Generation of post-germinal centre myeloma plasma B cell.
|
|
- Joanna Bell
- 6 years ago
- Views:
Transcription
1 Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused by alterations to genetic material following activation in the germinal centres of secondary lymphoid organs. Genetic defects include primary translocations of immunoglobulin heavy/light chain genes to other chromosomes near oncogenes/cell-cycle proteins and secondary changes including duplication/loss of chromosomes and/or mutations in cell growth/tumour suppressor genes. s also express CXCR4 receptors for, a chemokine that regulates homing to the where disease develops.
2 DNA damage following activation of s in the germinal centre. Germinal centre help Th2 CD4+ T cell IL-4 IL-10 DNA DAMAGE Follicular dendritic cell T cell zone Migration to s are primed by receptor recognition of antigens presented by follicular dendritic cells in the germinal centres of secondary lymphoid organs. CD4+ helper T cell interaction activates s to differentiate into cells and also induces isotype switching and affinity maturation. During this process abnormal DNA recombination events translocate heavy and light immunoglobulin genes to other chromosomes and generate a malignant phenotype. Secondary genetic alterations involving duplication/deletion of chromosomes or mutations in other genes can follow. The myeloma s continue to produce immunoglobulins resulting in a gammopathy and ultimately home to the where disease develops.
3 Adhesion of myeloma s to stromal cells. stromal cell Homing to IL-6 TNF-α IL-1β OPN IGF-1 BAFF APRIL VCAM-1 or fibronectin VLA-4 ICAM-1 LFA-1 or MUC-1 TGF-β TNF-α Gammopathy CXCR4 Monoclonal antibody The myeloma s express CXCR4 receptors that bind, a chemokine that regulates homing to the. s also express cellular adhesion molecules, such as VLA-4, LFA-1 and MUC-1, that interact with ligands expressed on stromal cells. Stimulation of adhesion molecules on stromal cells generates intracellular signals that promote the secretion of soluble cellular factors that help to maintain the myeloma s in an anti-apoptotic and drug-resistant state. Soluble cellular factors that stimulate the stromal cells are are also secreted by the myeloma s.
4 destruction mediated by unbalanced formation/resorption. resorption formation Osteoclast Osteoblast In multiple myeloma, disease is characterised by the presence of lytic lesions and raised blood calcium levels as a result of an imbalance between formation (mediated by osteoblasts) and resorption (mediated by osteoclasts). s home to and via interaction with stromal cells introduce changes in the microenvironment. Various soluble factors secreted by cells in the collectively reduce formation and promote resorption.
5 stromal cells Increased resorption by osteoclast activation. Osteoblast OPG OPG OPG Hypercalcaemia s RANKL TNF-α LT MIP-1α CD138 resorption IL-6 Lytic lesion Mineral RANKL RANK Osteoclast resorption destruction is mediated by the resorption activity of multinucleated osteoclasts. RANKL is a required activation signal for osteoclasts. RANKL is secreted along with other growth factors by myeloma s. In addition, an inhibitor of osteoclast activation, osteoprotegerin (OPG), which is secreted by osteoblasts and stem cells, is degraded by CD138 receptors expressed on myeloma s. stromal cells also have reduced production of OPG. OPG acts as a decoy molecule that competes with RANKL for binding to RANK receptors expressed by osteoclasts. Activated osteoclasts secrete IL-6 that promotes the survival of myeloma s.
6 stromal cells Reduced formation by osteoblast inhibition. Activin A s Dkk-1 IL-3 TGF-β formation Mineral Osteoblast formation destruction is exacerbated by the inhibition of osteoblast activity needed for formation. s secrete soluble factors that inhibit osteoblast activity. In addition, stromal cells secrete activin A which also inhibits osteoblast function.
7 Induced angiogenesis in. stromal cells bfgf Angiogenesis s IL-6 IGF-1 To improve oxygen and nutrient supply to the myeloma s, the formation of new blood vessel is promoted by soluble factors secreted by both stromal cells and myeloma s. In addition, blood vessel endothelial cells also secrete growth factors that promote the survival of the myeloma s.
8 List of abbreviations for soluble factors IL-6 IL-1β OPN OPG IGF-1 IL-8 BAFF APRIL TNF-α Dkk-1 IL-3 TGF-β RANKL LT MIP-1α bfgf VLA-4 VCAM-1 MUC-1 LFA-1 ICAM-1 Interleukin-6 Interleukin 1-beta Osteopontin Osteoprotegerin Vascular endothelial growth factor Insulin-like growth factor-1 Interleukin-8 Stromal cell derived factor 1-alpha activating factor A proliferation-inducing ligand Hepatocyte growth factor Tumour necrosis factor-alpha Dickkopf homologue-1 Interleukin-3 Transforming growth factor-beta Receptor activator of nuclear factor kappa B ligand Lymphotoxin mnacrophage inflammatory protein 1-alpha Basic fibroblast growth factor Very kate activation antigen-4 Vascular cell adhesion molecule-1 Mucin-1 Lymphocyte function-associated antigen-1 Intercellular adhesion molecule-1 BACK
TCR, MHC and coreceptors
Cooperation In Immune Responses Antigen processing how peptides get into MHC Antigen processing involves the intracellular proteolytic generation of MHC binding proteins Protein antigens may be processed
More informationThe Development of Lymphocytes: B Cell Development in the Bone Marrow & Peripheral Lymphoid Tissue Deborah A. Lebman, Ph.D.
The Development of Lymphocytes: B Cell Development in the Bone Marrow & Peripheral Lymphoid Tissue Deborah A. Lebman, Ph.D. OBJECTIVES 1. To understand how ordered Ig gene rearrangements lead to the development
More informationT Cell Effector Mechanisms I: B cell Help & DTH
T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide
More informationIntroduction. Abbas Chapter 10: B Cell Activation and Antibody Production. General Features. General Features. General Features
Introduction Abbas Chapter 10: B Cell Activation and Antibody Production January 25, 2010 Children s Mercy Hospitals and Clinics Humoral immunity is mediated by secreted antibodies (Ab) Ab function to
More informationThe Adaptive Immune Responses
The Adaptive Immune Responses The two arms of the immune responses are; 1) the cell mediated, and 2) the humoral responses. In this chapter we will discuss the two responses in detail and we will start
More informationACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY
ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through
More informationPrinciples of Adaptive Immunity
Principles of Adaptive Immunity Chapter 3 Parham Hans de Haard 17 th of May 2010 Agenda Recognition molecules of adaptive immune system Features adaptive immune system Immunoglobulins and T-cell receptors
More informationThe Major Histocompatibility Complex (MHC)
The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens
More informationFollicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy
More informationThe recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation
The migration of a particular type of leukocyte into a restricted type of tissue, or a tissue with an ongoing infection or injury, is often called leukocyte homing, and the general process of leukocyte
More informationSeeds and soil theory by Stephen Paget at the end of the XIX century.
Seeds and soil theory by Stephen Paget at the end of the XIX century. In The Distribution Of Secondary Growths In Cancer Of The Breast Paget presents and analyzes 735 fatal cases of breast cancer, complete
More informationChapter 2 (pages 22 33): Cells and Tissues of the Immune System. Prepared by Kristen Dazy, MD, Scripps Clinic Medical Group
Allergy and Immunology Review Corner: Cellular and Molecular Immunology, 8th Edition By Abul K. Abbas, MBBS; Andrew H. H. Lichtman, MD, PhD; and Shiv Pillai, MBBS, PhD. Chapter 2 (pages 22 33): Cells and
More informationNormal GC initiation then collapse; normal mutation and 10. Constitutive signalling leads to spontaneous GC in PP, even BCR -/- 19
S1 Genetic modifications affecting germinal-centre formation and function Gene Compartment GC Phenotype Ref LTα, LTβ, TNF, Organ Disorganized lymphoid architecture in spleens; poor 1 TNFRI, LTβR architecture
More informationB cell activation and antibody production. Abul K. Abbas UCSF
1 B cell activation and antibody production Abul K. Abbas UCSF 2 Lecture outline B cell activation; the role of helper T cells in antibody production Therapeutic targeting of B cells 3 Principles of humoral
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationOverview B cell development T cell development
Topics Overview B cell development T cell development Lymphocyte development overview (Cont) Receptor diversity is produced by gene rearrangement and is random Includes specificities that will bind to
More informationNew Agents for Myeloma Bone Disease
New Agents for Myeloma Bone Disease G. David Roodman MD PhD University of Pittsburgh Bone Remodeling is Uncoupled in Myeloma Normal Myeloma Hattner R et al. Nature. 1965;206:489. 1 Myeloma Bone Disease
More informationsilent epidemic,. (WHO),
Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining
More informationT cell-mediated immunity
T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating
More informationBone and Cancer. Peter Croucher
Bone and Cancer Peter Croucher Academic Unit of Bone Biology, Section of Musculoskeletal Science, University of Sheffield Medical School, Sheffield, UK Learning Objectives To Develop Understanding of:
More informationChapter 3, Part A (Pages 37-45): Leukocyte Migration into Tissues
Allergy and Immunology Review Corner: Chapter 3, Part A (pages 37-45) of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 3, Part A (Pages
More informationImmunology for the Rheumatologist
Immunology for the Rheumatologist Rheumatologists frequently deal with the immune system gone awry, rarely studying normal immunology. This program is an overview and discussion of the function of the
More informationLymphoid System: cells of the immune system. Answer Sheet
Lymphoid System: cells of the immune system Answer Sheet Q1 Which areas of the lymph node have most CD3 staining? A1 Most CD3 staining is present in the paracortex (T cell areas). This is towards the outside
More informationHow plasma cells develop. Deutsches Rheuma Forschungs Zentrum, Berlin Institut der Leibniz Gemeinschaft
How plasma cells develop Deutsches Rheuma Forschungs Zentrum, Berlin Institut der Leibniz Gemeinschaft 1 Plasma cells develop from activated B cells Toll Like Receptor B Cell Receptor B cell B cell microbia
More informationEffector T Cells and
1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New
More informationCellular Immune response. Jianzhong Chen, Ph.D Institute of immunology, ZJU
Cellular Immune response Jianzhong Chen, Ph.D Institute of immunology, ZJU Concept of adaptive immune response T cell-mediated adaptive immune response I. Concept of immune response A collective and coordinated
More informationCytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins,
Cytokines http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter22/animation the_immune_response.html Cytokines modulate the functional activities of individual cells and tissues both under
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More informationAntigen-Independent B-Cell Development Bone Marrow
Antigen-Independent B-Cell Development Bone Marrow 1. DNA rearrangements establish the primary repertoire, creating diversity 2. Allelic exclusion ensures that each clone expresses a single antibody on
More informationCHAPTER 9 BIOLOGY OF THE T LYMPHOCYTE
CHAPTER 9 BIOLOGY OF THE T LYMPHOCYTE Coico, R., Sunshine, G., (2009) Immunology : a short course, 6 th Ed., Wiley-Blackwell 1 CHAPTER 9 : Biology of The T Lymphocytes 1. 2. 3. 4. 5. 6. 7. Introduction
More informationDevelopment of B and T lymphocytes
Development of B and T lymphocytes What will we discuss today? B-cell development T-cell development B- cell development overview Stem cell In periphery Pro-B cell Pre-B cell Immature B cell Mature B cell
More informationTest Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas
Test Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas Chapter 04: Antigen Recognition in the Adaptive Immune System Test Bank MULTIPLE CHOICE 1. Most T lymphocytes
More informationBone Health in Patients with Multiple Myeloma
Bone Health in Patients with Multiple Myeloma Amrita Y. Krishnan, MD Director Judy and Bernard Briskin Myeloma Center City of Hope Comprehensive Cancer Center Bone Health Bisphosphonates in Space Bone
More informationImmune response. This overview figure summarizes simply how our body responds to foreign molecules that enter to it.
Immune response This overview figure summarizes simply how our body responds to foreign molecules that enter to it. It s highly recommended to watch Dr Najeeb s lecture that s titled T Helper cells and
More informationMetastasis progression
Metastasis progression Mieloma multiplo Linear Progression Cancer cells disseminate through the organism after acquiring metastatic features inside the primary cancer Parallel progression Cancer cells
More informationB cell development in the bone marrow.
development in the bone. s develop from multipotent haematopoietic stem s in the bone that produce lymphoid progenitors which in turn generate s. s with a unique antibody specificity develop by initial
More informationQuestion 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?
Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes
More informationMAF Shalaby Prof. Rheumatology Al Azhar University, Cairo, Egypt.
MAF Shalaby Prof. Rheumatology Al Azhar University, Cairo, Egypt. AUTOIMMUNE DISEASE RA SLE VASCULITIS RELAPSING POLYCHONDRITIS SS DM/PM SJOGREN S SYNDROME RHEUMATOID ARTHRITIS Classically immune mediated
More informationAntibodies and T Cell Receptor Genetics Generation of Antigen Receptor Diversity
Antibodies and T Cell Receptor Genetics 2008 Peter Burrows 4-6529 peterb@uab.edu Generation of Antigen Receptor Diversity Survival requires B and T cell receptor diversity to respond to the diversity of
More informationMicro 204. Cytotoxic T Lymphocytes (CTL) Lewis Lanier
Micro 204 Cytotoxic T Lymphocytes (CTL) Lewis Lanier Lewis.Lanier@ucsf.edu Lymphocyte-mediated Cytotoxicity CD8 + αβ-tcr + T cells CD4 + αβ-tcr + T cells γδ-tcr + T cells Natural Killer cells CD8 + αβ-tcr
More informationImmunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters,
Immunology T-Lymphocytes 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, karin.peters@rub.de The role of T-effector cells in the immune response against microbes cellular immunity humoral immunity
More informationAdaptive Immunity: Humoral Immune Responses
MICR2209 Adaptive Immunity: Humoral Immune Responses Dr Allison Imrie 1 Synopsis: In this lecture we will review the different mechanisms which constitute the humoral immune response, and examine the antibody
More informationT cell Receptor. Chapter 9. Comparison of TCR αβ T cells
Chapter 9 The αβ TCR is similar in size and structure to an antibody Fab fragment T cell Receptor Kuby Figure 9-3 The αβ T cell receptor - Two chains - α and β - Two domains per chain - constant (C) domain
More informationIg light chain rearrangement: Rescue pathway
B Cell Development Ig light chain rearrangement: Rescue pathway There is only a 1:3 chance of the join between the V and J region being in frame Vk Jk Ck Non-productive Rearrangement Light chain has a
More informationSubject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
More informationPlasma cell myeloma (multiple myeloma)
Plasma cell myeloma (multiple myeloma) Common lymphoid neoplasm, present at old age (70 years average) Remember: plasma cells are terminally differentiated B-lymphocytes that produces antibodies. B-cells
More informationCELL BIOLOGY - CLUTCH CH THE IMMUNE SYSTEM.
!! www.clutchprep.com CONCEPT: OVERVIEW OF HOST DEFENSES The human body contains three lines of against infectious agents (pathogens) 1. Mechanical and chemical boundaries (part of the innate immune system)
More informationAndrea s SI Session PCB Practice Test Test 3
Practice Test Test 3 READ BEFORE STARTING PRACTICE TEST: Remember to please use this practice test as a tool to measure your knowledge, and DO NOT use it as your only tool to study for the test, since
More informationThe development of T cells in the thymus
T cells rearrange their receptors in the thymus whereas B cells do so in the bone marrow. The development of T cells in the thymus The lobular/cellular organization of the thymus Immature cells are called
More informationAttribution: University of Michigan Medical School, Department of Microbiology and Immunology
Attribution: University of Michigan Medical School, Department of Microbiology and Immunology License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution
More informationComment les cellules osseuses communiquent entre elles. Gérard Friedlander Journées UPA 2011
Comment les cellules osseuses communiquent entre elles Gérard Friedlander Journées UPA 2011 Structure de l os Osteocyte Ostéoclaste Remodelage osseux RANKL RANK NF-kB pathway Stem cell progenitor precursor
More informationCytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
More informationLecture 9: T-cell Mediated Immunity
Lecture 9: T-cell Mediated Immunity Questions to Consider How do T cells know where to go? Questions to Consider How do T cells know where to go? How does antigen get targeted to a T cell expressing the
More informationInnate immunity (rapid response) Dendritic cell. Macrophage. Natural killer cell. Complement protein. Neutrophil
1 The immune system The immune response The immune system comprises two arms functioning cooperatively to provide a comprehensive protective response: the innate and the adaptive immune system. The innate
More informationReview Questions: Janeway s Immunobiology 8th Edition by Kenneth Murphy
Review Questions: Janeway s Immunobiology 8th Edition by Kenneth Murphy Chapter 11 (pages 429-460): Dynamics of Adaptive Immunity prepared by Kelly von Elten, Walter Reed National Military Medical Center,
More informationBone metastases in hematology
Botziekte bij hematologische tumoren Prof. Dr. Michel Delforge Hematologie, UZ Leuven Bone metastases in hematology The bone marrow is the source of many hematological malignancies However, bone damage
More informationMedical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University
Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve
More informationDefensive mechanisms include :
Acquired Immunity Defensive mechanisms include : 1) Innate immunity (Natural or Non specific) 2) Acquired immunity (Adaptive or Specific) Cell-mediated immunity Humoral immunity Two mechanisms 1) Humoral
More informationThe Role of Microenvironment in the Control of Tumor Angiogenesis
The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,
More informationDeposition of Bone by the Osteoblasts. Bone is continually being deposited by osteoblasts, and it is continually being resorbed where osteoclasts are
Bone remodeling Deposition of Bone by the Osteoblasts. Bone is continually being deposited by osteoblasts, and it is continually being resorbed where osteoclasts are active. This mechanism is always is
More informationThe Adaptive Immune Response. T-cells
The Adaptive Immune Response T-cells T Lymphocytes T lymphocytes develop from precursors in the thymus. Mature T cells are found in the blood, where they constitute 60% to 70% of lymphocytes, and in T-cell
More informationT cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
More informationHLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol
HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared
More informationImmunology lecture: 14. Cytokines: Main source: Fibroblast, but actually it can be produced by other types of cells
Immunology lecture: 14 Cytokines: 1)Interferons"IFN" : 2 types Type 1 : IFN-Alpha : Main source: Macrophages IFN-Beta: Main source: Fibroblast, but actually it can be produced by other types of cells **There
More informationHelminth worm, Schistosomiasis Trypanosomes, sleeping sickness Pneumocystis carinii. Ringworm fungus HIV Influenza
Helminth worm, Schistosomiasis Trypanosomes, sleeping sickness Pneumocystis carinii Ringworm fungus HIV Influenza Candida Staph aureus Mycobacterium tuberculosis Listeria Salmonella Streptococcus Levels
More informationIL-17 in health and disease. March 2014 PSO13-C051n
IL-17 in health and disease March 2014 PSO13-C051n Originally Researchers Suggested That IL-12 and IL-4 drove Th Cell Differentiation Naïve CD4 + T cell Question: Which of these cell types is responsible
More informationBasis of Immunology and
Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie
More informationB cells: a fundamental role in the pathogenesis of rheumatoid arthritis?
Rheumatology 2005;44(Suppl. 2):ii3 ii7 B cells: a fundamental role in the pathogenesis of rheumatoid arthritis? doi:10.1093/rheumatology/keh616 The role of T cells in the pathogenesis of RA is well established,
More informationFoundations in Microbiology
Foundations in Microbiology Fifth Edition Talaro Chapter 15 The Acquisition of Specific Immunity and Its Applications Chapter 15 2 Chapter Overview 1. Development of the Dual Lymphocyte System 2. Entrance
More informationPathophysiology of Postmenopausal & Glucocorticoid Induced Osteoporosis. March 15, 2016 Bone ECHO Kate T Queen, MD
Pathophysiology of Postmenopausal & Glucocorticoid Induced Osteoporosis March 15, 2016 Bone ECHO Kate T Queen, MD Review: normal bone formation Bone Modeling Remodeling Peak Bone Mass Maximum bone mass
More informationLymphoid Organs and Lymphocyte Trafficking. Dr. Issa Abu-Dayyeh
Lymphoid Organs and Lymphocyte Trafficking Dr. Issa Abu-Dayyeh Invader recognition Where does invader recognition take place?? Secondary lymphoid organs: Lymph nodes Spleen Mucosal-associated lymphoid
More informationImmune response to infection
Immune response to infection Dr. Sandra Nitsche (Sandra.Nitsche@rub.de ) 20.06.2018 1 Course of acute infection Typical acute infection that is cleared by an adaptive immune reaction 1. invasion of pathogen
More informationContribution of Interstitial Valve Cells to Aortic Valve Calcification
UNIVERSITÀ DEGLI STUDI DI PADOVA SEDE AMMINISTRATIVA: UNIVERSITÀ DEGLI STUDI DI PADOVA DIPARTIMENTO DI SCIENZE MEDICO-DIAGNOSTICHE E TERAPIE SPECIALI SCUOLA DI DOTTORATO DI RICERCA IN SCIENZE MEDICHE,
More informationMECHANISMS OF CELLULAR REJECTION IN ORGAN TRANSPLANTATION AN OVERVIEW
MECHANISMS OF CELLULAR REJECTION IN ORGAN TRANSPLANTATION AN OVERVIEW YVON LEBRANCHU Service Néphrologie et Immunologie Clinique CHU TOURS ANTIGEN PRESENTING CELL CD4 + T CELL CYTOKINE PRODUCTION CLONAL
More informationκ λ Antigen-Independent B-Cell Development Bone Marrow Ordered Rearrangement of Ig Genes During B-Cell Development in the Bone Marrow
Antigen-Independent B-Cell Development Bone Marrow 1. DNA rearrangements establish the primary repertoire, creating diversity 2. Allelic exclusion ensures that each clone expresses a single antibody on
More informationFOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH
FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH ALETA A SOURCE OF 1,3-BETA GLUCANS Aleta is highly bioavailable, offering a concentration greater than 5% of 1,3-beta glucans. Aleta provides a consistent response
More informationAntigen Presentation and T Lymphocyte Activation. Abul K. Abbas UCSF. FOCiS
1 Antigen Presentation and T Lymphocyte Activation Abul K. Abbas UCSF FOCiS 2 Lecture outline Dendritic cells and antigen presentation The role of the MHC T cell activation Costimulation, the B7:CD28 family
More informationBone Marrow Microenvironment in Multiple Myeloma Progression
Bone Marrow Microenvironment in Multiple Myeloma Progression The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Published
More informationMultiple myeloma Biological & Clinical Aspects Isabelle Vande Broek, MD, PhD
Multiple myeloma Biological & Clinical Aspects Isabelle Vande Broek, MD, PhD Department of Oncology & Hematology AZ Nikolaas Iridium Kanker Netwerk Introduction Multiple myeloma = Kahler s disease Dr.
More informationImmunology - Lecture 2 Adaptive Immune System 1
Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers
More informationIs it CVID? Not Necessarily HAIG TCHEUREKDJIAN, MD
Is it CVID? Not Necessarily HAIG TCHEUREKDJIAN, MD Current Paradigm of Pathogenesis Genetic defect(s) Molecular defect(s) Cellular defect(s) Clinical disease Current Paradigm of Pathogenesis Genetic defect(s)
More informationAdaptive immune responses: T cell-mediated immunity
MICR2209 Adaptive immune responses: T cell-mediated immunity Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will discuss the T-cell mediated immune response, how it is activated,
More informationMolecular Pathology of Lymphoma (Part 1) Rex K.H. Au-Yeung Department of Pathology, HKU
Molecular Pathology of Lymphoma (Part 1) Rex K.H. Au-Yeung Department of Pathology, HKU Lecture outline Time 10:00 11:00 11:15 12:10 12:20 13:15 Content Introduction to lymphoma Review of lymphocyte biology
More informationall of the above the ability to impart long term memory adaptive immunity all of the above bone marrow none of the above
1. (3 points) Immediately after a pathogen enters the body, it faces the cells and soluble proteins of the innate immune system. Which of the following are characteristics of innate immunity? a. inflammation
More informationLECTURE: 23 T-AND B-LYMPHOCYTES COOPERATIONS LEARNING OBJECTIVES: The student should be able to:
LECTURE: 23 Title T-AND B-LYMPHOCYTES COOPERATIONS LEARNING OBJECTIVES: The student should be able to: Enumerate the major types of T-helper cells surface molecules, and that expressed on the B-lymphocytes
More informationHow T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do? Monoclonal antibody approach
How T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about T cell function was known, but the receptor genes had not been identified
More informationA second type of TCR TCR: An αβ heterodimer
How s recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about function was known, but the receptor genes had not been identified Recall
More informationPrimary Immunodeficiency
Primary Immunodeficiency DiGeorge Syndrome Severe Combined Immunodeficiency SCID X-Linked Agammaglobulinemia Common variable immunodeficiency (CVID) IgA deficiency Hyper- IgM Syndrome Wiskott-Aldrich syndrome
More informationCancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz
Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz December 1, 2010 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 25 More mutations as 20 you get older
More informationFusion proteins for immune applications (FPIA)
Fusion proteins for immune applications (FPIA) Marie-Paule Lefranc IMGT, the international ImMunoGeneTics information system http://www.imgt.org Fusion proteins for immune applications (FPIA) Fusion proteins
More informationPBS Class #2 Introduction to the Immune System part II Suggested reading: Abbas, pgs , 27-30
PBS 803 - Class #2 Introduction to the Immune System part II Suggested reading: Abbas, pgs. 15-25, 27-30 Learning Objectives Compare and contrast the maturation of B and T lymphocytes Compare and contrast
More informationAdaptive (acquired) immunity. Professor Peter Delves University College London
Adaptive (acquired) immunity Professor Peter Delves University College London p.delves@ucl.ac.uk Haematopoiesis Haematopoiesis Lymphocytes = adaptive response Recognition of pathogens by adaptive cells,
More informationHelper-T-cell regulated B-cell differentiation. Phase I begins at the site of infection with acute inflammation that leads to the activation and
1 2 Helper-T-cell regulated B-cell differentiation. Phase I begins at the site of infection with acute inflammation that leads to the activation and emigration of DCs to the T- cell zones of the lymph
More informationNTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc.
NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc. Cytokines Properties of Cytokines Cytokines are proteins with specific roles
More informationDNA vaccine, peripheral T-cell tolerance modulation 185
Subject Index Airway hyperresponsiveness (AHR) animal models 41 43 asthma inhibition 45 overview 41 mast cell modulation of T-cells 62 64 respiratory tolerance 40, 41 Tregs inhibition role 44 respiratory
More informationThe Adaptive Immune Response. B-cells
The Adaptive Immune Response B-cells The innate immune system provides immediate protection. The adaptive response takes time to develop and is antigen specific. Activation of B and T lymphocytes Naive
More information