(Paludism) .(and Gilles (Plasmodium). (Anopheles) . Nested-PCR. Downloaded from sjsph.tums.ac.ir at 12:13 IRST on Monday March 11th 2019

Size: px

Start display at page:

Download "(Paludism) .(and Gilles (Plasmodium). (Anopheles) . Nested-PCR. Downloaded from sjsph.tums.ac.ir at 12:13 IRST on Monday March 11th 2019"

Cordelia Jackson
5 years ago
Views:

1 : : : - : nateghpourm@sina.tums.ac.ir : : : : 1394/2/22 : 1393/7/30 : : :. (PCR) RDTs. RDTs. 600 :. Nested-PCR :. : 1570). Wareel ) (.(and Gilles (Paludism) (Plasmodium). (Anopheles)

2 / ). ( ). (.. ( ) Rapid Polymerase Chain Diagnostic Tests(RDTs). Reaction (PCR) EDTA PCR %90 5 %85.(WHO 2007).(Faghia 1969) (EMRO)..(Saebi et al. 2007). ) ( ( ) (Nateghpour et al. 2011)....( Manouchehri et al. 1990)

3 97 /... Parasite Lactate Dehydrogenase (PLDH) (Pf HRPII) P.falciparum Histidine Rich Protein II... RDTs PCR DNA. NESTED - PCR DNA. PCR DNA PCR Primer F & R: KCl: 150 Turky et al. FV: 50 mm MgCl2: 2Mm 10pmol/µl. tag: 0/4Unit 10Mm Tris: ).( 2012 F: TTAAAATTGTTGCAGTTAAAACG R: CCTGTTGTTGCCTTAAACTTC CGCTTCTAGCTTAATCCACATAACTG ATAC ACTTCCAAGCCGAAGCAAAGAAAGT FF: RV: CCTTA TTAAACTGGTTTGGGAAAACCAAATA RF: TATT ACACAATGAACTCAATCATGACTACC CGTC WHO (Malaria microscopy). RDTs Premier Medical Corporation Ltd, Mumbai, India RDT 25...

4 /98..(Rodrigues et al. 2006).... RDTs Nested PCR Suarez-Mutis et al. 2007; Rodrigues et al.).( PCR. 25µl. : Nested- 1 DNA PCR. PCR %39. % (1 ) : :PCR RDTs Nested-PCR RDTs

5 99 /... ) ( Fernando 3730 Fernando ).(et al Osorio..(Osorio et al. 2004) 2002 Joseph. (Joseph and Robert 2002) 2006 Eke Aba.(Eke et al. 2006) 2007 Mohanna Hajr ( 6-11) 469 %12/8.(Mohanna et al. 2007) 2010 Steresman RT- Nested PCR RDT ( ) (Turki et al. 2012) %0/6 %1/6 :....( Nateghpour et al. 2011) :

6 / PCR..(Stresman et al. 2010) Alves %23/8 PCR 175 Alves et al.).( PCR %2/9 %4/2 %14/2 %17/6 PCR PCR.(Roshanravan et al. 2003) Nested RDT PCR

7 101 / / / / / >40 P. vivax 6 4 LADDER 5 NESTED-PCR P. falciparum

8 /102 References Warrel, DA. and Gilles, HM., Essential malariology. Fourth edition London: Arnold publisher. WHO., World Health Organization.The world health report 2007: a safer future: global public health security in the 21st century pdf Faghih, M., Malarialogy and Malaria Eradication. Tehran University Press [In Persian]. Saebi, E., Ranjbar, M., Nabavi, M., Raeisi, A., Shahbazi, A. and Shoghli, A., Malaria treatment guideline in I. R. Iran, Seda press, Second edition, Tehran, Ministry of Health and Medical Education (I. R. Iran) [In Persian]. Manouchehri, AV., Zaim, M. and , AM., A review of malaria in Iran. J Am Mosq Control Assoc. 8(4), pp Rodrigues, J., Suarez- Mutis, M. and Anderade, SL., A new challenge for malaria control in Brazil: asymptomatic infection A Review. Mem Inst Oswaldo Cruz Rio de Janeiro. 101(3), pp Suarez-Mutis, M., Cuervo, P., Leoratti, M.S., Morase- Avilas, S.L., Ferreira, AN. and Coura, J.R., Cross sectional study reveals a high percentage of asymptomatic Plasmodium vivax infection in the Amazon Rio negro area, Brazil Rev Inst Med Trop S Paulo. 49(3), pp Turki, H., Zoghi, S., Mehrizi, AA., Zakeri, S., Raeisi, A., Khazan, H., Haghdoost AA., Absence of Asymptomatic malaria infection in endemic area of Bashagard district, Hormozgan province, Iran. Iranian Journal of Parasitology; 7(1), pp Nateghpour, M., Akbarzadeh, K., Farivar, L. and Amiri, A., Detection of asymptomatic malaria infection among the Afghani immigrant population in Iranshahr district of southeastern Iran. Bull Soc Pathol Exot. 10(1007), pp Fernando, S., Abeyasinghe, R., Abeyasinghe, N.L. and Galappaththy, Rajapaksa, L.C., Absence of Asymptomatic Malaria Infections in Previously High Endemic Areas of Sri Lanka. Am J Trop Med Hyg. 81(5), pp Osorio, L., Todd, J. and Bradley, D., Absence of asymptomatic malaria in schoolchildren of Quibdo, Choco. Biomedica. 24(1), pp Joseph, M.V. and Robert, H.G., Asymptomatic Plasmodium parasitemia and the ecology of Malaria Transmission. Am J Trop Med Hyg. 66(6), pp Eke, R.A., Chibgu, L.N. and Nwachukwa, W., High Prevalence Asymptomatic Infection in a Suburb of Aba Town, Nigeria. Annals of African Medicine. 5(1), pp Mohanna, M., Bin Ghouth, A.S. and Raja, Y.A., Malaria signs and infection rate among asymptomatic schoolchildren in Hajr Valley, Yeman. Eastern Mediterranean Health Journal. 13(1), pp Steresman, G., Kamanga, A., Mono, P., Hamapumbu, H., Mharakurwa, S. and Kamanga, A., A method of active case detection to target reservoirs of asymptomatic malaria and gametocyte carriers in a rural area in Southern Province, Zambia. Malar J. 9, P Alves, F.P., Durlacher, R.R., Menezes, M.J., Krieger, H., Pereira, D.A., SilvaL, H. and Vamargo, E.P., High prevalence of asymptomatic plasmodium vivax and plasmodium falciparum infections in native Amazonian populations. Am J Trop med Hyg. 66(6), pp Roshanravan, B., Kari, E., Gilman, R.H., Cabrera, L., Lee, E. and Metcalfe, J., Endemic malaria in the Peruvian Amazon region of Iquitos. Am J Trop Med Hyg. 69(1), pp

9 Scientific Journal of School of Public Health and Institute of Public Health Research 103 Vol. 13, No. 2, Summer 2015 Asymptomatic malaria control program in high-risk Jask district, Hormozgan Province, Iran Motevalli Haghi, A., Ph.D. Assistant Professor, Department of Medical Parasitology and Mycology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran Delavari, M., MSc. Student, Department of Medical Parasitology and Mycology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran Nateghpour, M., Ph.D. Professor, Department of Medical Parasitology and Mycology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran- Corresponding author: Shekari, M., Ph.D. Professor, Department of Molecular Medical Research center, Hormozgan University of Medical Sciences, Iran Turki, H., Ph.D. Assistant Professor, Department of Medical Parasitology, Hormozgan University of Medical, Iran Raeisi, A., Ph.D. Assistant Professor, Center for Research of Endemic Parasites of Iran, Tehran University of Medical Sciences Rowshan, A., BSc. Technician of medical laboratory, Hormozgan University of Medical Sciences, Iran Received: Oct 22, 2014 Accepted: May 12, 2015 ABSTRACT Background and Aim: Asymptomatic malaria is a great challenge in the control, elimination and eradication programs of the disease in the endemic areas. The infected individuals with asymptomatic malaria are not cured and are, consequently, a potential source for contamination of the mosquito vectors and spread of the disease in the area. Therefore, detection of asymptomatic infected people is very important as regards combating the disease. This study was conducted to determine the presence and prevalence of asymptomatic malaria in Jask district, Hormozgan Province, Iran during , in the hope that the results will help in designing strategies to eliminate the disease in the area. Materials and Methods: A total of 200 persons under coverage of health centers in Jask district were selected randomly and enrolled in the study. From each subject a 5-ml blood sample was taken in 3 occasions (total number of samples = 600), slides prepared and examined using microscopic and molecular (PCR) methods, as well as rapid diagnostic (RDT) tests. Results: None of the 600 slides prepared microscopically showed any positive malaria case. Neither did any of those prepared by RDTs or Nested-PCR. Conclusion: The findings of this study indicate that implementation of the malaria control program has been successful in the area; therefore the malaria elimination program should continue. Key words: Asymptomatic malaria, Jask, Hormozgan province, Iran

Comparison of light microscopy and nested PCR assay in detecting of malaria mixed species infections in an endemic area of Iran

Comparison of light microscopy and nested PCR assay in detecting of malaria mixed species infections in an endemic area of Iran Aliehsan Heidari, Manizheh Nourian, Hossein Keshavarz Associate Prof. Dept.