The effect of hormonal estrus induction on maternal effect and apoptosis-related genes expression in porcine cumulus-oocyte complexes
|
|
- Mark Jennings
- 5 years ago
- Views:
Transcription
1 Bogcki et l. Reproductive Biology nd Endocrinology 2014, 12:32 RESEARCH Open Access The effect of hormonl estrus induction on mternl effect nd poptosis-relted genes expression in porcine cumulus-oocyte complexes Mrek Bogcki 1*, Mrt Wsielk 1, Ann Kitewsk 1, Iwon Bogck 2 nd Beenu Moz Jlli 1 Astrct Bckground: The effect of hormonl estrus induction on mternl effect (MATER - mternl ntigen tht emryo requires, ZAR-1 - zygote rrest 1, nd BMP15 - one morphogenetic protein 15) nd poptosis-relted genes expression (BCL-2 nd BAX) in porcine cumulus-oocyte complexes (COCs) nd selected folliculr prmeters ws investigted in this study. Methods: Gilts were divided into three groups: (I) with nturl estrus; (II) stimulted with ; nd (III) with + PGF2lph. Anlysis of mternl effect nd poptosis-relted trnscripts expression in COCs, nd progesterone synthesis pthwy genes expression (P450scc nd 3etHSD) in grnulos cells ws performed y qpcr. BMP15 protein expression in folliculr fluid (FF) ws nlyzed y western lot. Oocyte nucler mturtion ws ssessed y ceto-orcein stining. Progesterone (P4) nd estrdiol (E2) concentrtions in FF nd serum were mesured y ELISA. Dt were nlyzed with the one-wy ANOVA nd Bonferroni post-test or Kruskl-Wllis test nd Dunns post-test. Results: The highest expression of MATER, ZAR-1, ndbmp15 genes ws found in COCs recovered from gilts treted with when compred to + PGF2lph-stimulted or non-stimulted gilts. Hormonl tretment did not ffect the BMP15 protein expression in FF, ut incresed the expression of genes prticipting in P4 synthesis in grnulos cells. The higher percentge of immture oocytes ws found in -treted when compred to the non-stimulted gilts. The expression of BCL-2 nd BAX mrna, nd BCL-2/BAX mrna rtio ws significntly higher in COCs derived from -treted when compred to + PGF2lph-treted or non-stimulted sujects. The level of P4 in serum ws similr in nimls from ll experimentl groups, while its concentrtion in FF ws greter in gilts sujected to tretment thn in + PGF2lph-stimulted nd non-stimulted gilts. The concentrtion of E2 did not differ in the serum or FF etween the control group nd the hormonlly stimulted groups. Conclusions: Hormonl induction of estrus ffected mternl effect gene trnscripts levels in COCs nd nd oocyte nucler mturtion. The inclusion of PGF2lph into the stimultion protocol enled mintining of physiologicl concentrtion of P4 in FF. Additionlly, oth hormonl tretments seem to e eneficil for poptosis prevention through incresing BCL-2/BAX trnscript rtio. Keywords: Mternl effect genes, Pig, Estrus induction, Gondotropins * Correspondence: m.ogcki@pn.olsztyn.pl 1 Institute of Animl Reproduction nd Food Reserch of Polish Acdemy of Sciences, Tuwim 10, Olsztyn , Polnd Full list of uthor informtion is ville t the end of the rticle 2014 Bogcki et l.; licensee BioMed Centrl Ltd. This is n Open Access rticle distriuted under the terms of the Cretive Commons Attriution License ( which permits unrestricted use, distriution, nd reproduction in ny medium, provided the originl work is properly credited. The Cretive Commons Pulic Domin Dediction wiver ( pplies to the dt mde ville in this rticle, unless otherwise stted.
2 Bogcki et l. Reproductive Biology nd Endocrinology 2014, 12:32 Pge 2 of 11 Bckground Hormonl induction of the estrus is commonly used in commercil swine reeding to improve production efficiency nd fcilitte niml mngement. It lso serves s fundmentl technique in the preprtion of recipients nd donors for emryo trnsfer procedures, s well s in the recovery of lrge numer of emryos used lter for oth iotechnologicl purposes nd in sic studies. However, the dministrtion of gondotropins my e to some extent detrimentl to the reproductive performnce of the treted nimls. Estrus induction in gilts hs n impct on folliculr development, s reflected y the chnges in follicle dimeter nd folliculr fluid volume compred to nturlly cyclic pigs [1]. In our erlier studies, higher numer of degenerted porcine emryos nd lower numer of lstocysts htched in vitro were found fter hormonl induction of the estrus [2]. Moreover, studies hve shown tht hormonl tretment ffects the expression of genes crucil for pre-implnttion events in the uterus nd conceptus during erly pregnncy [3] nd increses emryonic losses in pigs [4]. One of the predominnt fctors ffecting proper emryo development nd successful pregnncy is oocyte qulity. During cytoplsmic mturtion, the oocyte increses its size nd volume, nd lrge numer of mrnas nd proteins re ccumulted t tht time. These molecules, identified s mternl effect genes products, regulte events crucil for oocyte meiosis completion (nucler mturtion), orgniztion of two pronuclei, nd first emryo clevges [5,6]. An expression of ZAR-1 (zygote rrest 1), one of the mternl effect genes, ws found in porcine oocytes nd erly emryos recovered in vivo; ut it decresed significntly t the morul nd lstocyst stges [7]. These indicte tht ZAR-1 hs significnt function in oocyte development nd during the first emryonic clevges. MATER (mternl ntigen tht n emryo requires or NALP5), which lso elongs to the mternl effect genes, ws found to ply role in ctivting emryonic genome nd mintining chromosome stility nd euploidy in mice [8,9]. Interestingly, recent dt show tht, during folliculogenesis, MATER is expressed nd exerts its iologicl role lso in the surrounding cumulus cells [10], which confirms the importnce of the intimte reltionship etween oocyte nd cumulus cells for the production of fully competent gmete. An exmple of nother kind of mternl effect gene is one morphogenetic protein 15 (BMP15). BMP15 elongs to the TGF-β superfmily nd is known s grnulos cell mitosis nd prolifertion inducer [11,12]. The production of dequte mounts of BMP15 protein y the oocyte is necessry to promote cumulus cells expnsion [13]. The expression of BMP15 mrna ws lso found in cumulus cells nd it decresed long with the oocyte mturtion nd cumulus expnsion in vitro [14]. Knockout of BMP15 in femle mice decresed fertility nd diminished emryonic development [15]. There re studies demonstrting tht the BMP15 level in folliculr fluid (FF) ppers to e potentil mrker in predicting oocyte qulity nd susequent emryo development [15,16]. Although there re some reports on mternl effect genes expression nd their cellulr locliztion during porcine oocyte mturtion nd emryo development in vitro [5,7,17-19], there is no evidence showing the effect of hormonl tretment on their expression in this species. The most commonly pplied protocols of estrus induction include the use of comintion of PMSG to stimulte folliculr development nd hcg to induce ovultion. However, it ws suggested y Sommer et l. [20] tht including PGF2α into the protocol ws very effective for collecting pronucler stge emryos. Tking the following into considertion: (1) our previous results tht estrus induction decresed emryo qulity in pigs, (2) the informtion tht genetic mteril within the oocyte plys n importnt role in directing the numerous events required for successful folliculogenesis nd erly emryo development, nd (3) the fct tht n luteinizing hormone (LH) surge cuses the chnge from estrdiol (E 2 ) to domintion of progesterone (P 4 ), we investigted the effect of the two mentioned regimens of exogenous gondotropins tretment on selected mternl effect gene expression (MATER, ZAR-1 nd BMP15) in COCs, steroid hormones concentrtion in FF, nd P 4 synthesis pthwy gene expression (P450scc nd 3βHSD) in grnulos cells. Additionlly, we exmined poptosis-relted gene expression (ntipoptotic BCL-2 nd propoptotic BAX) nd BCL-2/BAX mrna rtios in COCs in response to hormonl induction of the estrus. Methods Animls The experiment ws performed on gilts from one commercil herd, ech 6.5 months old nd on verge weighing 115 kg. Gilts were divided into three groups (five to eight nimls per group). Briefly, from the group of nimls, the gilts entering into their nturl estrus cycle were ssigned to the nturl cyclic group (group I), nd the remining gilts were ssigned to groups II nd III nd treted hormonlly to induce first nd second estrus. Animls from group I (n = 8), exhiiting first nd second estrus nturlly, were not hormonlly stimulted. Gilts were considered to e in estrus when they responded to or exposure. The nimls ssigned to groups II nd III were treted with PMSG [Folligon ; Intervet, Netherlnds; 750 IU im], followed y hcg [Chorulon ; Intervet, Netherlnds; 500 IU im] 72 h lter. After seventeen dys, the second estrus in nimls from group II (n = 5) ws induced y n identicl tretment of PMSG nd hcg. Animls from group III (n = 7),
3 Bogcki et l. Reproductive Biology nd Endocrinology 2014, 12:32 Pge 3 of 11 etween dys twelve nd sixteen of the second estrus, were treted with PGF2α [Dinolitic ; Pfizer, Polnd; 10 mg im], followed 24 h lter with 10 mg of PGF2α simultneously with 750 IU of PMSG, then followed 72 h lter with 500 IU of hcg. This procedure ws modifiction of the method descried previously y Sommer et l. [20]. The gilts were slughtered out 36 h fter hcg dministrtion. Blood smples were collected, incuted overnight t 4 C nd then centrifuged 3000 X g for 20 min t 4 C. Serum ws hrvested nd frozen t -20 C for P 4 nd E 2 nlysis. All procedures were conducted in ccordnce with the ntionl guidelines for griculturl niml cre nd were pproved y the Locl Animl Ethics Committee, University of Wrmi nd Mzury in Olsztyn, Polnd. Recovery of COCs nd grnulos cells The numer of preovultory follicles on ech ovry ws counted. Cumulus oocyte complexes (COCs) were recovered y cutting the follicles with sclpel on Petri dish. They were wshed twice in Medium 199 (Sigm, St. Louis, MO, USA) supplemented with 0.68 mm L-glutmine (Sigm), 20 mm Hepes (Sigm), 100 U/ml penicillin (Sigm), 0.1 mg/ml streptomycin (Sigm) nd 10% fetl ovine serum (FBS; Invitrogen, Crlsd, CA, USA). After wshing twice in phosphte-uffered sline, the COCs from one niml were pooled in groups of ten to fifteen per tue, snp frozen in liquid nitrogen, nd kept t -80 C until further RNA isoltion. At the sme time, FF ws collected (per niml FF from ll preovultory follicles from oth ovries ws pooled), centrifuged to remove cell deris, nd frozen t -20 C for P 4 nd E 2 nlysis. The grnulos cells were gently scrped from the inner follicle wll nd trnsferred to 1.5ml microcentrifuge tue in phosphte-uffered sline nd centrifuged t 90 X g for 10 min t room temperture. After centrifugtion, the superntnt ws removed nd the cells were snp frozen in liquid nitrogen nd stored t -80 C for further RNA isoltion. Evlution of nucler mturtion For evlution of oocyte nucler mturtion, dditionl nimls prepred s descried previously were used [nturl estrus (group I) n = 4; (group II) n = 3; + PGF2α (group III) n = 3]. After the recovery of COCs, cumulus cells were removed completely y vortexing in 0.1% (w/v) hyluronidse (Sigm). Denuded oocytes were plced on glss slide under cover slip (supported with Vseline corners) nd fixed for up to 72 h in n cetic cid/ethnol fixtive (1:3, v:v). Nucler structures were then visulized y stining with cetoorcein (1% orcein in 45% cetic cid). Oocytes were evluted under phse-contrst microscope for the stge of nucler mturtion. Bsed on the stge of nucler mturtion, oocytes were divided into two groups: immture oocytes (GV) nd oocytes tht resumed meiosis (prometphse I metphse II). P 4 nd E 2 mesurement Concentrtions of P 4 nd E 2 in FF nd serum were determined using commercil ELISA kits (Enzo Life Sciences, New York, NY, USA) ccording to the supplier s instructions. The stndrd curves for P 4 nd E 2 rnged from 15.6 to 500 pg/ml nd from 15.6 to 1000 pg/ml, respectively. The concentrtions of P 4 nd E 2 in FF nd serum were mesured in duplictes for ech smple nd the finl concentrtion ws expressed s n verge. Assy sensitivity ws 8.57 pg/ml for P 4 nd pg/ml for E 2. The intr-ssy coefficients of vrition were 5.9% for P 4 nd 4.9% for E 2. RNA isoltion nd qpcr Totl RNA from COCs nd grnulos cells ws isolted using Qigen RNesy Plus Micro Kit (Qigen, Vlenci, CA, USA) nd checked for quntity nd qulity with NnoDrop (ND-1000; Thermo Scientific, Wlthm, MA, USA). DNse tretment with gdna elimintor columns (Qigen) ws included in the RNA isoltion protocol. The RNA otined ws reversely trnscried with the use of trnscriptor high fidelity cdna synthesis kit (Roche, Bsel, Switzerlnd). For reverse trnscription, 15 ng of totl RNA from COCs nd 1 μg of RNA from grnulos cells were used. The rection ws performed in totl volume of 20 μl, including RNA, wter, 60 μm ofrndom hexmer primers, rection uffer, 5 mm DTT, 20 U Protector RNse inhiitor, 1 mm deoxynucleotide mix, nd 10 U of reverse trnscriptse. At first, the templte-primer mixture ws dentured y heting the tue for 10 min t 65 C in thermo cycler (SensoQuest GmH, Göttingen, Germny). Then, fter dding the remining components of the mixture, the following therml profile of the rection ws pplied: 30 min t 45 C followed y inctivtion of reverse trnscriptse t 85 C for 5 min, with susequent cooling to 4 C. cdna ws kept t -20 C for further qpcr nlysis. Power SYBR Green PCR Mster Mix (Life Technologies, Crlsd, CA, USA) ws used for qpcr nlysis. The primers used for qpcr, products sizes, nd Gen- Bnk ccession numers nd/or references re included in Tle 1. The qpcr mix consisted of 2 μl of RT product, 1 μl of forwrd nd reverse primer (0.4 μm), 8.5 μl of nuclese-free wter, nd 12.5 μl of SYBR Green. The rection ws performed mnully in duplictes for ech smple, t finl volume of 25 μl in 96-well pltes using ABI 7300 (Life Technologies). Ech run included nontemplte control (NTC). A stndrd curve ws generted y mplifying seril dilutions of known quntity of cdna. The mplifiction efficiency for ech gene ws
4 Bogcki et l. Reproductive Biology nd Endocrinology 2014, 12:32 Pge 4 of 11 Tle 1 Primers used for qpcr Gene Primer sequence Amplicon size (se pirs) GenBnk ccession no./reference MATER F: GATTAACGCCCAGCTCTTGT 154 AM R: AGCTTCTGCAGAGTGCAGTG ZAR-1 F: TGGTGTGTCCAGGGCACTAA 213 NM_ R: GTCACAGGAGAGGCGTTTGC BMP15 F: AGCTTCCACCAACTGGGTTGG 285 Li et l. [17] R: TCATCTGCATGTACAGGGCTG BAX F: AAGCGCATTGGAGATGAACT 159 Wsielk et l. [22] R: AAAGTAGAAAAGCGCGACCA BCL-2 F: GAAACCCCTAGTGCCATCAA 196 Ju et l. [23] R: GGGACGTCAGGTCACTGAAT P450scc F: TTTACAGGGAGAAGCTCGGCAAC 251 Wlzel et l. [24] R: TTACCTCCGTGTTCAGGACCAAC 3βHSD F: GGGTTTCTGGGTCAGAGGATC 236 Wlzel et l. [24] R: CGTTGACCACGTCGATGATAGAG GAPDH F: TCGGAGTGAACGGATTTG 219 Kuijk et l. [21] R: CCTGGAAGATGGTGATGG found to e etween 90 nd 100% for ll the investigted genes. The therml profile for mplifiction of the investigted genes ws s follows: preincution t 95 C for 15 min, followed y 45 cycles of denturtion t 95 C for 15 s, nneling t either 52 C (for glycerldehyde-3- phosphte dehydrogense; GAPDH), 55 C (for BMP15, MATER, ZAR-1), 57 C (for BCL-2), or 60 C (for BAX, P450scc, 3βHSD) for 30 s, nd elongtion t 72 C for 30 s. After the end of the lst cycle, the melting curve ws generted. Product purity ws confirmed y electrophoresis nd its specificity ws confirmed y sequencing (Genomed, Wrsw, Polnd). The otined sequences were compred with the expected sequences of the investigted genes using BLAST (l2seq). The finl quntifiction ws reported s reltive expression (verge vlue from duplictes) fter normliztion to reference gene (GAPDH) expression in the sme smples. GAPDH ws selected s good reference gene cndidte for pig oocytes nd emryos for the resons suggested y Kuijk et l. [21]. There ws no sttisticlly significnt impct of the tretments on GAPDH trnscript level in our study, confirming its usefulness s good endogenous control. Western lot A western lot of the BMP15 protein ws crried out ccording to the method descried previously y Wu et l. [15] nd Prdis et l. [25]. Protein concentrtion in FF ws determined ccording to the Brdford [26]. Briefly, 0.75 μg of protein in n SDS-gel loding uffer (50 mm TRIS-HCl, 4% SDS, 20% glycerol, nd 2% β-mercptoethnol) ws heted to 95 C for 4 min, electrophoreticlly seprted on 12% polycrylmide- SDS gel for 1.5 h t constnt current (200 ma), nd then trnsferred overnight onto nitrocellulose memrne. After the trnsfer, the memrnes were stined with Ponceu S for totl protein loding. They were then locked in solution of 5% (w/v) non-ft dry milk for 1.5 h. The expression of BMP15 ws determined with the use of primry polyclonl rit nti-humn BMP15 ntiody (Snt Cruz Biotechnology, Inc., Snt Cruz, CA, USA), diluted 1:400 in locking solution. The secondry ntiody used ws got nti-rit IgG conjugted with lkline phosphtse (Sigm), diluted 1:20,000 in locking solution contining pig protein. The moleculr weight of the nds ws determined y reference to stndrd moleculr weight mrker. Three immunorective nds were found, representing BMP15 promture protein (65 kd), cleved proregion (50 kd), nd mture protein (25 kd). The intensity of the nds ws quntified y mesuring opticl density using Kodk ID imge nlysis softwre (Estmn Kodk, Rochester, NY, USA). A control smple ( mix of ll smples nlyzed) ws loded on ech gel to correct for interlot vriility [15,25]. Densitometric vlues for individul FF smples were normlized to stle protein nd quntified fter Ponceu S stining. All smples were electrophoresed nd nlyzed in duplicte, nd vlues were verged efore sttisticl nlysis [15,25]. Sttisticl nlysis The sttisticl nlysis ws crried out with the use of GrphPd PRISM v. 5.0 softwre (GrphPd Softwre, Inc., Sn Diego, CA, USA). Normlity (ell shped
5 Bogcki et l. Reproductive Biology nd Endocrinology 2014, 12:32 Pge 5 of 11 distriution) nd homoscedsticity (vrinces) of the dt were tested efore nlysis. For the dt fitting the ssumptions of prmetric tests, i.e., following norml distriution nd hving similr vrinces, one-wy ANOVA nd Bonferroni post-test ws pplied. For dt tht did not meet the ssumptions of prmetric tests (not following norml distriution or hving different vrinces), the non-prmetric Kruskl-Wllis test nd Dunn post-test were done. With regrd to the pigs reproductive prmeters (such s the numer of follicles, oocyte nucler mturtion, hormone concentrtion in FF nd serum), the dt did not show norml distriution nd/or similr vrinces even fter logrithmic or rcsine trnsformtion (in cse of the dt concerning oocyte nucler mturtion); therefore we nlyzed them with the non-prmetric Kruskl-Wllis test nd Dunn post-test. Becuse of different vrinces, the dt of ZAR-1, BMP15, BAX, nd BCL-2/BAX mrna expression were logrithmiclly trnsformed nd nlysis ws done on the trnsformed dt. These dt were nlyzed with the use of one-wy ANOVA nd Bonferroni post-test. MATER, BCL-2, P450scc, 3βHSD mrna nd BMP15 protein expression dt, which did not show norml distriution, were nlyzed with the use of the non-prmetric Kruskl-Wllis test nd Dunn post-test. P vlues less thn 0.05 were considered significnt. Results re presented s ls men ± S.E.M. Results The effect of hormonl tretments on follicle numers, oocyte nucler mturtion, nd steroids concentrtions (P 4 nd E 2 ) in FF nd lood serum The numer of preovultory follicles per gilt did not differ etween the experimentl groups of gilts (Tle 2). A higher percentge of immture oocytes ws found in -treted nimls (group II) when compred to the nturlly cyclic nimls (group I) (p < 0.05; Figure 1). The percentge of oocyte nucler mturtion did not differ etween -treted nimls (group II) nd + PGF2α-treted nimls (group III) (p > 0.05). P 4 concentrtion in lood serum did not differ etween the experimentl groups of nimls (p > 0.05; Tle 2). However, its concentrtion in FF ws significntly higher in gilts stimulted with (group II) compred to those stimulted with + PGF2α (group III) or in the nturlly cyclic nimls (group I) (p < 0.01; Tle 2). There ws no difference in P 4 concentrtion in FF etween nturlly cyclic (group I) nd + PGF2α-treted nimls (group III) (p > 0.05). There ws no difference in E 2 concentrtion in lood serum etween the -treted gilts (group II), + PGF2α-treted gilts (group III), nd nturlly cyclic gilts (group I) (p > 0.05; Tle 2). The sme oservtion ws mde regrding E 2 concentrtion in FF (Tle 2). The effect of hormonl tretments on the expression of mternl effect (MATER, ZAR-1, BMP15) nd poptosisrelted (BCL-2 nd BAX) genes, BCL-2/BAX mrna rtio in COCs nd BMP15 protein in FF The highest expression of MATER, ZAR-1, BMP15 genes ws found in the COCs recovered from gilts treted with (group II), when compred to the PMSG/ hcg + PGF2α-stimulted (group III) nd nturlly cyclic gilts (group I) (p < 0.01; Figure 2). Additionlly, mternl effect gene expression ws higher in the COCs of + PGF2α-treted gilts (group III) thn in the nturlly cyclic gilts (group I) (p < 0.05). Hormonl tretment did not ffect BMP15 protein level in FF. The densitometric nlysis of ll three detected nds of BMP15 (nlyzed seprtely) indicted tht there were no differences in BMP15 forms expression in FF etween experimentl groups (mrked t p < 0.05; Figure 3). The expression of poptosis-relted gene BCL-2 ws significntly higher (p < 0.05) in COCs derived from gilts Tle 2 The effect of hormonl tretments on follicle numers nd steroids concentrtions in FF nd serum Tretment p Nturl estrus + PGF2α Follicles per gilt ± ± ± 1.87 ns Steroids in FF P 4 (ng/ml) ± ± ± vs. p < 0.01 E 2 (ng/ml) ± ± ± 1.12 ns Steroids in lood serum P 4 (ng/ml) 1.86 ± ± ± 0.16 ns E 2 (pg/ml) ± ± ± ns Follicles numer nd P 4 nd E 2 concentrtion in folliculr fluid nd lood serum recovered from non-stimulted gilts with nturl estrus (group I; n = 8), stimulted with (group II; n = 5) or with + PGF2α (group III; n = 7). Vlues re expressed s ls men ± S.E.M.
6 Bogcki et l. Reproductive Biology nd Endocrinology 2014, 12:32 Pge 6 of 11 oocyte nucler mturtion (%) Nturl estrus +PGF2α 0 immture oocytes (GV) Figure 1 The nucler mturtion of oocytes. The comprison of nucler mturtion of oocytes derived from non-stimulted gilts with nturl estrus (group I; n = 4), stimulted with (group II, n = 3) or with + PGF2α (group III, n = 3). Vlues re expressed s percentges of immture oocytes (germinl vesicle; GV). Significnt differences etween groups were mrked with p < treted with (group II; Figure 4), compred to + PGF2α-treted gilts (group III) or the nturlly cyclic nimls (p < 0.05); Figure 4. Moreover, its expression ws enhnced in COCs recovered from -treted gilts (group II) compred to PMSG/ hcg + PGF2α-treted gilts (group III) (p < 0.05). In the cse of BAX mrna expression, it ws significntly higher in COCs of -stimulted gilts (group II) compred to + PGF2α-stimulted gilts (group III) nd the nturlly cyclic gilts (group I) (p < 0.05; Figure 4). The expression of BAX mrna ws comprle in the + PGF2α-treted gilts (group III) nd in the nturlly cyclic gilts (group I) (p > 0.05). The rtio of BCL2/BAX mrna ws higher in COCs of gilts treted with (group II) thn in the other two groups (p < 0.01; Figure 4). Additionlly, significntly higher BCL-2/BAX mrna rtio ws found in + PGF2α-treted (group III) nimls thn in nimls ttining estrus nturlly (group I) (p < 0.05). mrna expression (ritrry units) c MATER ZAR-1 BMP15 c c Nturl estrus +PGF2α Figure 2 The expression of mternl effect genes in porcine COCs. The comprison of the expression of mternl effect genes (MATER, ZAR-1 nd BMP15) in COCs derived from non-stimulted gilts with nturl estrus (group I; n = 8), stimulted with (group II; n = 5) or with + PGF2α (group III; n = 7). Vlues from qpcr were normlized to GAPDH expression. Different superscripts depict significnt sttisticl differences t p < Dt re expressed in ritrry units s the ls men ± S.E.M. The effect of hormonl tretments on the expression of P 4 synthesis pthwy genes (P450scc nd 3βHSD) in grnulos cells Regrding expression of P450scc mrna, it ws significntly incresed in grnulos cells from femles sujected to hormonl tretment with + PGF2α (group III) in comprison to grnulos cells recovered from nturlly cyclic nimls (group I) nd treted nimls (group II) (p < 0.05; Figure 5). Additionlly, we did not find ny difference in P450scc mrna expression in grnulos cells otined from gilts stimulted with (group II) nd the nturlly cyclic gilts (group I) (p > 0.05; Figure 5). The expression of 3βHSD mrna ws significntly incresed in grnulos cells recovered from gilts stimulted with + PGF2α (group III), compred to its expression in grnulos cells otined from nturlly cyclic gilts (group I) (p < 0.001; Figure 5). Moreover, its expression ws lso incresed in grnulos cells of -treted nimls (group II) compred to nturlly cyclic pigs (group I) (p < 0.05). Discussion The pper presents the results on the effect of hormonl estrus induction on COCs qulity nd selected folliculr prmeters in the pig. We found tht hormonl stimultion of gilts with or + PGF2α did not ffect the follicle numer when compred with nturlly cyclic nimls. It hd een previously reported tht in pregnnt femles the numer of corpor lute nd the fertiliztion rte were comprle etween non-stimulted nd -treted pigs [3]. On the other hnd, Kiewisz et l. [27] showed tht tretment with + PGF2α generted higher numer of corpor lute nd conceptuses when compred to nimls ttining estrus nturlly. This oservtion ws not confirmed in the
7 Bogcki et l. Reproductive Biology nd Endocrinology 2014, 12:32 Pge 7 of 11 A BMP15 protein expression (opticl density) nd 1 nd 2 nd 3 Nturl estrus +PGF2α B M Nturl estrus PMSG/ hcg 65 kd 50 kd 25 kd Ponceu S Figure 3 The expression of BMP15 protein in FF. The comprison of expression of BMP15 protein (A) in folliculr fluid derived from nonstimulted gilts with nturl estrus (group I; n = 8), stimulted with (group II; n = 5) or with + PGF2α (group III; n = 7). Representtive nds of western lots re presented (B). The nds represent three forms of BMP15 found in FF: premture protein (nd 1, ~65 kd), cleved proregion (nd 2, ~50 kd) nd mture protein (nd 3, ~25 kd). Dt re expressed in ritrry opticl density units s the ls men ± S.E.M. Different superscripts depict significnt sttisticl differences t p < present study with regrd to folliculr growth; however, the discrepncy my result from differences in niml tretment. In the cited study of Kiewisz et l. [27], gilts were ssigned for hormonl stimultion in their third estrus, while in our study nimls with two consecutively stimulted estruses were used. In the present study, we oserved mrkedly higher expression of ll the investigted mternl effect gene trnscripts (MATER, ZAR-1, BMP15) in COCs recovered from nimls treted hormonlly with or + PGF2α, when compred with those oserved in nturlly cyclic femles. This high expression mrna expression (ritry units) c BCL-2 BAX BCL-2/BAX c BCL-2/BAX mrna expression rtio Nturl estrus +PGF2α Figure 4 The expression of poptosis-relted genes in porcine COCs. The comprison of the expression of poptosis-relted genes BCL-2, BAX nd BCL-2/BAX mrna rtio in COCs derived from non-stimulted gilts with nturl estrus (group I; n = 8), stimulted with (group II; n = 5) or with + PGF2α (group III; n = 7). Vlues from qpcr were normlized to GAPDH gene expression. Dt re expressed in ritrry units s the ls men ± S.E.M. Different superscripts depict significnt sttisticl differences t p < 0.05.
8 Bogcki et l. Reproductive Biology nd Endocrinology 2014, 12:32 Pge 8 of 11 mrna expression (ritrry units) Nturl estrus +PGF2α βHSD P450scc Figure 5 The expression of P 4 synthesis pthwy genes in porcine grnulos cells. The comprison of the expression of P 4 synthesis pthwy genes (3βHSD nd P450scc) in grnulos cells derived from non-stimulted gilts with nturl estrus (group I; n = 8), stimulted with (group II; n = 5) or with + PGF2α (group III; n = 7). Vlues from qpcr were normlized to GAPDH expression. Different superscripts depict significnt sttisticl differences t p < Dt re expressed in ritrry units s the ls men ± S.E.M. mrna expression (ritrry units) of mternl effect genes, prticulrly in COCs otined from -stimulted pigs, seems to e ssocited with higher numer of immture oocytes tht did not resume meiosis. It is well known tht the intense synthesis of mternl trnscripts precedes the onset of trnscriptionl silencing during the GV stge. The mternl trnscripts undergo post-trnscriptionl regultion through shortening of the polya til, which enles their storge nd protection from the trnsltion mchinery. After meiosis resumption, when the proteins re required, the trnscripts re polydenylted nd used for trnsltion, then rpidly degrded [18,28]. The high levels of the investigted mternl effect gene trnscripts found in our study in COCs from hormonlly treted nimls, nd the lower percentge of oocytes tht resumed meiosis, my result from the fct tht cellulr mechnisms controlling trnscription nd/or trnsltion in femle gmetes cn e modified in these gilts in response to exogenous gondotropins. Similrly, in studies on the development of porcine emryos, it ws shown tht disturtion in mternl mrna degrdtion my e responsile for delyed clevge of porcine emryos in vitro [29]. Together, these findings suggest tht mechnisms of mternl trnscript utiliztion re potentil determinnts of oocyte/emryo qulity nd developmentl potentil, nd my e ffected y fctors such s hormonl stimultion nd in vitro culture conditions. The BMP15 protein level in FF is considered s potentil mrker of oocyte qulity. The min role plyed y BMP15 protein in preovultory follicles is to stimulte cumulus cell expnsion [13,14]. The present study hs shown tht hormonl tretment of gilts mrkedly incresed BMP15 trnscript level in COCs ut it did not ffect BMP15 protein level in FF. Similr results were otined y Prdis et l. [25] who lso did not find correltion etween BMP15 mrna expression in oocytes nd protein in FF during different phses of follicle development, suggesting tht not necessrily protein y itself ut rther its receptor cn e influenced y gondotropins in the pig. In our experiment, the serum concentrtion of P 4 did not differ etween the experimentl groups ut ws higher in the FF of compred to PMSG/ hcg + PGF2α-stimulted nd non-stimulted femles. Similrly, in the studies of Wiesk et l. [1] the concentrtion of P 4 in FF, recovered from follicles of nonstimulted gilts, ws lower thn in follicles otined from gondotropin-treted () gilts t ll stges of follicle development. The high concentrtion of P 4 in FF otined from -treted nimls ws ssocited with incresed percentge of oocytes t the GV stge nd incresed levels of mternl effect gene trnscripts in COCs. Shimd nd Terd [30] found tht P 4 induces germinl vesicle rekdown (GVBD) in porcine oocytes, proly through the disruption of gp junction communiction. Dynmic chnges in the expression of P 4 receptor proteins, following in vitro mturtion in response to supplementtion with LH, follicle-stimulting hormone (FSH), or P 4, lso indicted the role of P 4 in ovine oocyte mturtion [31]. In the current in vivo study, the incresed concentrtion of P 4 in FF of -treted nimls does not seem to support meiosis resumption in the oocytes. On the other hnd, it ws found tht the ddition of vrious concentrtions of P 4 to the mturtion medium hd negtive effects on the percentge of oocytes completing nucler or cytoplsmic mturtion in porcine [32] nd ovine oocytes [33]. Our results lso indicte tht the inclusion of PGF2α into the synchroniztion protocol decreses the P 4 concentrtion in follicles to the levels oserved in the follicles of nturlly cyclic gilts. A similr effect ws oserved in in vitro studies, where PGF2α exerted concentrtion-dependent inhiitory influence on gondotropin-stimulted P 4 production [34]. It cn e suggested tht including PGF2α into n estrus stimultion protocol in the pig cn e eneficil for otining more physiologicl concentrtion of P 4 in FF nd enhncing the nturl hormonl environment for oocyte development. Mintining the pproprite P 4 concentrtion
9 Bogcki et l. Reproductive Biology nd Endocrinology 2014, 12:32 Pge 9 of 11 in FF is possile explntion for the results of Sommer et l. [20], in which inclusion of PGF2α into gondotropin stimultion protocol ws very effective for the collection of pronucler stge emryos for iotechnologicl purposes. From the present study it seems tht hormonl stimultion of estrus increses mrna expression of oth investigted enzymes prticipting in P 4 synthesis (P450scc nd 3βHSD) in grnulos cells. While in the grnulos cells of -treted nimls only 3βHSD expression ws rised, dding PGF2α into the stimultion protocol enhnced the expression of oth investigted steroidogenesis-relted genes. Similrly to our findings, the studies of Blitek et l. [35] found tht induction of estrus with + PGF2α incresed the expression of mrna for steroidogenic pthwy genes such s StAR, CYP11A, nd 3βHSD in the corpus luteum on dys 9 nd 12 of pregnncy, compred to the nimls ttining estrus nturlly. Interestingly, in our study the increse of 3βHSD mrna expression ws oserved in grnulos cells fter stimultion with oth nd + PGF2α; however, the incresed P 4 concentrtion ws found only in nimls treted with. It my e tht the inclusion of PGF2α in the stimultion protocol incresed P 4 metolism, while t the sme time not ffecting 3βHSD mrna expression stimulted y gondotropins. A slightly different sitution ws found in the cse of P450scc mrna, where we did not oserve the effect of gondotropins tretment on its expression; however, its enhnced expression is rther result of the incresed metolism of P 4 induced y PGF2α. The intr-folliculr concentrtion of E 2 is considered s mrker for preovultory mturtion, nd it increses progressively long with follicle development. In our experiments, oth nturlly cyclic nd hormonlly stimulted gilts hd similr E 2 concentrtion in lood serum nd FF. However, the results otined y Wiesk et l. [1] reveled lower levels of E 2 in the follicles of hormonlly treted gilts compred to nturlly cyclic nimls. In the present study we did not find reltionship etween E 2 concentrtion nd the resumption of meiosis in oocytes. This oservtion is in greement with the findings of in vitro experiments [36], where it ws suggested tht E 2 is not involved in nucler mturtion of pig oocytes ut rther my promote chnges in clcium ctivity during oocyte cytoplsmic mturtion [37]. It hs een suggested tht oocytes of inferior qulity re predestined to undergo poptosis. Chnges in the lnce etween nti- nd propoptotic fctors ply n importnt role in the regultion of cellulr poptosis. Our oservtion tht gondotropins incresed the BCL- 2/BAX trnscript rtio in COCs is in greement with the ntipoptotic effect on the whole follicles found y Chun et l. [38]. Moreover, it ws reveled tht my suppress poptotic mchinery in rodent grnulos cells [39,40]. In our study, high level of P 4 in FF ws ssocited with n incresed rtio of BCL-2/BAX mrna in COCs of -stimulted nimls. It is possile tht this gondotropin-induced ntipoptotic effect in COCs is medited through high P 4 content in the FF. In ovine grnulos cells, gondotropin surges induced the expression of progesterone receptors, promoting their resistnce to poptosis [41]. This reltionship ws lso found in ovine cumulus cells, where tretment with P 4 for 24 h decresed cspse-3 ctivity nd the rtio of BAX/BCL2 trnscripts, while n inhiition of P 4 synthesis enzymes incresed cspse-3 ctivity nd the poptosis in these cells [42]. On the other hnd, the ility of oocytes to prevent poptosis my rely on some mternl specific fctors, like BMP15 [43]. The role of BMP15 in poptosis prevention might e suggested in our study, where high BMP15 trnscript levels were found in COCs recovered from hormonlly treted nimls. Conclusions In conclusion, hormonl induction of estrus with PMSG/ hcg or + PGF2α ffected mternl effect gene trnscript levels in porcine COCs nd oocyte mturtion. The high mternl effect genes mrna content in COCs from hormonlly stimulted nimls my e cused y some disturnces in mternl trnscripts utiliztion fter gondotropin tretment. The inclusion of PGF2α into the stimultion protocol seems to e eneficil for mintining physiologicl concentrtion of P 4 in FF. Moreover, oth hormonl regimens pper to e eneficil for poptosis prevention through incresing the BCL- 2/BAX rtio. Whether the effect of gondotropins on oocyte mturtion nd mternl effect gene expression ffect lso oocyte qulity nd susequent emryo development needs to e further studied. Competing interests The uthors declre tht they do not hve competing interests. Authors contriutions MB conceived of the study, prticipted in its design, coordintion nd helped to drft the mnuscript. MW prticipted in coordintion, collected the tissues nd crried out mrna isoltion, qpcr nd ceto-orcein stining. AK collected the tissues nd crried out Western lot nlysis. IB prticipted in preprtion of the mnuscript drft nd qpcr nlysis. BMJ crried out immunossys. All uthors red nd pproved the finl mnuscript. Acknowledgments This reserch ws supported y grnt no. NN from the Ministry of Science nd Higher Eduction, Polnd. We sincerely pprecite M. Blitek for help in the cre nd hndling of nimls. The correction of English grmmr, flow nd redility of the mnuscript ws done y professionl service. Ann Kitewsk ws supported y the Europen Union within the Europen Socil Fund.
10 Bogcki et l. Reproductive Biology nd Endocrinology 2014, 12:32 Pge 10 of 11 Author detils 1 Institute of Animl Reproduction nd Food Reserch of Polish Acdemy of Sciences, Tuwim 10, Olsztyn , Polnd. 2 Deprtment of Animl Physiology, University of Wrmi nd Mzury, Oczpowskiego 2, Olsztyn , Polnd. Received: 10 Decemer 2013 Accepted: 27 Mrch 2014 Pulished: 1 My 2014 References 1. Więsk T, Hunter MG, Foxcroft GR: Differences in folliculr morphology, steroidogenesis nd oocyte mturtion in nturlly cyclic nd PMSG/ hcg-treted prepuertl gilts. J Reprod Fertil 1990, 89: Zięcik AJ, Biłłowicz M, Kczmrek M, Deminowicz W, Rioperez J, Wsielk M, Bogcki M: Influence of estrous synchroniztion of prepuertl gilts on emryo qulity. J Reprod Dev 2005, 51: Blitek A, Kczmrek MM, Kiewisz J, Zięcik AJ: Endometril nd conceptus expression of HoxA10, trnsforming growth fctor et 1, leukemi inhiitory fctor, nd prostglndin H synthse-2 in erly pregnnt pigs with gondotropin-induced estrus. Domest Anim Endocrinol 2010, 38: Mrtint-Botté F, Venturi E, Guillouet P, Drincourt MA, Terqui M: Induction nd synchroniztion of ovultions of nulliprous nd multiprous sows with n injection of gondotropin-relesing hormone gonist (receptl). Theriogenology 2010, 73: Tong Z-B, Gold L, DePol A, Vnevski K, Dorwrd H, Sen P, Plumo C, Bondy CA, Nelson NM: Developmentl expression nd sucellulr locliztion of mouse MATER, n oocyte-specific protein essentil for erly development. Endocrinology 2004, 145: Pisni LF, Rmelli P, Lzzri B, Brgli S, Cecilini F, Mrini P: Chrcteriztion of mternl ntigen tht emryos require (MATER/ NLRP5) gene nd protein in pig somtic tissues nd germ cells. J Reprod Dev 2010, 56: Uzekov S, Roy-Su M, Dliès-Trn R, Perreu C, Ppillier P, Momprt F, Thelie A, Pennetier S, Cognie J, Cdoret V, Royere D, Monget P, Mermillod P: Zygote rrest 1 gene in the pig, cttle nd humn: evidence of different trnscripts vrints in mle nd femle germ cells. Reprod Biol Endocrinol 2006, 4: Tong Z-B, Gold L, Pfeifer KE, Dorwrd H, Lee E, Bondy CA, Den J, Nelson NM: Mter, mternl effect gene required for erly emryonic development in mice. Nt Genet 2000, 26: Zheng P, Den J: Role of Fili, mternl effect gene, in mintining euploidy during clevge-stge mouse emryogenesis. Proc Ntl Acd Sci USA2009, 106: Sen P, Riccio M, Mrzon L, Nicoli A, Mrsell T, Mrmiroli S, Bertcchini, Fno RA, L Sls GB, De Pol A: Humn MATER locliztion in specific cell domins of oocyte nd folliculr cells. Reprod Biomed Online 2009, 2: Moore RK, Otsuk F, Shimski S: Moleculr sis of one morphogenetic protein-15 signling in grnulos cells. J Biol Chem 2003, 278: Zhu G, Bingrn G, Pn D, Mu Y, Feng S: Expression of one morphogenetic proteins nd receptors in porcine cumulus-oocyte complexes during in vitro mturtion. Anim Reprod Sci 2008, 104: Su YQ, Wu X, O Brien MJ, Pendol FL, Denegre JN, Mtzuk MM, Eppig JJ: Synergistic roles of BMP15 nd GDF9 in the development nd function of the oocyte-cumulus cell complex in mice: genetic evidence for n oocyte-grnulos cell regultory loop. Dev Biol 2004, 276: Kthirvel M, Soundin E, Kumnn V: Differentil expression dynmic of growth differentition fctor 9 (GDF9) nd one morphogenetic fctor 15 (BMP15) mrna trnscripts during in vitro mturtion of ufflo (Bulus ulis) cumulus-oocyte complexes. SpringerPlus 2013, 2: Wu YT, Tng L, Ci J, Lu XE, Xu J, Zhu XM, Luo Q, Hung H-F: High one morphogenetic protein-15 level in folliculr fluid is ssocited with high qulity oocyte nd susequent emryonic development. Hum Reprod 2007, 22: Gode F, Gulekli B, Dogn E, Korhn P, Dogn S, Bige O, Cimrin D, Atey N: Influence of folliculr fluid GDF9 nd BMP15 on emryo qulity. Fertil Steril 2011, 95: Li HK, Kuo TY, Yng HS, Chen LR, Li SS, Hung HW: Differentil gene expression of one morphogenetic protein 15 nd growth differentition fctor 9 during in vitro mturtion of porcine oocytes nd erly emryos. Anim Reprod Sci 2008, 103: Thelie A, Ppillier P, Perreu C, Uzekov S, Hennequet-Antier C, Dlies- Trn R: Regultion of ovine oocyte-specific trnscripts during in vitro oocyte mturtion nd fter mternl emryonic trnsition nlyzed using trnscriptome pproch. Mol Reprod Dev 2009, 76: Romr R, De Sntis T, Ppillier P, Perreu C, Thélie A, Dell Aquil, Mermillod P, Dliés-Trn R: Expression of mternl trnscripts during ovine oocyte in vitro mturtion is ffected e donor ge. Reprod Domest Anim 2011, 46: Sommer JR, Collins EB, Estrd JL, Petters RM: Synchroniztion nd superovultion of mture cycling gilts for the collection of pronucler stge emryos. Anim Reprod Sci 2007, 100: Kuijk EW, du Puy L, vn Tol HT, Hgsmn HP, Colenrnder B, Roelen BA: Vlidtion of reference genes for quntittive RT-PCR studies in porcine oocytes nd preimplnttion emryos. BMC Dev Biol 2007, 7: Wsielk M, Fujii T, Ohski T, Hshizume T, Bogcki M, Swi K: Trnscript undnce nd poptosis in dy-7 porcine lstocyst cultured with exogenous insulin-like growth fctor-i. Reprod Biol 2013, 13: Ju S, Rui R, Lu Q, Lin P, Guo H: Anlysis of poptosis nd methyltrnsferse mrna expression in porcine cloned emryos cultured in vitro. J Assist Reprod Genet 2010, 27: Wlzel H, Brock J, Pöhlnd R, Vnselow J, Tomek W, Schneider F, Tiemnn U: Effects of glectin-1 on regultion of progesterone production in grnulos cells from pig ovries in vitro. Glycoiology 2004, 14: Prdis F, Novk S, Murdoch GK, Dyck MK, Dixon WT, Foxcroft GR: Temporl regultion of BMP2, BMP6, BMP15, GDF9, BMPR1A, BMPR1B, BMPR2 nd TGFBR1 mrna expression in the oocyte, grnulos nd thec cells of developing preovultory follicles in the pig. Reproduction 2009, 138: Brdford MM: A rpid nd sensitive method for the quntittion of microgrm quntities of protein utilizing the principle of protein-dye inding. Anl Biochem 1976, 72: Kiewisz J, Kczmrek MM, Morwsk E, Blitek A, Kpelński W, Zięcik AJ: Estrus synchroniztion ffects WNT signling in the porcine reproductive trct nd emryos. Theriogenology 2011, 76: Guéripel X, Brun V, Gougeon A: Oocyte one morphogenetic protein 15, ut not growth differentition fctor 9, is incresed during gondotropin-induced folliculr development in the immture mouse nd is ssocited with cumulus oophorus expnsion. Biol Reprod 2006, 75: Isom CS, Li RF, Whitworth KM, Prther RS: Timing of first emryonic clevge is positive indictor of the in vitro developmentl potentil of porcine emryos derived from in vitro fertiliztion, somtic cell nucler trnsfer nd prthenogenesis. Mol Reprod Dev 2012, 79: Shimd M, Terd T: FSH nd LH induce progesterone production nd progesterone receptor synthesis in cumulus cells: requirement for meiotic resumption in porcine oocytes. Mol Hum Reprod 2002, 8: Apricio IM, Grci-Herreros M, O She LC, Hensey C, Lonergn P, Fir T: Expression, regultion, nd function of progesterone receptors in ovine cumulus oocyte complexes during in vitro mturtion. Biol Reprod 2011, 84: Dode MA, Grves C: Involvement of steroid hormones on in vitro mturtion of pig oocytes. Theriogenology 2002, 57: Silv CC, Knight PG: Effects of ndrogens, progesterone nd their ntgonists on the developmentl competence of in vitro mtured ovine oocytes. J Reprod Fertil 2000, 119: Aysekr DR, Michel AE, Weley GE, Flint AP: Mode of ction of prostglndin F2 lph in humn luteinized grnulos cells: role of protein kinse C. Mol Cell Endocrinol 1993, 97: Blitek A, Morwsk-Pucinsk E, Szymnsk M, Krwczynski K, Ziecik A: Effect of estrus synchroniztion on lutel P4 synthesis in erly pregnnt gilts. Reprod Domest Anim 2013, 48(Suppl. 1): Dode MA, Grves CN: Role of estrdiol-17β on nucler nd cytoplsmic mturtion of pig oocytes. Anim Reprod Sci 2003, 78: Wng HF, Isoe N, Kummoto K, Ymshiro H, Ymshit Y, Terd T: Studies of the role of steroid hormone in the regultion of oocyte mturtion in cttle. Reprod Biol Endocrinol 2006, 4: Chun SY, Billig H, Tilly JL, Furut I, Tsfriri A, Hsueh AJ: Gondotropin suppression of poptosis in cultured preovultory follicles: meditory role of endogenous insulin-like growth fctor I. Endocrinology , 1994:135.
11 Bogcki et l. Reproductive Biology nd Endocrinology 2014, 12:32 Pge 11 of Xio CW, Ash K, Tsng BK: Nucler fctor- B-medited X-linked inhiitor of poptosis protein expression prevents rt grnulos cells from tumor necrosis fctor-induced poptosis. Endocrinology 2001, 142: Roles R, To XJ, Trovich AM, Mrvel DV, Nhum R, Perez GI, Nhum R, Perez GI, Tilly KI, Tilly JL: Locliztion, regultion nd possile consequences of poptotic protese-ctivting fctor-1 (Apf-1) expression in grnulos cells of the mouse ovry. Endocrinology 1999, 140: Quirk SM, Cown RG, Hrmn RM: Progesterone receptor nd the cell cycle modulte poptosis in grnulos cells. Endocrinology 2004, 145: Slh M, Tosc L, Cu C, Ppillier P, Perreu C, Dupont J, Mermillod P, Uzekov S: Kinetics of gene expression nd signling in ovine cumulus cells throughout IVM in different mediums in reltion to oocyte developmentl competence, cumulus poptosis nd progesterone secretion. Theriogenology 2011, 75: Hussein TS, Froilnd DA, Amto F, Thompson JG, Gilchrist RB: Oocytes prevent cumulus cell poptosis y mintining morphogenic prcrine grdient of one morphogenetic proteins. J Cell Sci 2005, 18: doi: / Cite this rticle s: Bogcki et l.: The effect of hormonl estrus induction on mternl effect nd poptosis-relted genes expression in porcine cumulus-oocyte complexes. Reproductive Biology nd Endocrinology :32. Sumit your next mnuscript to BioMed Centrl nd tke full dvntge of: Convenient online sumission Thorough peer review No spce constrints or color figure chrges Immedite puliction on cceptnce Inclusion in PuMed, CAS, Scopus nd Google Scholr Reserch which is freely ville for redistriution Sumit your mnuscript t
EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum,
DOI:.554/5YRTIMB..3 OPPOSITE MODELS OF EXPRESSION OF ANDROGEN RECEPTOR (AR) AND RETINOIC ACID RECEPTOR-α (RAR-α) IN THE ONSET OF MALE GERM CELL DEVELOPMENT IN HORMONALLY MANIPULATED RATS E. Pvlov, N. Atnssov,
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationsupplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationUniversity, 1-4-4, Kagamiyama, Higashi-Hiroshima, Hiroshima, , Japan
Pge 1 of 34 Reproduction Advnce Puliction first posted on 2 My 08 s Mnuscript REP-08-0074 Sequentil exposure of porcine cumulus cells to FSH nd/or LH is criticl for pproprite expression of steroidogenic
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationHormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.
Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationSupplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationBackground Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield.
Nnjing Agriculturl University Potssium enhnces the sugr ssimiltion in leves nd fruit y regulting the expression of key genes involved in sugr metolism of Asin pers Cixi Dong, Chngwei Shen, Yngchun Xu College
More informationAlterations in the expression of genes involved in lipid metabolism during bovine oocyte maturation and at the blastocyst stage in vivo vs.
Chpter 5 Altertions in the expression of genes involved in lipid metolism during ovine oocyte mturtion nd t the lstocyst stge in vivo vs. in vitro O.A. Algriny 1, P.L.A.M. Vos 1, M.A. Sirrd 2, S.J. Dielemn
More informationEffects of Recombinant Bovine Somatotropin Administration at Breeding on the Cow, Conceptus and Subsequent Offspring Performance of Beef Cattle
Effects of Recominnt Bovine Somtotropin Administrtion t Breeding on the Cow, Conceptus nd Susequent Offspring Performnce of Beef Cttle V. R. G. Mercdnte 1, F. M. Cirico 1, D. D. Henry 1, P. L. P. Fontes
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationRecent advances in cryopreservation od salmonid fish semen. Andrzej Ciereszko
Recent dvnces in cryopreservtion od slmonid fish semen Andrzej Ciereszko Institute of Animl Reproduction nd Food Reserch, Polish Acdemy of Sciences in Olsztyn, Polnd Justifiction for the studies Poor performnce
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationDR. MARC PAGÈS Project Manager R&D Biologicals - Coccidia Projects, HIPRA
DR. MARC PAGÈS Project Mnger R&D Biologicls - Coccidi Projects, HIPRA Dr. Mrc Pgès Bosch otined Microiology nd Genetics degree t the University of Brcelon in 1998. He otined his PhD working on the synptoneml
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationSupplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationSupplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationEffect of Fructose Addition in Skim Milk Extender on the Quality of Liquid Nili-Ravi Buffalo (Bubalus bubalis) Semen
Pkistn J. Zool., vol. 42(3), pp. 227-231,. Effect of Fructose Addition in Skim Milk Extender on the Qulity of Liquid Nili-Rvi Bufflo (Bulus ulis) Semen Shmim Akhter, Muhmmd Sjjd Ansri*, Bushr Allh Rkh,
More informationThe Effect of Substituting Sugar with Artificial. Sweeteners on the Texture and Palatability of Pancakes
The Effect of Sustituting Sugr with Artificil NUTR 453 Sweeteners on the Texture nd Pltility of Pnckes Jmie Wldron, Rquel Reyes, nd Reecc Legi 1 I. Astrct The effects of replcing sugr with Stevi nd Splend
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationCheck your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationBelg. J. Zool., 138 (2) : July 2008
Belg. J. Zool., 138 (2) : 184-19 July 8 Leptin promoted meiotic mturtion of ovine oocytes nd development of prthenogenetic ctivtion nd yk (Bos grunniens)-ovine interspecies cloned emryos Zhilin Guo, Yongsheng
More informationFollicle Size-Dependent Induction of Prostaglandin G/H Synthase-2 during Superovulation in Cattle'
BIOLOGY OF REPRODUCTION 58, 1527-1532 (1998) Follicle Size-Dependent Induction of Prostglndin G/H Synthse-2 during Superovultion in Cttle' Jinmin Liu nd Jen Sirois 2 Centre de recherche en reproduction
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More informationChronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats
Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho
More informationATRX is a novel progesterone regulated protein and biomarker of low. developmental potential in mammalian oocytes
Pge 1 of 28 Reproduction Advnce Puliction first posted on 1 Mrch 2017 s Mnuscript REP-16-0443 1 1 2 ATRX is novel progesterone regulted protein nd iomrker of low developmentl potentil in mmmlin oocytes
More informationOutline. AMH as a diagnostic marker for cryptorchidism 2/4/2018. Use of. in diagnosing ovarian tumors and cryptorchidism. Anti-Müllerian hormone (AMH)
2/4/28 Universiteit Utrecht Outline Use of nti-müllerin hormone () in dignosing ovrin tumors nd cryptorchidism nti-müllerin hormone () Wht, origin, Mrker for equine cryptorchidism Mrker for equine grnulos
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationChapter 5: The peripheral nervous system Learning activity suggested answers
Chpter 5: The peripherl nervous system Lerning ctivity suggested nswers Lerning Activity 5.1 (p. 222) 1 Briefly descrie the two min functions of the somtic nervous system. Description should refer to:
More informationSUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationESM Table 1. Characterisation of the human non-diabetic cohort used for MRIbased assessment of pancreatic fat and insulin secretion via OGTT.
ESM Tle 1. Chrcteristion of the humn non-dietic cohort used for MRIsed ssessment of pncretic ft nd insulin secretion vi OGTT. Trit sex Medin (IQR) 86 femles, 5 mles ge (yers) 4.4 (.5-5.57) BMI (kg/m²).62
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationEffects of Sini San used alone and in combination with fluoxetine on central and peripheral 5-HT levels in a rat model of depression
Online Sumissions:http://www.journltcm.com J Trdit Chin Med 2013 Octoer 15; 33(5): 674-681 info@journltcm.com ISSN 0255-2922 2013 JTCM. All rights reserved. EXPERIMENTAL STUDY TOPIC Effects of Sini Sn
More informationPNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :
PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged
More informationIrs-2 coordinates Igf-1 receptor-mediated β-cell development and peripheral insulin signalling
Irs-2 coordintes Igf-1 receptor-medited β-cell development nd peripherl insulin signlling Dominic J. Withers 1,2 *, Deorh J. Burks 1 *, Hether H. Towery 1, Shri L. Altmuro 1, Crrie L. Flint 1 & Morris
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationSUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
More informationReducing the Risk. Logic Model
Reducing the Risk Logic Model ETR (Eduction, Trining nd Reserch) is nonprofit orgniztion committed to providing science-bsed innovtive solutions in helth nd eduction designed to chieve trnsformtive chnge
More informationB. Koven 1*, E. Gisbert 2, O. Nixon 1, I. Meiri-Ashkenazi 1, A. Gaon 1, M.M. Solovyev 3,4, A. Tandler 1, H. Rosenfeld 1
DESIGNING WEANING DIETS BASED ON THE ONTOGENY OF DIGESTIVE TRACT ENZYME ACTIVITY DURING THE CARNIVOROUS-OMNIVOROUS TRANSITION IN GREY MULLET (MUGIL CEPHALUS) JUVENILES B. Koven 1*, E. Gisert 2, O. Nixon
More informationEffect of fungicide timing and wheat varietal resistance on Mycosphaerella graminicola and its sterol 14 α-demethylation-inhibitorresistant
Effect of fungicide timing nd whet vrietl resistnce on Mycospherell grminicol nd its sterol 14 α-demethyltion-inhiitorresistnt genotypes Didierlurent L., Roisin-Fichter C., Snssené J., Selim S. Pltform
More informationSupporting Information. In Situ Supramolecular Assembly and Modular Modification of Hyaluronic Acid Hydrogels for 3D Cellular Engineering
Supporting Informtion In Situ Suprmoleculr Assemly nd Modulr Modifiction of Hyluronic Acid Hydrogels for 3D Cellulr Engineering Kyeng Min Prk,, Jeong-A Yng,, Hyunte Jung, c Junseok Yeom, Ji Sun Prk, d
More informationInvasive Pneumococcal Disease Quarterly Report. July September 2017
Invsive Pneumococcl Disese Qurterly Report July September 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Rebekh Roos Helen Heffernn October 2017 Acknowledgements This report
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationOptimizing Metam Sodium Fumigation in Fine-Textured Soils
Optimizing Metm Sodium Fumigtion in Fine-Textured Soils Neil C Gudmestd University Distinguished Professor & Endowed Chir of Potto Pthology Deprtment of Plnt Pthology North Dkot Stte University Erly Dying
More informationEffect of granulocyte macrophage colony-stimulating factor deficiency on ovarian follicular cell function
Journl of Reproduction nd Fertility (2) 12, 283 292 Effect of grnulocyte mcrophge colony-stimulting fctor deficiency on ovrin folliculr cell function R. B. Gilchrist, D. B. Rowe, L. J. Ritter, S. A. Robertson,
More informationWSU Tree Fruit Research and Extension Center, Wenatchee (509) ext. 265;
FINAL REPORT WTFRC Project # AH-1-5 WSU Project # 13C-355-3 Project title: PI: Orgniztion: Coopertors: of Sunburn in Apples with RAYNOX Lrry Schrder, Horticulturist WSU Tree Fruit Reserch nd Extension
More informationPHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationSUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
More informationThe Ever Changing World of Feed Additives in The Poultry Industry
The Ever Chnging World of Feed Additives in The Poultry Industry B. S. Lumpkins nd G.F. Mthis Southern Poultry Reserch Inc. Athens, GA, USA Outline Southern Poultry Reserch Impct of ethnol production of
More informationBright Futures Medical Screening Reference Table 2 to 5 Day (First Week) Visit
Bright Futures Medicl Reference Tle 2 to 5 Dy (First Week) Visit Universl Action Metolic nd Verify documenttion of neworn metolic screening results, pproprite rescreening, nd needed follow-up. Document
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More informationA critical role for interleukin 4 in activating alloreactive CD4 T cells
A criticl role for interleukin 4 in ctivting llorective CD4 T cells Jessmyn Bgley,Tokihiko Swd*,Yin Wu nd John Icomini To generte ntigen-specific responses, T cells nd ntigen presenting cells (APCs) must
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationThe β-globin nuclear compartment in development and erythroid differentiation
The β-gloin nucler comprtment in development nd erythroid differentition Roert-Jn Plstr 1,2, Bs Tolhuis 1,2, Erik Splinter 1, Rin Nijmeijer 1, Frnk Grosveld 1 & Wouter de Lt 1 Efficient trnscription of
More informationXII. HIV/AIDS. Knowledge about HIV Transmission and Misconceptions about HIV
XII. HIV/AIDS Knowledge bout HIV Trnsmission nd Misconceptions bout HIV One of the most importnt prerequisites for reducing the rte of HIV infection is ccurte knowledge of how HIV is trnsmitted nd strtegies
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationEXPRESSION AND FUNCTION OF BRAIN-DERIVED NEUROTROPHIN FACTOR AND ITS RECEPTOR,
The Journl of Experimentl Biology 24, 287 295 (21) Printed in Gret Britin The Compny of Biologists Limited 21 JEB3367 287 EXPRESSION AND FUNCTION OF BRAIN-DERIVED NEUROTROPHIN FACTOR AND ITS RECEPTOR,
More informationINFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA
Pthology nd Hygiene INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA Kulcsár G. 1, Fáián K. 1 *, Brn T. 1, Virág Gy.
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
More information