sf9 cells and purified according to the
2 manufacturer s protocol (QIAGEN). Smooth muscle myosin and MLCK were prepared as described. 3, 4 MLCPassay The MLCP assay was carried out at 25 C using 32 P-labeled smooth muscle myosin as a substrate. 5 It should be noted that no detectable phosphatase activity was present in the 32 P-labeled myosin. The arterial rings were immersed in liquid nitrogen at indicated times and homogenized in 10 mmol/l Tris-HCl (ph 7.5), 100 mmol/l KCl, 40 mmol/l MgCl 2, 1 mmol/l EGTA, 1 mmol/l DTT, 10 µg/ml leupeptin and 1 mmol/l PMSF. Then, the homogenates (4 mg/ml) were incubated with 32 P-labeled 3 µmol/l myosin in the presence of 100 mmol/l NaCl, 30 mmol/l Tris-HCl (ph 7.5), 0.1 mmol/l EGTA, 0.2 mg/ml bovine serum albumin. The reactions were terminated by the addition of 10% trichloroacetic acid. The liberated 32 P was determined by Cerenkov counting. MBS kinase assay The MBS kinase assay was performed at 25 C using full length Ser695Ala MBS as a substrate. The frozen rings described above were homogenized in 50 mmol/l HEPES (ph 7.5), 100 mmol/l NaCl, 1% Triton X-100, 10 µg/ml leupeptin (buffer A), 1 mmol/l PMSF, 1 mmol/l DTT and 3 µmol/l calyculin A. Then, the homogenates (2 mg/ml) were incubated with 20 µg/ml Ser695Ala MBS in the presence of 5 mmol/l MgCl 2, 1 mmol/l CaCl 2 and 0.1 mmol/l ATP at 25 C. The MBS phosphorylation was monitored by Western blotting using pthr696ab. MBS phosphatase assay The MBS phosphatase assay was performed at 25 C using full length wild type(wt) MBS 2
3 phosphorylated by Rho-kinase and/or PKG as a substrate. MBS (30 µg/ml) was phosphorylated by Rho-kinase (5 µg/ml) or PKG (5 µg/ml) in the buffer containing 20 mmol/l Tris-Cl, ph 7.5, 4 mmol/l MgCl2, 25 mmol/l NaCl, 1 mmol/l PMSF, 30 µg/ml Leupeptine, 2 mm DTT, 0.1 mmol/l ATP with or without 3 µmol/l cgmp (for activating PKG). Phosphorylated MBS by Rho-kinase was sequentially phosphorylated by adding 3 µmol/l cgmp and PKG (5 µg/ml). The frozen rings were homogenized in buffer A with 1 µmol/l staurosporine, 30 µmol/l Y and 30 µmol/l DT-3. Then, the homogenates (2 mg/ml) were incubated with WT MBS phosphorylated by Rho-kinase at 25 C. The MBS phosphorylation was monitored by using pthr696ab. It should be noted that similar results were obtained when the frozen rings were homogenized with hexokinase and glucose in the above buffer to deplete endogenous ATP in the homogenates, thus quenching the kinase activity. Computer simulation Fraction population of [S 695 T 696 ], [S 695 pt 696 ], [ps 695 T 696 ] and [ps 695 pt 696 ] in the presence and the absence of cgmp at steady state were estimated by computer simulation using STELLA v8.1.1 software (iseesystems, Lebanon, NH). The rate constants (arbitrary) shown in the Fig. 8a in the absence of cgmp were as follow. k +1 = 1, k +1 = 0.6, k -1 = k -1 = 0.7, k +2 = k +2 = 1, k -2 = k -2 = 1.5. The rate constants in the presence of cgmp were as follow. k +1 = 1, k +1 = 0.6, k -1 = k -1 = 1.4 (2-fold increase), k +2 = k +2 = 3 (3-fold increase), k -2 = k -2 = 1.5. The rate of [S 695 T 696 ] formation was described as k -1 [S 695 pt 696 ] + k -2 [ps 695 T 696 ] (k +1 + k +2 ) [S 695 T 696 ]. The rate of [S 695 pt 696 ] formation was described as k +1 [S 695 T 696 ] + k -2 [ps 695 pt 696 ] (k -1 + k +2 ) [S 695 pt 696 ]. The rate of [ps 695 T 696 ] formation was described as k +2 [S 695 T 696 ] + k -1 [ps 695 pt 696 ] (k -2 + k +1 ) [ps 695 T 696 ]. The rate of [ps 695 pt 696 ] formation was described as k +2 [S 695 pt 696 ] + k +1 [ps 695 T 696 ] (k -2 + k -1 ) 3
4 [ps 695 pt 696 ]. The initial values of [S 695 T 696 ], [S 695 pt 696 ], [ps 695 T 696 ] and [ps 695 pt 696 ] at time zero were 100, 0, 0 and 0, respectively. The simultaneous differential equation was solved by Runge-Kutta 4 th approximation with calculation time interval of Halving and doubling the calculation time interval did not affect the result. Statistical analysis The results are expressed as mean ± s.e.mean. Data were compared by Student s t -test. Values were considered significantly different at P < Supplementary Figure Legends Fig. 1S. The phosphorylation of un-phosphorylated and Rho-kinase-prephosphorylated MBS by PKG. The pre-phosphorylation of MBS (180 µg/ml) by Rho-kinase (12 µg/ml) to the maximum level was performed in the presence of 0.1 mmol/l cold ATP at 25 o C for 60min as described previously. 1 Unphosphorylated MBS or pre-phosphorylated MBS was incubated with 5 µmol/l cgmp and PKG (12 µg/ml) in the presence of 0.1 mmol/l γ- 32 P-ATP and 0.2 µmol/l microcyctin LR, and the increase in [ 32 P] incorporation to MBS was monitored by autoradiography. The [ 32 P] incorporation of the unphosphorylated MBS obrained at 30 min by PKG was taken as 100%. Data represent mean±s.e.m. (n=4). Fig. 2S. The linear relationship between the amount of MBS and the western blot signal intensities for phosphorylated MBS. Various amounts of mono-phosphorylated MBS at Ser695 by PKG and di-phosphorylated MBS at Ser695/Thr696 by Rho-kinase/PKG were subjected to SDS-PAGE, followed by western blot using anti-phosphoser695 antibody and anti-di-phosphoser695/thr696 antibody as probes, 4
5 respectively. The signal intensities were quantified by densitometry. All values were expressed as means+s.e.m. (n = 3) Fig. 3S. The effect of the protein kinase inhibitors on the MBS phosphorylation by the arterial homogenates. Arterial rings were homogenized in the presence or absence of PKG inhibitor (DT-3), Rho-kinase inhibitor (Y-27632) and a non-specific kinase inhibitor (staurosporine) as described in Material and Methods. Di-phosphorylated MBS by Rho-kinase/PKG with cold ATP (see Materials and Methods) was further phosphorylated by arterial homogenates using γ- 32 P-ATP and the [ 32 P] incorporation into MBS was monitored by autoradiography. It should be noted that MBS can be phosphorylated at various sites in addition to Ser695 and Thr696 in vitro. 5
6 References 1. Niiro N, Koga Y, Ikebe M. Agonist-induced changes in the phosphorylation of the myosin- binding subunit of myosin light chain phosphatase and CPI17, two regulatory factors of myosin light chain phosphatase, in smooth muscle. Biochem J. 2003;369: Komatsu S, Yano T, Shibata M, Tuft RA, Ikebe M. Effects of the regulatory light chain phosphorylation of myosin II on mitosis and cytokinesis of mammalian cells. The Journal of biological chemistry. 2000;275: Ikebe M, Hartshorne DJ. Effects of Ca2+ on the conformation and enzymatic activity of smooth muscle myosin. Journal of Biological Chemistry. 1985;260: Ikebe M, Hartshorne DJ, Elzinga M. Phosphorylation of the 20,000-dalton light chain of smooth muscle myosin by the calcium-activated, phospholipid-dependent protein kinase. Phosphorylation sites and effects of phosphorylation. The Journal of biological chemistry. 1987;262: Koga Y, Ikebe M. p116rip decreases myosin II phosphorylation by activating myosin light chain phosphatase and by inactivating RhoA. The Journal of biological chemistry. 2005;280:
7
8
9
Follow this and additional works at: Part of the Physiology Commons
University of Massachusetts Medical School escholarship@umms Open Access Articles Open Access Publications by UMMS Authors 9-26-2002 Agonist-induced changes in the phosphorylation of the myosin- binding
More informationIt has been known that endothelial-derived nitric oxide
cgmp-dependent Relaxation of Smooth Muscle Is Coupled With the Change in the Phosphorylation of Myosin Phosphatase Kensei Nakamura,* Yasuhiko Koga,* Hiroyasu Sakai, Kazuaki Homma, Mitsuo Ikebe Abstract
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationA Novel Regulatory Mechanism of Myosin Light Chain Phosphorylation via Binding of to Myosin Phosphatase
University of Massachusetts Medical School escholarship@umms Open Access Articles Open Access Publications by UMMS Authors 12-21-2007 A Novel Regulatory Mechanism of Myosin Light Chain Phosphorylation
More informationReceived 17 July 2006; revised 28 August 2006; accepted 15 September Available online 27 September Edited by Lukas Huber
PHI-1 interacts with the catalytic subunit of myosin light chain phosphatase to produce a Ca 2+ independent increase in MLC 20 phosphorylation and force in avian smooth muscle Amr El-Toukhy a,b, Allison
More informationWestern Immunoblotting Preparation of Samples:
Western Immunoblotting Preparation of Samples: Total Protein Extraction from Culture Cells: Take off the medium Wash culture with 1 x PBS 1 ml hot Cell-lysis Solution into T75 flask Scrap out the cells
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationMeasurement of PDH Endogenous Activity Relative to the Fully- States
Measurement of PDH Endogenous Activity Relative to the Fully- and Dephosphorylated Phosphorylated States Table of contents PDH Protocol #1 Measurement of PDH Endogenous Activity 1. Introduction 3 2. Regulation
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationThe dynamic regulation of blood vessel caliber
INVITED BASIC SCIENCE REVIEW The dynamic regulation of blood vessel caliber Colleen M. Brophy, MD, Augusta, Ga BACKGROUND The flow of blood to organs is regulated by changes in the diameter of the blood
More informationMEK1 Assay Kit 1 Catalog # Lot # 16875
MEK1 Assay Kit 1 Kit Components Assay Dilution Buffer (ADB), Catalog # 20-108. Three vials, each containing 1.0ml of assay dilution buffer (20mM MOPS, ph 7.2, 25mM ß-glycerol phosphate, 5mM EGTA, 1mM sodium
More informationVascular reactivity in sepsis and platelet dysfunction in septic shock
Vascular reactivity in sepsis and platelet dysfunction in septic shock Benjamin Reddi Discipline of Physiology School of Medical Science University of Adelaide Thesis submitted for the degree of Doctor
More informationA Subset of Protein Kinase C Phosphorylation Sites on the Myosin II Regulatory Light Chain Inhibits Phosphorylation by Myosin Light Chain Kinase
Article A Subset of Protein Kinase C Phosphorylation Sites on the Myosin II Regulatory Light Chain Inhibits Phosphorylation by Myosin Light Chain Kinase Kirsi Turbedsky, Thomas D. Pollard, and Anne R.
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/398/rs12/dc1 Supplementary Materials for Quantitative phosphoproteomics reveals new roles for the protein phosphatase PP6 in mitotic cells Scott F. Rusin, Kate
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationEffec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers
Effec
More informationPhosFree TM Phosphate Assay Biochem Kit
PhosFree TM Phosphate Assay Biochem Kit (Cat. # BK050) ORDERING INFORMATION To order by phone: (303) - 322-2254 To order by Fax: (303) - 322-2257 To order by e-mail: cservice@cytoskeleton.com Technical
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationBILAYER CHANNEL RECONSTITUTION
(1) 1% Agar Salt Bridge 1.0 g Agar 3.75g KCl in 100ml distilled water, store at 4 o C. BILAYER CHANNEL RECONSTITUTION (2) Cs solution: (Cesium Methanesulfonate) 1) 50 mm Cs + solution 0.209 MOPS, 10mM
More informationPHI-1 induced enhancement of myosin phosphorylation in chicken smooth muscle
FEBS 29767 FEBS Letters 579 (2005) 4271 4277 PHI-1 induced enhancement of myosin phosphorylation in chicken smooth muscle Amr El-Touhky a, Allison M. Given a, Audrey Cochard a, Frank V. Brozovich a,b,
More informationSelectScreen Biochemical Kinase Profiling Service
Page 1 of 11 ASSAY THEORY 2 ADAPTA ASSAY CONDITIONS 3 ADAPTA ASSAY CONTROLS 4 ADAPTA DATA ANALYSIS 5 KINASE-SPECIFIC ASSAY CONDITIONS 6 CAMK1 (CaMK1) 6 CDK7/cyclin H/MNAT1 6 CDK9/cyclin T1 6 CHUK (IKK
More informationAmajor metabolic consequence of insulin action is
Glycogen Synthase Sensitivity to Insulin and Glucose-6-Phosphate Is Mediated by Both NH 2 - and COOH-Terminal Phosphorylation Sites Alexander V. Skurat, Amy D. Dietrich, and Peter J. Roach In skeletal
More informationUse of a camp BRET Sensor to Characterize a Novel Regulation of camp by the Sphingosine-1-phosphate/G 13 Pathway
Use of a camp BRET Sensor to Characterize a Novel Regulation of camp by the Sphingosine-1-phosphate/G 13 Pathway SUPPLEMENTAL DATA Characterization of the CAMYEL sensor and calculation of intracellular
More informationOn Line Data Supplement
On Line Data Supplement Chemicals and Other Materials [γ- 32 P]ATP, L-[ 35 S]methionine, L-[ 3 H]leucine, m 7 GTP-Sepharose, glutathione- Sepharose 4B and ECL reagents were purchased from Amersham Pharmacia
More informationProtein Dephosphorylation Methods
Protein Dephosphorylation Methods Phosphospecific antibodies are designed to differentiate between the phosphorylated and the non-phosphorylated states of a protein. The method to determine if or how well
More informationB. 50 mm Calcium Chloride Solution (CaCl 2 ) (Prepare 25 ml in Reagent A using Calcium Chloride, Dihydrate, Sigma Prod. No. C-3881.
SIGMA QUALITY CONTROL TEST PROCEDURE ProductInformation Enzymatic Assay of PHOSPHOLIPASE C PRINCIPLE: L-α-Lecithin + H 2 O Phospholipase C > 1,2-Diglyceride + Choline Phosphate Choline phosphate + H 2
More informationSupporting information (protein purification, kinetic characterization, product isolation, and characterization by NMR and mass spectrometry):
Supporting Information Mechanistic studies of a novel C-S lyase in ergothioneine biosynthesis: the involvement of a sulfenic acid intermediate Heng Song, 1 Wen Hu, 1,2 Nathchar Naowarojna, 1 Ampon Sae
More informationLength-dependent activation is modulated by cardiac troponin I bisphosphorylation at Ser23 and Ser24 but not by Thr143 phosphorylation
Am J Physiol Heart Circ Physiol 306: H1171 H1181, 2014. First published February 28, 2014; doi:10.1152/ajpheart.00580.2013. Length-dependent activation is modulated by cardiac troponin I bisphosphorylation
More informationnachr α 4 β 2 CHO Cell Line
B SYS GmbH nachr α 4 β 2 CHO Cell Line Cell Culture Conditions B SYS GmbH B SYS GmbH nachr α 4 β 2 CHO Page 2 TABLE OF CONTENTS 1 BACKGROUND...3 1.1 Human Nicotinic Acetylcholine Receptors...3 1.2 B SYS
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationTECHNICAL BULLETIN. MDR1, human recombinant, expressed in Sf9 cells, membrane preparation, for ATPase. Product Number M9194 Storage Temperature 70 C
MDR1, human recombinant, expressed in Sf9 cells, membrane preparation, for ATPase Product Number M9194 Storage Temperature 70 C TECHNICAL BULLETIN Product Description Multi-drug resistance (MDR) is a major
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
More informationCHO α 1 β 2 γ 2 GABAA Cell Line
B SYS GmbH CHO α 1 β 2 γ 2 GABAA Cell Line Specification Sheet B SYS GmbH B SYS GmbH CHO α 1 β 2 γ 2 Cells Page 2 TABLE OF CONTENTS 1 BACKGROUND...3 1.1 THE PHARMACOLOGICAL DISTINCTION OF GABA A RECEPTOR
More informationPREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS
TMM,5-2011 PREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS Ice-cold means cooled in ice water. In order to prevent proteolysis, make sure to perform all steps on ice. Pre-cool glass homogenizers, buffers
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Table S1. Primers and fluorescent probes used for qrt-pcr analysis of relative expression levels of PPP family phosphatases. gene name forward primer, 5-3 probe, 5-3 reverse primer,
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Purification and biochemical properties of SDS-stable low molecular weight alkaline serine protease from Citrullus Colocynthis Muhammad Bashir Khan, 1,3 Hidayatullah khan, 2 Muhammad
More informationCa 2 -Dependent Rapid Ca 2 Sensitization of Contraction in Arterial Smooth Muscle
Ca 2 -Dependent Rapid Ca 2 Sensitization of Contraction in Arterial Smooth Muscle George J. Dimopoulos,* Shingo Semba,* Kazuyo Kitazawa, Masumi Eto, Toshio Kitazawa Abstract Ca 2 ion is a universal intracellular
More informationASSAY THEORY 2 ADAPTA ASSAY CONDITIONS 3 ADAPTA ASSAY CONTROLS 4 ADAPTA DATA ANALYSIS 5
Page 1 of 11 ASSAY THEORY 2 ADAPTA ASSAY CONDITIONS 3 ADAPTA ASSAY CONTROLS 4 ADAPTA DATA ANALYSIS 5 KINASE-SPECIFIC ASSAY CONDITIONS 6 CAMK1 (CaMK1) 6 CDK4/cyclin D1 6 CDK4/cyclin D3 6 CDK6/cyclin D1
More informationLoss of protein association causes cardiolipin degradation in Barth syndrome
SUPPLEMENTARY INFORMATION Loss of protein association causes cardiolipin degradation in Barth syndrome Yang Xu 1, Colin K.L. Phoon 2, Bob Berno 5, Kenneth D Souza 6, Esthelle Hoedt 4, Guoan Zhang 4, Thomas
More informationPart I. Boolean modelling exercises
Part I. Boolean modelling exercises. Glucose repression of Icl in yeast In yeast Saccharomyces cerevisiae, expression of enzyme Icl (isocitrate lyase-, involved in the gluconeogenesis pathway) is important
More informationManual. Precision Red Advanced Protein Assay Reagent. Cat. # ADV02. cytoskeleton.com. Cytoskeleton, Inc.
The Protein Experts Manual Cytoskeleton, Inc. V. 6.0 Precision Red Advanced Protein Assay Reagent Cat. # ADV02 cytoskeleton.com Phone: (303) 322.2254 Fax: (303) 322.2257 Customer Service: cserve@cytoskeleton.com
More informationSUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION EXPERIMENTAL PROCEDURES Tryptic digestion protection experiments - PCSK9 with Ab-3D5 (1:1 molar ratio) in 50 mm Tris, ph 8.0, 150 mm NaCl was incubated overnight at 4 o C. The
More informationIt is all in the enzymes
Enzyme regulation 1 It is all in the enzymes Enzymes can enhance the rates of metabolic (or other) reactions by many orders of magnitude. A rate enhancement of 10 17 means that what would occur in 1 second
More informationImproved Stability of the LANCE Ultra Signal in Kinase Assays
Improved Stability of the LANCE Ultra Signal in Kinase Assays LANCE Ultra is a high throughput screening (HTS) technology platform optimized for homogeneous time-resolved fluorescence resonance energy
More informationTable S1. Sequence of human and mouse primers used for RT-qPCR measurements.
Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationQIAGEN Technologies for Proteomic studies
Welcome QIAGEN Technologies for Proteomic studies QIAGEN Protein Seminar Dr Philippe JOANIN W W W. Q I A G E N. C O M Why fractionate? Human proteome 100,000 different proteins No specific AntiBodies for
More informationIntroduction. Figure 1 Experimental Strategy
Beyond s: Interrogating the Purinome Tony A. Klink, Karen Kleman-Leyer, Matt Staeben, Robert G. Lowery BellBrook Labs, Madison, Wisconsin, USA 53711 Introduction The development of ATP-site ligands as
More informationAMPK Assay. Require: Sigma (1L, $18.30) A4206 Aluminum foil
AMPK Assay Require: Acetone Sigma (1L, $18.30) A4206 Aluminum foil Ammonium sulfate Fisher BP212R-1 AMP Sigma A1752 ATP Sigma A6144 (alt. use A7699) Beta-mercaptoethanol Sigma M6250 (alt. use M7154) Bio-Rad
More informationFIRST BIOCHEMISTRY EXAM Tuesday 25/10/ MCQs. Location : 102, 105, 106, 301, 302
FIRST BIOCHEMISTRY EXAM Tuesday 25/10/2016 10-11 40 MCQs. Location : 102, 105, 106, 301, 302 The Behavior of Proteins: Enzymes, Mechanisms, and Control General theory of enzyme action, by Leonor Michaelis
More informationPhospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
More informationSupplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants
Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants Species UDP-2,3- diacylglucosamine hydrolase specific activity (nmol min -1 mg -1 ) Fold vectorcontrol specific
More informationNature Medicine: doi: /nm.3891
Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,
More informationSupplementary Material. Contents include:
Supplementary Material Contents include: 1. Supplementary Figures (p. 2-7) 2. Supplementary Figure Legends (p. 8-9) 3. Supplementary Tables (p. 10-12) 4. Supplementary Table Legends (p. 13) 1 Wellen_FigS1
More informationSeparation of a phosphorylated-his protein using phosphate-affinity polyacrylamide gel electrophoresis
Notes & Tips Separation of a phosphorylated-his protein using phosphate-affinity polyacrylamide gel electrophoresis Categories: Electrophoretic Techniques Seiji Yamada a,*, Hiro Nakamura a,b, Eiji Kinoshita
More informationA Homogeneous Phosphoinositide 3-Kinase Assay on Phospholipid FlashPlate Platforms. Busi Maswoswe, Hao Xie, Pat Kasila and Li-an Yeh
A Homogeneous Phosphoinositide 3-Kinase Assay on Phospholipid FlashPlate Platforms Busi Maswoswe, Hao Xie, Pat Kasila and Li-an Yeh Abstract Phosphoinositide 3-kinases (PI 3-kinase) consist of a family
More informationSupplementary Material and Methods
Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided
More informationab AMPK alpha pthr172 ELISA Kit
ab154468 AMPK alpha pthr172 ELISA Kit Instructions for Use For the measurement levels of AMPK alpha phosphorylated at threonine 172 in human, mouse and rat cell and tissue lysates. This product is for
More informationHuman TRPC6 Ion Channel Cell Line
TECHNICAL DATA SHEET ValiScreen Ion Channel Cell Line Caution: For Laboratory Use. A research product for research purposes only Human TRPC6 Ion Channel Cell Line Product No.: AX-012-C Lot No.: 512-548-A
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationGrowth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
More informationCholesterol determination using protein-templated fluorescent gold nanocluster probes
Electronic Supplementary Information for Cholesterol determination using protein-templated fluorescent gold nanocluster probes Xi Chen and Gary A. Baker* Department of Chemistry, University of Missouri-Columbia,
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationThe Annexin V Apoptosis Assay
The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.
More informationContraction is a primary function of vascular smooth
Contractile Properties of the Cultured Vascular Smooth Muscle Cells The Crucial Role Played by RhoA in the Regulation of Contractility Dan Bi, Junji Nishimura, Naohisa Niiro, Katsuya Hirano, Hideo Kanaide
More informationMammalian Tissue Protein Extraction Reagent
Mammalian Tissue Protein Extraction Reagent Catalog number: AR0101 Boster s Mammalian Tissue Protein Extraction Reagent is a ready-to-use Western blot related reagent solution used for efficient extraction
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationSignal Transduction and Protein Phosphorylation in Smooth Muscle Contraction
Biochemistry (Moscow), Vol. 67, No. 12, 2002, pp. 1309-1328. Translated from Biokhimiya, Vol. 67, No. 12, 2002, pp. 1587-1610. Original Russian Text Copyright 2002 by Vorotnikov, Krymsky, Shirinsky. REVIEW
More informationAntibodies: LB1 buffer For 50 ml For 10ml For 30 ml Final 1 M HEPES, ph 2.5 ml 0.5 ml 1.5 ml 50mM. 5 M NaCl 1.4 ml 280 µl 0.
Experiment: Date: Tissue: Purpose: ChIP-Seq Antibodies: 11x cross-link buffer: Regent Stock Solution Final Vol for 10 ml of 11xstock concentration 5 M NaCl 0.1M 0.2 ml 0.5 M EDTA 1 mm 20 ul 0.5 M EGTA,
More informationBrush border myosin heavy chain phosphorylation regulated by calcium and calmodulin
Volume 212, number 1, 154-158 FEB 04421 February 1987 Brush border myosin heavy chain phosphorylation regulated by calcium and calmodulin is James P. Rieker, Helena Swanljung-Collins, Judith Montibeller
More informationCell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
More informationSupplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular
Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular weight markers (M). Supplementary Figure-2. Overlay of
More informationChromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.
Chromatin IP (Isw2) 7/01 Toshi last update: 06/15 Reagents Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. 2.5 M glycine. TBS:
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationOptimization of a LanthaScreen Kinase assay for NTRK1 (TRKA)
Optimization of a LanthaScreen Kinase assay for NTRK1 (TRKA) Overview This protocol describes how to develop a LanthaScreen kinase assay designed to detect and characterize kinase inhibitors. The development
More informationTivadar Orban, Beata Jastrzebska, Sayan Gupta, Benlian Wang, Masaru Miyagi, Mark R. Chance, and Krzysztof Palczewski
Structure, Volume Supplemental Information Conformational Dynamics of Activation for the Pentameric Complex of Dimeric G Protein-Coupled Receptor and Heterotrimeric G Protein Tivadar Orban, Beata Jastrzebska,
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSupplemental Information
Supplemental Information Role of phosphorylation and basic residues in the catalytic domain of cytosolic phospholipase A 2! in regulating interfacial kinetics and binding and cellular function Purification
More informationSupplementary Material for
Supplementary Material for Parathyroid Hormone Signaling through Low-density-lipoprotein-related Protein 6 Mei Wan, Chaozhe Yang, Jun Li, Xiangwei Wu, Hongling Yuan, Hairong Ma, Xi He, Shuyi Nie, Chenbei
More informationSupplementary material: Materials and suppliers
Supplementary material: Materials and suppliers Electrophoresis consumables including tris-glycine, acrylamide, SDS buffer and Coomassie Brilliant Blue G-2 dye (CBB) were purchased from Ameresco (Solon,
More informationRequires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More informationSUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
More informationHuman PKA (Protein Kinase A) Activity Assay Kit
Human PKA (Protein Kinase A) Activity Assay Kit CATALOG NO: IRAAKT2532 LOT NO: SAMPLE INTENDED USE The PKA (Protein Kinase A) Activity kit is designed to quantitatively measure PKA activity in a variety
More informationSupporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3
Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein
More informationProperties of Allosteric Enzymes
Properties of Allosteric Enzymes (1) An allosteric enzyme possesses at least spatially distinct binding sites on the protein molecules the active or the catalytic site and the regulator or the allosteric
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationRole of thin-filament regulatory proteins in relaxation of colonic smooth muscle contraction
Am J Physiol Gastrointest Liver Physiol 297: G958 G966, 2009. First published September 3, 2009; doi:10.1152/ajpgi.00201.2009. Role of thin-filament regulatory proteins in relaxation of colonic smooth
More informationPDF hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/142604
More informationPPP_glycogen_metabolism Part 2 الفريق الطبي األكاديمي. Done By: - Shady Soghayr
PPP_glycogen_metabolism Part 2 الفريق الطبي األكاديمي Done By: - Shady Soghayr لكية الطب البرشي البلقاء التطبيقية / املركز 6166 6102/ **How we get glucose-1-phosphate from glucose (source of glucose-1-
More informationNature Immunology: doi: /ni.3631
Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above
More informationCA Tel.: ; Fax: ; ucsd.edu.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 283, NO. 10, pp. 6300 6311, March 7, 2008 2008 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. The Phosphatase PHLPP
More informationFunctional coexpression of serine protein kinase SRPK1 and its substrate ASF/SF2 in Escherichia coli
2000 Oxford University Press Nucleic Acids Research, 2000, Vol. 28, No. 5 e14 Functional coexpression of serine protein kinase SRPK1 and its substrate ASF/SF2 in Escherichia coli Bai-Gong Yue, Paul Ajuh
More informationOptimization of a LanthaScreen Kinase assay for ZAP70
Optimization of a LanthaScreen Kinase assay for ZAP70 Overview This protocol describes how to develop a LanthaScreen kinase assay designed to detect and characterize kinase inhibitors. The development
More informationNF-κB p65 (Phospho-Thr254)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual
More information