Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission

Save this PDF as:

Size: px
Start display at page:

Download "Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission"


1 Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission Jesica Raingo, Mikhail Khvotchev, Pei Liu, Frederic Darios, Ying C. Li, Denise M.O. Ramirez, Megumi Adachi, Philippe Lemieux, Katalin Toth, Bazbek Davletov and Ege T. Kavalali Supplementary Figure 1: Limited co-localization of VAMP4 staining with Parvalbumin positive terminals at the stratum pyramidale. Supplementary Figure 2: Wide-spread distribution of syb2 in synaptic terminals in the stratum radiatum of the CA1 area. Supplementary Figure 3: Endogenous VAMP4 is present in synapses formed in culture. Supplementary Figure 4: Parvalbumin-positive inhibitory interneurons are sparsely distributed in high density hippocampal cultures. Supplementary Figure 5: IPSCs evoked in response to paired pulse stimulation (P2/P1) showed a significant increase indicating the reduced release probability of synapses expressing VAMP4. Supplementary Figure 6: Knockdown of VAMP4 in hippocampal neurons using two lentiviral short hairpin RNA constructs Supplementary Figure 7: Prominent surface expression of VAMP4 equals the size of the cytoplasmic VAMP4 pool. Supplementary Figure 8: The VAMP4 L25A mutant forms stable SNARE complexes with syntaxin1 and SNAP-25. Supplementary Figure 9: VAMP4 L25A mutant maintains evoked neurotransmission when expressed on the background of syb2-deficient neurons. Supplementary Figure 10: The model of syb2- and VAMP4-driven synaptic transmission. 1

2 Supplementary Figure 1: Limited co-localization of VAMP4 staining with Parvalbumin positive terminals at the stratum pyramidale. Immunofluorescence labeling for VAMP4 (green) and PV (red) in the CA1 area of the hippocampus. Colocalization occurs in the soma of PV-positive interneurons (upper row, arrow), but not in presynaptic terminals (s.p. stratum pyramidale, upper row; lower row) where PV-positive terminals surrounding somas of pyramidal cells are VAMP4-negative. However, it is difficult to exclude some low level of co-localization, as pyramidal cell soma staining for VAMP4 dominates at the stratum pyramidale. Scale bar: 15 µm 2

3 Supplementary Figure 2: Wide-spread distribution of syb2 in synaptic terminals in the stratum radiatum of the CA1 area. Electron micrographs showing immunoreactivity for syb2 in the str. radiatum of the CA1 area. Large panel on the left: Several presynaptic terminals are showing positive syb2-staining, dark staining is the result of the immunoperoxidase reaction, two presynaptic terminals are shown with higher magnification on the right. Bottom right panel: Immunogold labeling for syb2 of a presynaptic terminal in the str. radiatum of the CA1 area. Scale bars: 1 µm 3

4 Supplementary Figure 3: Endogenous VAMP4 is present in synapses formed in culture. Neurons were processed for immunocytochemistry using a tyramide signal amplification system for synaptophysin I (synaptic marker) and VAMP4. White arrowheads indicate synaptic puncta colocalized with VAMP4 immunoreactivity. Scale bar is 10 µm. 4

5 Supplementary Figure 4: Parvalbumin-positive inhibitory interneurons are sparsely distributed in high density hippocampal cultures. Neurons were processed for immunocytochemistry for synapsin (synaptic marker) and parvalbumin. Scale bar is 40 µm. 5

6 Supplementary Figure 5: IPSCs evoked in response to paired pulse stimulation (P2/P1) showed a significant increase indicating the reduced release probability of synapses expressing VAMP4. Representative traces (left) and paired pulse ratios (right) of IPSCs evoked in response to two stimuli separate by a 100 ms interpulse interval in syb2 deficient neurons infected with VAMP4 (n=31) or syb2 (n=35) (data from the same cells as in Fig. 1a). Bars represent mean ± standard error of the mean (s.e.m.) and "*" denotes statistical significance between the groups assessed by one-way ANOVA-Fisher test at p<

7 Supplementary Figure 6: Knockdown of VAMP4 in hippocampal neurons using two lentiviral short hairpin RNA constructs (A) Bar graph depicts the reduction in mrna levels (quantified with Q-PCR) after infection with VAMP4 knockdown constructs KD1 and KD2. (B) Reduction in VAMP4 protein is also detectable as a decrease in VAMP4 immunofluorescence in infected neurons stained with VAMP4 and synapsin antibodies. 7

8 Supplementary Figure 7: Prominent surface expression of VAMP4 equals the size of the cytoplasmic VAMP4 pool. In this experiment we modified the external and internal ph values to assess the localization of VAMP4. Bath application of an acidified (ph 4) solution onto cultured neurons infected with VAMP4 lentivirus caused a decrease in fluorescence consistent with quenching of phluorin fluorescence at the membrane surface. The figure shows averaged time courses (n= 58 boutons; VAMP4) in control conditions (ph7.2) and in presence of acidic external solution (ph 4). After wash-out of the acidic solution, we applied 50 mm NH 4 Cl containing extracellular solution. In this case, VAMP4 showed increased fluorescence (nearly equal to the surface fraction) consistent with alkalinization of internal organelles containing this protein. 8

9 Supplementary Figure 8: The VAMP4 L25A mutant forms stable SNARE complexes with syntaxin1 and SNAP-25. (A) VAMP4 L25A and VAMP4 ΔN (The N-terminal sequence of VAMP4 prior to SNARE motif is deleted) forms stable SDS-resistant complex with Syntaxin 1 and SNAP-25 similar to syb2 or wild type VAMP4 (Fig. 3). Experiments were performed as described in Fig. 5a. (B) VAMP4 L25A and VAMP4 ΔN containing SNARE complexes do not engage with complexins 1&2 or synaptotagmin 1. Experiments were performed as described in Fig. 5c. 9

10 Supplementary Figure 9: VAMP4 L25A mutant maintains evoked neurotransmission when expressed on the background of syb2-deficient neurons. Representative traces (left) and average cumulative charge transfer values (right) of IPSCs recorded in syb2 deficient neurons infected with VAMP4 L25A (n=8 cells) and VAMP4 (n=31 cells). IPSCs were evoked by 50 APs applied at 10 Hz. Data represent means ± s.e.m. (no statistically significant difference between the groups as measured by two tailed t-test). 10

11 Supplementary Figure 10: The model of syb2- and VAMP4-driven synaptic transmission. Presynaptic terminals contain syb2-enriched vesicles (green) that mainly drive synchronous release and VAMP4-enriched vesicles that selectively support asynchronous release (red). Stimulation-dependent trafficking of VAMP4 suggests that activity could shift the proportion of vesicles enriched in VAMP4 and modulate the kinetics of neurotransmitter release. 11

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn. Supplementary Figure 1 SybII and Ceb are sorted to distinct vesicle populations in astrocytes. (a) Exemplary images for cultured astrocytes co-immunolabeled with SybII and Ceb antibodies. SybII accumulates

More information


SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV

More information

Autonomous Function of Synaptotagmin 1 in Triggering Synchronous Release Independent of Asynchronous Release

Autonomous Function of Synaptotagmin 1 in Triggering Synchronous Release Independent of Asynchronous Release Neuron, Vol. 48, 547 554, November 23, 2005, Copyright ª2005 by Elsevier Inc. DOI 10.1016/j.neuron.2005.09.006 Autonomous Function of Synaptotagmin 1 in Triggering Synchronous Release Independent of Asynchronous

More information

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons Neuron, Volume 96 Supplemental Information Ca V 2.2 Gates Calcium-Independent but Voltage-Dependent Secretion in Mammalian Sensory Neurons Zuying Chai, Changhe Wang, Rong Huang, Yuan Wang, Xiaoyu Zhang,

More information


THE SYNAPTIC VESICLE CYCLE Annu. Rev. Neurosci. 2004. 27:509 47 doi: 10.1146/annurev.neuro.26.041002.131412 Copyright c 2004 by Annual Reviews. All rights reserved First published online as a Review in Advance on March 12, 2004

More information

1) Drop off in the Bi 150 box outside Baxter 331 or to the head TA (jcolas).

1) Drop off in the Bi 150 box outside Baxter 331 or  to the head TA (jcolas). Bi/CNS/NB 150 Problem Set 3 Due: Tuesday, Oct. 27, at 4:30 pm Instructions: 1) Drop off in the Bi 150 box outside Baxter 331 or e-mail to the head TA (jcolas). 2) Submit with this cover page. 3) Use a

More information

Increased Expression of a-synuclein Reduces Neurotransmitter Release by Inhibiting Synaptic Vesicle Reclustering after Endocytosis

Increased Expression of a-synuclein Reduces Neurotransmitter Release by Inhibiting Synaptic Vesicle Reclustering after Endocytosis Article Increased Expression of a-synuclein Reduces Neurotransmitter Release by Inhibiting Synaptic Vesicle Reclustering after Endocytosis Venu M. Nemani, 1 Wei Lu, 2 Victoria Berge, 3 Ken Nakamura, 1

More information

Desynchronization of Neocortical Networks by Asynchronous Release of GABA at Autaptic and Synaptic Contacts from Fast-Spiking Interneurons

Desynchronization of Neocortical Networks by Asynchronous Release of GABA at Autaptic and Synaptic Contacts from Fast-Spiking Interneurons Desynchronization of Neocortical Networks by Asynchronous Release of GABA at Autaptic and Synaptic Contacts from Fast-Spiking Interneurons Frédéric Manseau 1, Silvia Marinelli 1, Pablo Méndez 1, Beat Schwaller

More information

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative

More information

Supporting Online Material for

Supporting Online Material for Supporting Online Material for Astrocytes Potentiate Transmitter Release at Single Hippocampal Synapses Gertrudis Perea and Alfonso Araque* *To whom

More information

Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu

Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu Distinct contributions of Na v 1.6 and Na v 1.2 in action potential initiation and backpropagation Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu Supplementary figure and legend Supplementary

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Salamanca Study Abroad Program: Neurobiology of Hearing

Salamanca Study Abroad Program: Neurobiology of Hearing Salamanca Study Abroad Program: Neurobiology of Hearing Synaptics and the auditory nerve R. Keith Duncan University of Michigan Review Resources Reviews: Safieddine et al., 2012, The

More information



More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Bioscience in the 21st century

Bioscience in the 21st century Bioscience in the 21st century Neurons, Synapses, and Signaling Dr. Michael Burger Outline: 1. Why neuroscience? 2. The neuron 3. Action potentials 4. Synapses 5. Organization of the nervous system 6.

More information

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,

More information

Modelling Vesicular Release at Hippocampal Synapses

Modelling Vesicular Release at Hippocampal Synapses Modelling Vesicular Release at Hippocampal Synapses Suhita Nadkarni 1,2., Thomas M. Bartol 1,2., Terrence J. Sejnowski 1,2,3 *, Herbert Levine 1 1 Center for Theoretical Biological Physics, University

More information


SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo. Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from

More information

Vesicular Trafficking of Semaphorin 3A is Activity- Dependent and Differs Between Axons and Dendrites

Vesicular Trafficking of Semaphorin 3A is Activity- Dependent and Differs Between Axons and Dendrites Traffic 6; 7: 6 77 Blackwell Munksgaard Copyright # Blackwell Munksgaard 6 doi:./j.6-854.6.44.x Vesicular Trafficking of Semaphorin A is Activity- Dependent and Differs Between Axons and Dendrites Joris

More information

Modeling Excitatory and Inhibitory Chemical Synapses

Modeling Excitatory and Inhibitory Chemical Synapses In review, a synapse is the place where signals are transmitted from a neuron, the presynaptic neuron, to another cell. This second cell may be another neuron, muscle cell or glandular cell. If the second

More information

Synaptic Transmission: Ionic and Metabotropic

Synaptic Transmission: Ionic and Metabotropic Synaptic Transmission: Ionic and Metabotropic D. Purves et al. Neuroscience (Sinauer Assoc.) Chapters 5, 6, 7. C. Koch. Biophysics of Computation (Oxford) Chapter 4. J.G. Nicholls et al. From Neuron to

More information

Neurons, Synapses, and Signaling

Neurons, Synapses, and Signaling Chapter 48 Neurons, Synapses, and Signaling PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

El Azzouzi et al., http :// /cgi /content /full /jcb /DC1

El Azzouzi et al., http :// /cgi /content /full /jcb /DC1 Supplemental material JCB El Azzouzi et al., http :// /cgi /content /full /jcb.201510043 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Acquisition of -phluorin correlates negatively with podosome

More information

Wnt Signaling Mediates Experience-Related Regulation of Synapse Numbers and Mossy Fiber Connectivities in the Adult Hippocampus

Wnt Signaling Mediates Experience-Related Regulation of Synapse Numbers and Mossy Fiber Connectivities in the Adult Hippocampus Article Wnt Signaling Mediates Experience-Related Regulation of Synapse Numbers and Mossy Fiber Connectivities in the Adult Hippocampus Nadine Gogolla, 1,2 Ivan Galimberti, 1 Yuichi Deguchi, 1 and Pico

More information

The 7 th lecture. Anatomy and Physiology For the. 1 st Class. By Dr. Ala a Hassan Mirza

The 7 th lecture. Anatomy and Physiology For the. 1 st Class. By Dr. Ala a Hassan Mirza The 7 th lecture In Anatomy and Physiology For the 1 st Class By Dr. Ala a Hassan Mirza Nervous System (part I) The Nerve Tissue and the Nervous System The Tissues of the Body There are 4 types of tissues

More information

The Nervous System. Dr. ZHANG Xiong Dept. of Physiology ZJU School of Medicine.

The Nervous System. Dr. ZHANG Xiong Dept. of Physiology ZJU School of Medicine. The Nervous System Dr. ZHANG Xiong Dept. of Physiology ZJU School of Medicine Http:// Part 1. Summary of the nervous system The Nervous System Central Nervous System Brain + Spinal Cord Peripheral

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-11-1-0356 TITLE: New Treatments for Drug-Resistant Epilepsy that Target Presynaptic Transmitter Release PRINCIPAL INVESTIGATOR: Emilio R. Garrido Sanabria, MD, PhD CONTRACTING ORGANIZATION:

More information

35-2 The Nervous System Slide 1 of 38

35-2 The Nervous System Slide 1 of 38 1 of 38 35-2 The Nervous System The nervous system controls and coordinates functions throughout the body and responds to internal and external stimuli. 2 of 38 Neurons Neurons The messages carried by

More information

Supplemental Information. Memory-Relevant Mushroom Body. Output Synapses Are Cholinergic

Supplemental Information. Memory-Relevant Mushroom Body. Output Synapses Are Cholinergic Neuron, Volume 89 Supplemental Information Memory-Relevant Mushroom Body Output Synapses Are Cholinergic Oliver Barnstedt, David Owald, Johannes Felsenberg, Ruth Brain, John-Paul Moszynski, Clifford B.

More information

Alterations in Synaptic Strength Preceding Axon Withdrawal

Alterations in Synaptic Strength Preceding Axon Withdrawal Alterations in Synaptic Strength Preceding Axon Withdrawal H. Colman, J. Nabekura, J.W. Lichtman presented by Ana Fiallos Synaptic Transmission at the Neuromuscular Junction Motor neurons with cell bodies

More information

Portions from Chapter 6 CHAPTER 7. The Nervous System: Neurons and Synapses. Chapter 7 Outline. and Supporting Cells

Portions from Chapter 6 CHAPTER 7. The Nervous System: Neurons and Synapses. Chapter 7 Outline. and Supporting Cells CHAPTER 7 The Nervous System: Neurons and Synapses Chapter 7 Outline Neurons and Supporting Cells Activity in Axons The Synapse Acetylcholine as a Neurotransmitter Monoamines as Neurotransmitters Other

More information

Chapter 4: The Cytology of Neurons

Chapter 4: The Cytology of Neurons Chapter 4: The Cytology of Neurons Principles of Neural Science by Eric R. Kandel Fundamental Neuroscience by Duane E. Haines The World of the Cell by Wayne M. Becker (Ding-I Yang) 851 7386 An Overall

More information

Concept 48.1 Neuron organization and structure reflect function in information transfer

Concept 48.1 Neuron organization and structure reflect function in information transfer Name Chapter 48: Neurons, Synapses, and Signaling Period Chapter 48: Neurons, Synapses, and Signaling Concept 48.1 Neuron organization and structure reflect function in information transfer 1. What is

More information

Scuola di Neuroscienze Università degli Studi di Torino

Scuola di Neuroscienze Università degli Studi di Torino Scuola di Neuroscienze Università degli Studi di Torino Corso di Dottorato Torino, 7 Settembre 2006 Canali del calcio presinaptici: distribuzione e neurotrasmissione Presynaptic Ca 2+ channels: types and

More information

DPP6 Establishes the A-Type K + Current Gradient Critical for the Regulation of Dendritic Excitability in CA1 Hippocampal Neurons

DPP6 Establishes the A-Type K + Current Gradient Critical for the Regulation of Dendritic Excitability in CA1 Hippocampal Neurons Article DPP6 Establishes the A-Type K + Current Gradient Critical for the Regulation of Dendritic Excitability in CA1 Hippocampal Neurons Wei Sun, 1,2 Jon K. Maffie, 3 Lin Lin, 1 Ronald S. Petralia, 4

More information

Human Anatomy and Physiology - Problem Drill 11: Neural Tissue & The Nervous System

Human Anatomy and Physiology - Problem Drill 11: Neural Tissue & The Nervous System Human Anatomy and Physiology - Problem Drill 11: Neural Tissue & The Nervous System Question No. 1 of 10 The human body contains different types of tissue. The tissue is formed into organs and organ systems.

More information


CORTICAL INHIBITORY NEURONS AND SCHIZOPHRENIA CORTICAL INHIBITORY NEURONS AND SCHIZOPHRENIA David A. Lewis*,Takanori Hashimoto* and David W. Volk* Abstract Impairments in certain cognitive functions, such as working memory, are core features of schizophrenia.

More information

Social transmission and buffering of synaptic changes after stress

Social transmission and buffering of synaptic changes after stress SUPPLEMENTARY INFORMATION Articles In the format provided by the authors and unedited. Social transmission and buffering of synaptic changes after stress Toni-Lee

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Na + K + pump. The beauty of the Na + K + pump. Cotransport. The setup Cotransport the result. Found along the plasma membrane of all cells.

Na + K + pump. The beauty of the Na + K + pump. Cotransport. The setup Cotransport the result. Found along the plasma membrane of all cells. The beauty of the Na + K + pump Na + K + pump Found along the plasma membrane of all cells. Establishes gradients, controls osmotic effects, allows for cotransport Nerve cells have a Na + K + pump and

More information

Outline. Animals: Nervous system. Neuron and connection of neurons. Key Concepts:

Outline. Animals: Nervous system. Neuron and connection of neurons. Key Concepts: Animals: Nervous system Neuron and connection of neurons Outline 1. Key concepts 2. An Overview and Evolution 3. Human Nervous System 4. The Neurons 5. The Electrical Signals 6. Communication between Neurons

More information

10.1: Introduction. Cell types in neural tissue: Neurons Neuroglial cells (also known as neuroglia, glia, and glial cells) Dendrites.

10.1: Introduction. Cell types in neural tissue: Neurons Neuroglial cells (also known as neuroglia, glia, and glial cells) Dendrites. 10.1: Introduction Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Cell types in neural tissue: Neurons Neuroglial cells (also known as neuroglia, glia, and glial

More information

Computational cognitive neuroscience: 2. Neuron. Lubica Beňušková Centre for Cognitive Science, FMFI Comenius University in Bratislava

Computational cognitive neuroscience: 2. Neuron. Lubica Beňušková Centre for Cognitive Science, FMFI Comenius University in Bratislava 1 Computational cognitive neuroscience: 2. Neuron Lubica Beňušková Centre for Cognitive Science, FMFI Comenius University in Bratislava 2 Neurons communicate via electric signals In neurons it is important

More information

Synaptic communication

Synaptic communication Synaptic communication Objectives: after these lectures you should be able to: - explain the differences between an electrical and chemical synapse - describe the steps involved in synaptic communication

More information

Version A. AP* Biology: Nervous System. Questions 1 and 2. Name: Period

Version A. AP* Biology: Nervous System. Questions 1 and 2. Name: Period Name: Period Version A AP* Biology: Nervous System Directions: Each of the questions or incomplete statements below is followed by four suggested answers or completions. Select the one that is best in

More information


SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2294 Figure S1 Localization and function of cell wall polysaccharides in root hair cells. (a) Spinning-disk confocal sections of seven day-old A. thaliana seedlings stained with 0.1% S4B

More information

Axon Initial Segment Kv1 Channels Control Axonal Action Potential Waveform and Synaptic Efficacy

Axon Initial Segment Kv1 Channels Control Axonal Action Potential Waveform and Synaptic Efficacy Article Axon Initial Segment Kv1 Channels Control Axonal Action Potential Waveform and Synaptic Efficacy Maarten H.P. Kole, 1,2 Johannes J. Letzkus, 1,2 and Greg J. Stuart 1, * 1 Division of Neuroscience,

More information

The Nervous System & Nervous tissue. Dr. Ali Ebneshahidi

The Nervous System & Nervous tissue. Dr. Ali Ebneshahidi The Nervous System & Nervous tissue Dr. Ali Ebneshahidi Functions of the Nervous System 1. Nervous system and endocrine system are the chief control centers in maintaining body homeostasis. 2. Nervous

More information

Long-Term, Selective Gene Expression in Developing and Adult Hippocampal Pyramidal Neurons Using Focal In Utero Electroporation

Long-Term, Selective Gene Expression in Developing and Adult Hippocampal Pyramidal Neurons Using Focal In Utero Electroporation The Journal of Neuroscience, May 9, 2007 27(19):5007 5011 5007 Toolbox Editor s Note: Toolboxes are intended to briefly highlight a new method or a resource of general use in neuroscience or to critically

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information


SUPPLEMENTARY INFORMATION doi:1.138/nature9553 Supplementary Table 1. Overlap of neuronal marker and PKC- expression in CEl. Marker/PKC- PKC- Marker Gad65 87.4±4.7 5.3±12.6 CRH 1.2±1. 16.9±15.2 Dyn 1.9±1.2 4.5±2.9 Enk 42.8±7.4

More information

Nervous system function Central and peripheral nervous system. Myelinated neurons Nerve signal transmission Nerve Synapse

Nervous system function Central and peripheral nervous system. Myelinated neurons Nerve signal transmission Nerve Synapse Outline Nervous System - Neurons Biol 105 Lecture Packet 9 Chapter 7 I. II. III. IV. V. VI. Nervous system function Central and peripheral nervous system Nervous system cells Myelinated neurons Nerve signal

More information


SLX4 + MUS81 SLX4 + GEN1 SLX4 CONTROL SLX4 GEN MUS8 GEN MUS8 GEN MUS8 GEN MUS8 GEN C LM MUS8 XPF (loading control) D H2AX Frequency of -positive bridges (% of anaphase cells) 6 4 2 p =.8 x -4 GM855 p =.27 PSNF5 E H2AX Figure S. Analysis of anaphase

More information

Dissecting the phenotypes of Dravet syndrome by gene deletion

Dissecting the phenotypes of Dravet syndrome by gene deletion doi:10.1093/brain/awv142 BRAIN 2015: 138; 2219 2233 2219 Dissecting the phenotypes of Dravet syndrome by gene deletion Moran Rubinstein, Sung Han, Chao Tai, Ruth E. Westenbroek, Avery Hunker, Todd Scheuer

More information

Spiking Inputs to a Winner-take-all Network

Spiking Inputs to a Winner-take-all Network Spiking Inputs to a Winner-take-all Network Matthias Oster and Shih-Chii Liu Institute of Neuroinformatics University of Zurich and ETH Zurich Winterthurerstrasse 9 CH-857 Zurich, Switzerland {mao,shih}

More information

Excitatory/Inhibitory Synaptic Imbalance Leads to Hippocampal Hyperexcitability in Mouse Models of Tuberous Sclerosis

Excitatory/Inhibitory Synaptic Imbalance Leads to Hippocampal Hyperexcitability in Mouse Models of Tuberous Sclerosis Article Excitatory/Inhibitory Synaptic Imbalance Leads to Hippocampal Hyperexcitability in Mouse Models of Tuberous Sclerosis Helen S. Bateup, Caroline A. Johnson, Cassandra L. Denefrio, Jessica L. Saulnier,

More information

2Lesson. Outline 3.2. Lesson Plan. The OVERVIEW. Lesson 3.2: How do our neurons communicate with each other? LESSON. Unit1.2

2Lesson. Outline 3.2. Lesson Plan. The OVERVIEW. Lesson 3.2: How do our neurons communicate with each other? LESSON. Unit1.2 Outline OVERVIEW Rationale: This lesson is intended to introduce students to the process of synaptic transmission, which is how one neuron communicates with another neuron. Using the pain pathway as a

More information

Supplementary Figure 1. Flies form water-reward memory only in the thirsty state

Supplementary Figure 1. Flies form water-reward memory only in the thirsty state 1 2 3 4 5 6 7 Supplementary Figure 1. Flies form water-reward memory only in the thirsty state Thirsty but not sated wild-type flies form robust 3 min memory. For the thirsty group, the flies were water-deprived

More information

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment

More information

6.5 Nerves, Hormones and Homeostasis

6.5 Nerves, Hormones and Homeostasis 6.5 Nerves, Hormones and Homeostasis IB Biology SL Part 1 - Nerves Outcomes Part 1 6.5.1State that the nervous system consists of the central nervous system (CNS) and peripheral nerves, and is composed

More information


DUAL INTRACELLULAR RECORDINGS AND COMPUTATIONAL MODELS OF SLOW INHIBITORY POSTSYNAPTIC POTENTIALS IN RAT NEOCORTICAL AND HIPPOCAMPAL SLICES Pergamon Neuroscience Vol. 92, No. 4, pp. 1193 1215, 1999 Copyright 1999 IBRO. Published by Elsevier Science Ltd Printed in Great Britain. All rights reserved PII: S0306-4522(99)00021-4 0306-4522/99 $20.00+0.00

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information

Evaluating the Effect of Spiking Network Parameters on Polychronization

Evaluating the Effect of Spiking Network Parameters on Polychronization Evaluating the Effect of Spiking Network Parameters on Polychronization Panagiotis Ioannou, Matthew Casey and André Grüning Department of Computing, University of Surrey, Guildford, Surrey, GU2 7XH, UK

More information

Parallel Driving and Modulatory Pathways Link the Prefrontal Cortex and Thalamus

Parallel Driving and Modulatory Pathways Link the Prefrontal Cortex and Thalamus Boston University OpenBU Health Sciences SAR: Health Sciences: Scholarly Papers 2007-9-5 Parallel Driving and Modulatory Pathways Link the Prefrontal Cortex and Thalamus Zikopoulos,

More information

GABA from reactive astrocytes impairs memory in mouse models of Alzheimer disease

GABA from reactive astrocytes impairs memory in mouse models of Alzheimer disease SUPPLEMENTARY INFORMATION from reactive astrocytes impairs memory in mouse models of Alzheimer disease Seonmi Jo *, Oleg Yarishkin *, Yu Jin Hwang, Ye Eun Chun, Mijeong Park, Dong Ho Woo, Jin Young Bae,

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

LESSON 3.3 WORKBOOK. Why does applying pressure relieve pain? Workbook. Postsynaptic potentials

LESSON 3.3 WORKBOOK. Why does applying pressure relieve pain? Workbook. Postsynaptic potentials Depolarize to decrease the resting membrane potential. Decreasing membrane potential means that the membrane potential is becoming more positive. Excitatory postsynaptic potentials (EPSP) graded postsynaptic

More information

Overview of Neurons. Psychology 470. Introduction to Chemical Additions. Neurons2. Axons and Related Structures. Structures

Overview of Neurons. Psychology 470. Introduction to Chemical Additions. Neurons2. Axons and Related Structures. Structures Soma Collateral Overview of Neurons Psychology 470 Axon Hillock Teleodendria Introduction to Chemical Additions Steven E. Meier, Ph.D. Node of Ranvier Listen to the audio lecture while viewing these slides

More information

Section: Chapter 5: Multiple Choice. 1. The structure of synapses is best viewed with a(n):

Section: Chapter 5: Multiple Choice. 1. The structure of synapses is best viewed with a(n): Section: Chapter 5: Multiple Choice 1. The structure of synapses is best viewed with a(n): p.155 electron microscope. light microscope. confocal microscope. nissle-stained microscopic procedure. 2. Electron

More information

Perisynaptic Location of Metabot ropic GI utamate Receptors mglur1 and mglur5 on Dendrites and Dendritic Spines in the Rat Hippocampus

Perisynaptic Location of Metabot ropic GI utamate Receptors mglur1 and mglur5 on Dendrites and Dendritic Spines in the Rat Hippocampus European Journal of Neuroscience, Vol. 8, pp. 1488-1500, 1996 0 European Neuroscience Association Perisynaptic Location of Metabot ropic GI utamate Receptors mglur1 and mglur5 on Dendrites and Dendritic

More information

Supporting Online Material for

Supporting Online Material for Supporting Online Material for Action-Potential Modulation During Axonal Conduction Takuya Sasaki, Norio Matsuki, Yuji Ikegaya* *To whom correspondence

More information

antagonists on hippocampal long-term potentiation

antagonists on hippocampal long-term potentiation Research Opposing actions of chronic 9 -tetrahydrocannabinol and cannabinoid antagonists on hippocampal long-term potentiation Alexander F. Hoffman, 1 Murat Oz, 1 Ruiqin Yang, 2 Aron H. Lichtman, 2 and

More information

Recurrent excitatory postsynaptic potentials induced by synchronized fast cortical oscillations

Recurrent excitatory postsynaptic potentials induced by synchronized fast cortical oscillations Proc. Natl. Acad. Sci. USA Vol. 94, pp. 12198 12203, October 1997 Neurobiology Recurrent excitatory postsynaptic potentials induced by synchronized fast cortical oscillations (neuronal network 40 Hz synaptic

More information

a b c Supplementary Figure 1 R Shrm4 0 -/- -/- GABA B1b Wild type GABA B1a GABA B1a -GABA B1b mean intensity (a.u) Ponceau GABA B

a b c Supplementary Figure 1 R Shrm4 0 -/- -/- GABA B1b Wild type GABA B1a GABA B1a -GABA B1b mean intensity (a.u) Ponceau GABA B a b c 200 - H S1 P1 S2 P2 SYN TIF PSD Shrm4 95 - PSD95 34 - Synaptophysin 120-100 - Wil type GABA B1a -/- GABA B1b -/- -GABA B1a -GABA B1b e f 5 μm 10 μm 20 μm 100 - GABA B1a 600 400 200 Ponceau GABA B

More information

Biology 201-Worksheet on Nervous System (Answers are in your power point outlines-there is no key!)

Biology 201-Worksheet on Nervous System (Answers are in your power point outlines-there is no key!) Bio 201 Tissues and Skin 1 March 21, 2011 Biology 201-Worksheet on Nervous System (Answers are in your power point outlines-there is no key!) 1. The study of the normal functioning and disorders of the

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

Linking Neuronal Ensembles by Associative Synaptic Plasticity

Linking Neuronal Ensembles by Associative Synaptic Plasticity Linking Neuronal Ensembles by Associative Synaptic Plasticity Qi Yuan 1,2, Jeffry S. Isaacson 2, Massimo Scanziani 1,2,3 * 1 Department of Neurobiology, Center for Neural Circuits and Behavior, University

More information

Nervous System Review

Nervous System Review Nervous System Review Name: Block: 1. Which processes are involved in the movement of molecule Y from point X to point Z? A. exocytosis and diffusion B. endocytosis and diffusion C. exocytosis and facilitated

More information

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

Karen L.P. McNally, Amy S. Fabritius, Marina L. Ellefson, Jonathan R. Flynn, Jennifer A. Milan, and Francis J. McNally

Karen L.P. McNally, Amy S. Fabritius, Marina L. Ellefson, Jonathan R. Flynn, Jennifer A. Milan, and Francis J. McNally Developmental Cell, Volume 22 Supplemental Information Kinesin-1 Prevents Capture of the Oocyte Meiotic Spindle by the Sperm Aster Karen L.P. McNally, Amy S. Fabritius, Marina L. Ellefson, Jonathan R.

More information

Ionotropic glutamate receptors (iglurs)

Ionotropic glutamate receptors (iglurs) Ionotropic glutamate receptors (iglurs) GluA1 GluA2 GluA3 GluA4 GluN1 GluN2A GluN2B GluN2C GluN2D GluN3A GluN3B GluK1 GluK2 GluK3 GluK4 GluK5 The general architecture of receptor subunits Unique properties

More information

Synaptotagmin-2 Is a Reliable Marker for Parvalbumin Positive Inhibitory Boutons in the Mouse Visual Cortex

Synaptotagmin-2 Is a Reliable Marker for Parvalbumin Positive Inhibitory Boutons in the Mouse Visual Cortex Synaptotagmin-2 Is a Reliable Marker for Parvalbumin Positive Inhibitory Boutons in the Mouse Visual Cortex Jean-Pierre Sommeijer, Christiaan N. Levelt* Department of Molecular Visual Neuroscience, Netherlands

More information

Compensatory Contribution of Ca V. 2.3 Channels to Acetylcholine Release at the Neuromuscular Junction of Tottering Mice

Compensatory Contribution of Ca V. 2.3 Channels to Acetylcholine Release at the Neuromuscular Junction of Tottering Mice 5 Compensatory Contribution of 2.3 Channels to Acetylcholine Release at the Neuromuscular Junction of Tottering Mice Simon Kaja, 1,2 Rob C.G. van de Ven, 3 Michel D. Ferrari, 1 Rune R. Frants, 3 Arn M.J.M.

More information

Expression of the transient receptor potential channels TRPV1, TRPA1 and TRPM8 in mouse trigeminal primary afferent neurons innervating the dura

Expression of the transient receptor potential channels TRPV1, TRPA1 and TRPM8 in mouse trigeminal primary afferent neurons innervating the dura Washington University School of Medicine Digital Commons@Becker Open Access Publications 212 Expression of the transient receptor potential channels TRPV1, TRPA1 and TRPM8 in mouse trigeminal primary afferent

More information


BIOLOGY 2050 LECTURE NOTES ANATOMY & PHYSIOLOGY I (A. IMHOLTZ) FUNDAMENTALS OF THE NERVOUS SYSTEM AND NERVOUS TISSUE P1 OF 5 P1 OF 5 The nervous system controls/coordinates the activities of cells, tissues, & organs. The endocrine system also plays a role in control/coordination. The nervous system is more dominant. Its mechanisms

More information

Reduced Neuromuscular Quantal Content With Normal Synaptic Release Time Course and Depression in Canine Motor Neuron Disease

Reduced Neuromuscular Quantal Content With Normal Synaptic Release Time Course and Depression in Canine Motor Neuron Disease J Neurophysiol 88: 3305 3314, 2002; 10.1152/jn.00271.2002. Reduced Neuromuscular Quantal Content With Normal Synaptic Release Time Course and Depression in Canine Motor Neuron Disease MARK M. RICH, 1,2

More information

Supplemental Information. Caldendrin Directly Couples. Postsynaptic Calcium Signals. to Actin Remodeling in Dendritic Spines

Supplemental Information. Caldendrin Directly Couples. Postsynaptic Calcium Signals. to Actin Remodeling in Dendritic Spines Neuron, Volume 97 Supplemental Information Caldendrin Directly Couples Postsynaptic Calcium Signals to Actin Remodeling in Dendritic Spines Marina Mikhaylova, Julia Bär, Bas van Bommel, Philipp Schätzle,

More information

Nature Biotechnology: doi: /nbt.3828

Nature Biotechnology: doi: /nbt.3828 Supplementary Figure 1 Development of a FRET-based MCS. (a) Linker and MA2 modification are indicated by single letter amino acid code. indicates deletion of amino acids and N or C indicate the terminus

More information



More information


VISUAL CORTICAL PLASTICITY VISUAL CORTICAL PLASTICITY OCULAR DOMINANCE AND OTHER VARIETIES REVIEW OF HIPPOCAMPAL LTP 1 when an axon of cell A is near enough to excite a cell B and repeatedly and consistently takes part in firing

More information

Neurotransmitter release at ribbon synapses in the retina

Neurotransmitter release at ribbon synapses in the retina Immunology and Cell Biology (2000) 78, 442 446 Curtin Conference Neurotransmitter release at ribbon synapses in the retina CATHERINE W MORGANS Synaptic Biochemistry Group, Division of Neuroscience, John

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Analysis of State-Dependent Transitions in Frequency and Long-Distance Coordination in a Model Oscillatory Cortical Circuit

Analysis of State-Dependent Transitions in Frequency and Long-Distance Coordination in a Model Oscillatory Cortical Circuit Journal of Computational Neuroscience 15, 283 298, 2003 c 2003 Kluwer Academic Publishers. Manufactured in The Netherlands. Analysis of State-Dependent Transitions in Frequency and Long-Distance Coordination

More information