DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED

Size: px
Start display at page:

Download "DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED"

Transcription

1 DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED Viv Peut Kent Laboratory, University of Melbourne, Australia

2 WHY ENVELOPE? Env subject to both humoral and cellular immune responses Perhaps multiple rounds of mutation would be required for effective immune escape May result in virus with reduced fitness Lower viral fitness = Lower viral load (VL) - slower progression to disease - reduced transmission rates

3 VERY UNFIT VIRUS

4 HOWEVER... Gag has recently been shown to elicit a more effective CD8 T cell response in humans. Broad Env-specific CTL responses correlated with higher levels of viremia. (Kiepiela et al., Nat Med 2007) Gag-specific CD8 T cell clones more efficient than Envspecific CD8 T cells in limiting viral replication in vitro. (Chen, Walker, 4th IAS Conference, Sydney, 2007) Gag presented much earlier than other HIV proteins. (Sacha et al., J Immunol, 2007)

5 OUTLINE OF TALK What is VL outcome of macaques responding to Env vs those responding to Gag? X4-SHIV trial analyzed What is the pattern of immune escape at Env compared to Gag? Kinetics of escape Diversity of escape motifs What is effect of therapeutic immunization with only Gag vs all SIV proteins? R5-SIVmac251 study Viral load Immunodominance

6 THE SHIVmn229 TRIAL IN 30 PIGTAIL MACAQUES Vaccination SHIV DNA and fowlpoxvirus vaccines expressing Gag and Env (De Rose et al., J Virol, 2007) - HIV-1 Env truncated - no induction of neutralizing antibodies (NAb) Challenge Heterologous X4-utilising SHIV mn229 Env-specific T cell epitope identification Eight Env-specific CD8 T cell epitopes mapped in 10 animals identified by Intracellular cytokine staining (ICS)

7 Viral Load (log 10 copies/ml plasma) CD4 Lymphocytes (%) VL AND CD4 LEVELS - ENV vs GAG A. Env CD8 T Cell Responders vs Non Responders Non responders B. Responders Weeks Post Challenge

8 Viral Load (log 10 copies/ml plasma) CD4 Lymphocytes (%) VL AND CD4 LEVELS - ENV vs GAG A B. Env CD8 T Cell Responders vs Non Responders Non responders Responders C. Gag CD8 T Cell Responders vs Non Responders D. Non responders Responders p = 0.01 p = Weeks Post Challenge

9 Poster #PO8-08

10 KINETICS OF ESCAPE - ENV vs GAG Gag vs Env epitope escape kinetics % Wild Type Virus NL NL SP SP SP RY RY AF KW KP KP9 Env Gag Weeks Post Challenge p = 0.04

11 NUMBER OF MUTANT QUASISPECIES - ENV vs GAG 4 p = 0.03 I7S9 C8 G1R8 I7 Number of Total Mutant Quasispecies at week 8 post infection Epitope KP9 Animal ID 4246 (#) clones (10) R2 R2 2aa R1 H8 del KP (9) AF (28) KW (23) G1 R3 RY (12) G3 R3 T5 RY (23) N1 S9 S9 E8 SP (16) N6 R8 I6 SP (11) GI S9 SP (14) 5aa del G4 N3 NL (15) E4 NL (11) Gag Epitopes Env Epitopes

12 BROAD vs NARROW RESPONSE Compare Gag and Env - specific CD8 T cell responses elicited by a Gag, Env, Pol and accessory proteins combined (OPAL All) vaccination with a Gag-alone vaccination (OPAL Gag). Overlapping Peptide-pulsed Autologous Leukocytes (Kent et al., Poster, #P09-06)

13 OPAL - WHAT IS INVOLVED 18 ml blood draw PBMC Pulse PBMC with Overlapping 15mer peptides (ALL or GAG) 1 h at 37 o C IV infuse PBMC back into same animal Vaccinated or Infected Pigtail Macaque IFNγ BEFORE treatment ABCDEFGHIJKLMNO EFGHIJKLMNOPQRS IJKLMNOPQRSTUV MNOPQRSTUVWXYZ Experimental Design * 36 pigtail macaques * Infected with SIVmac251 * Treated with antiretrovirals (Tenofovir, FTC) * Immunised with - Gag peptide 10 - All SIV peptides (including Gag) 4 - Controls * Recrudescence of VL studied 2 weeks AFTER treatment CD8 CD4 0 CD8 CD Intracellular IFNγ Assay

14 7 6 5 Viral Load (by Treatment Group) ΔVL = 0.93 log 10 (p = 0.01) Control OPAL All OPAL Gag Week post SIV infection

15 GAG-SPECIFIC CD8 T CELL REPONSES IFNγ Gag responses - OPAL Gag Gag responses - OPAL All Animal ID At same dose of Gag in both groups, why are Gag responses reduced in the OPAL All group???

16 NEVER THE TWAIN SHALL MEET - Gag OR Env but rarely both Week 12 post infection in the ALL group SIV Gag-specific CD8 T cell (% IFNγ+ cells) Including 2 extreme Env-specific responses SIV Env-specific CD8 T cell (% IFNγ+ cells) Excluding 2 extreme Env-specific responses

17 DOMINANCE?

18 DOMINANCE? COMPETITION?

19 IN A NUT SHELL Characteristics Maintain lower viremia Gag Env

20 IN A NUT SHELL Characteristics Gag Env Maintain lower viremia Early and rapid CD8 T cell escape (Gag-specific CTL exerts vigorous selection pressure)

21 IN A NUT SHELL Characteristics Gag Env Maintain lower viremia Early and rapid CD8 T cell escape (Gag-specific CTL exerts vigorous selection pressure) Low diversity of escape mutants (Gag more constrained in its mutational manoeuvres )

22 IN A NUT SHELL Characteristics Gag Env Maintain lower viremia Early and rapid CD8 T cell escape (Gag-specific CTL exerts vigorous selection pressure) Low diversity of escape mutants (Gag more constrained in its mutational manoeuvres ) Strong response regardless of other CD8 T cell responses (broadest multi-protein responses may not always be the most useful)

23 FUTURE WORK Are a subset of HIV Env-specific T cell responses helpful? Prevent Env responses dominating Gag responses T cell mapping and escape studies in SIV Env Explore the relationships between CD8 T cell escape, NAb escape and N-linked glycosylation sites. (Peut et al., Poster #P03-06)

24 ACKNOWLEDGEMENTS Stephen Kent and all the lab and macaque facility staff M. Davenport & J. Petravic University of NSW Scholarships AChSHM GlaxoSmithKline Univ Melbourne AIDS Vaccine 07 NHMRC NIH Australian-Thai HIV Vaccine consortium

25

26

NK mediated Antibody Dependent Cellular Cytotoxicity in HIV infections

NK mediated Antibody Dependent Cellular Cytotoxicity in HIV infections NK mediated Antibody Dependent Cellular Cytotoxicity in HIV infections Amy Chung Dr. Ivan Stratov Prof. Stephen Kent ADCC process consists of Target cell QuickTime and a TIFF (Uncompressed) FcγR decompressor

More information

JVI Accepts, published online ahead of print on 7 March 2007 J. Virol. doi: /jvi

JVI Accepts, published online ahead of print on 7 March 2007 J. Virol. doi: /jvi JVI Accepts, published online ahead of print on 7 March 2007 J. Virol. doi:10.1128/jvi.02763-06 Copyright 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Innate and Cellular Immunology Control of Infection by Cell-mediated Immunity

Innate and Cellular Immunology Control of Infection by Cell-mediated Immunity Innate & adaptive Immunity Innate and Cellular Immunology Control of Infection by Cell-mediated Immunity Helen Horton PhD Seattle Biomedical Research Institute Depts of Global Health & Medicine, UW Cellular

More information

On an individual level. Time since infection. NEJM, April HIV-1 evolution in response to immune selection pressures

On an individual level. Time since infection. NEJM, April HIV-1 evolution in response to immune selection pressures HIV-1 evolution in response to immune selection pressures BISC 441 guest lecture Zabrina Brumme, Ph.D. Assistant Professor, Faculty of Health Sciences Simon Fraser University http://www3.niaid.nih.gov/topics/hivaids/understanding/biology/structure.htm

More information

Activation of NK Cells by ADCC Antibodies and HIV Disease Progression

Activation of NK Cells by ADCC Antibodies and HIV Disease Progression RAPID COMMUNICATION Activation of NK Cells by ADCC Antibodies and HIV Disease Progression Amy W. Chung, BSc, PhD,* Marjon Navis, PhD,* Gamze Isitman, BSc,* Leia Wren, BSc,* Julie Silvers, RN, Janaki Amin,

More information

How HIV Causes Disease Prof. Bruce D. Walker

How HIV Causes Disease Prof. Bruce D. Walker How HIV Causes Disease Howard Hughes Medical Institute Massachusetts General Hospital Harvard Medical School 1 The global AIDS crisis 60 million infections 20 million deaths 2 3 The screen versions of

More information

HIV Anti-HIV Neutralizing Antibodies

HIV Anti-HIV Neutralizing Antibodies ,**/ The Japanese Society for AIDS Research The Journal of AIDS Research : HIV HIV Anti-HIV Neutralizing Antibodies * Junji SHIBATA and Shuzo MATSUSHITA * Division of Clinical Retrovirology and Infectious

More information

Are we targeting the right HIV determinants?

Are we targeting the right HIV determinants? QuickTime et un décompresseur TIFF (non compressé) sont requis pour visionner cette image. AIDS Vaccine 2009 October 22 nd 2009 - Paris Are we targeting the right HIV determinants? Françoise BARRÉ-SINOUSSI

More information

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial

More information

HIV acute infections and elite controllers- what can we learn?

HIV acute infections and elite controllers- what can we learn? HIV acute infections and elite controllers- what can we learn? Thumbi Ndung u, BVM, PhD KwaZulu-Natal Research Institute for Tuberculosis and HIV (K-RITH) and HIV Pathogenesis Programme (HPP), Doris Duke

More information

RAISON D ETRE OF THE IMMUNE SYSTEM:

RAISON D ETRE OF THE IMMUNE SYSTEM: RAISON D ETRE OF THE IMMUNE SYSTEM: To Distinguish Self from Non-Self Thereby Protecting Us From Our Hostile Environment. Innate Immunity Acquired Immunity Innate immunity: (Antigen nonspecific) defense

More information

A VACCINE FOR HIV BIOE 301 LECTURE 10 MITALI BANERJEE HAART

A VACCINE FOR HIV BIOE 301 LECTURE 10 MITALI BANERJEE HAART BIOE 301 LECTURE 10 MITALI BANERJEE A VACCINE FOR HIV HIV HAART Visit wikipedia.org and learn the mechanism of action of the five classes of antiretroviral drugs. (1) Reverse transcriptase inhibitors (RTIs)

More information

Superior Control of HIV-1 Replication by CD8+ T Cells Targeting Conserved Epitopes: Implications for HIV Vaccine Design

Superior Control of HIV-1 Replication by CD8+ T Cells Targeting Conserved Epitopes: Implications for HIV Vaccine Design Superior Control of HIV-1 Replication by CD8+ T Cells Targeting Conserved Epitopes: Implications for HIV Vaccine Design Pratima Kunwar 1,7, Natalie Hawkins 2, Warren L. Dinges 1,3, Yi Liu 5, Erin E. Gabriel

More information

Establishment and Targeting of the Viral Reservoir in Rhesus Monkeys

Establishment and Targeting of the Viral Reservoir in Rhesus Monkeys Establishment and Targeting of the Viral Reservoir in Rhesus Monkeys Dan H. Barouch, M.D., Ph.D. Center for Virology and Vaccine Research Beth Israel Deaconess Medical Center Ragon Institute of MGH, MIT,

More information

RAISON D ETRE OF THE IMMUNE SYSTEM:

RAISON D ETRE OF THE IMMUNE SYSTEM: RAISON D ETRE OF THE IMMUNE SYSTEM: To Distinguish Self from Non-Self Thereby Protecting Us From Our Hostile Environment. Innate Immunity Adaptive Immunity Innate immunity: (Antigen - nonspecific) defense

More information

Fayth K. Yoshimura, Ph.D. September 7, of 7 HIV - BASIC PROPERTIES

Fayth K. Yoshimura, Ph.D. September 7, of 7 HIV - BASIC PROPERTIES 1 of 7 I. Viral Origin. A. Retrovirus - animal lentiviruses. HIV - BASIC PROPERTIES 1. HIV is a member of the Retrovirus family and more specifically it is a member of the Lentivirus genus of this family.

More information

EMERGING ISSUES IN THE HUMORAL IMMUNE RESPONSE TO HIV. (Summary of the recommendations from an Enterprise Working Group)

EMERGING ISSUES IN THE HUMORAL IMMUNE RESPONSE TO HIV. (Summary of the recommendations from an Enterprise Working Group) AIDS Vaccine 07, Seattle, August 20-23, 2007 EMERGING ISSUES IN THE HUMORAL IMMUNE RESPONSE TO HIV (Summary of the recommendations from an Enterprise Working Group) The Working Group Reston, Virginia,

More information

Rapid perforin upregulation directly ex vivo by CD8 + T cells is a defining characteristic of HIV elite controllers

Rapid perforin upregulation directly ex vivo by CD8 + T cells is a defining characteristic of HIV elite controllers Rapid perforin upregulation directly ex vivo by CD8 + T cells is a defining characteristic of HIV elite controllers Adam R. Hersperger Department of Microbiology University of Pennsylvania Evidence for

More information

Viral Reservoirs and anti-latency interventions in nonhuman primate models of SIV/SHIV infection

Viral Reservoirs and anti-latency interventions in nonhuman primate models of SIV/SHIV infection Viral Reservoirs and anti-latency interventions in nonhuman primate models of SIV/SHIV infection Koen Van Rompay California National Primate Research Center University of California Davis Outline Introduction

More information

Supporting Information

Supporting Information Supporting Information Sui et al..7/pnas.997 Pre-CLP CM9 LA9 SL Tat# Pol Vif % Tetramer + CD + CD + Vac+IL- +IL- Vac Fig. S. Frequencies of six different CD + CD + Mamu-A*-tetramer + cells were measured

More information

Vaccine-Induced T Cells Control Reversion of AIDS Virus Immune Escape Mutants

Vaccine-Induced T Cells Control Reversion of AIDS Virus Immune Escape Mutants JOURNAL OF VIROLOGY, Apr. 2007, p. 4137 4144 Vol. 81, No. 8 0022-538X/07/$08.00 0 doi:10.1128/jvi.02193-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Vaccine-Induced T Cells

More information

NIH Public Access Author Manuscript Nat Med. Author manuscript; available in PMC 2010 September 1.

NIH Public Access Author Manuscript Nat Med. Author manuscript; available in PMC 2010 September 1. NIH Public Access Author Manuscript Published in final edited form as: Nat Med. 2010 March ; 16(3): 319 323. doi:10.1038/nm.2089. Mosaic HIV-1 Vaccines Expand the Breadth and Depth of Cellular Immune Responses

More information

Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia

Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia AIDSvaccine conference, 14 th September 2011 IMGT HLA database July 2011 >5000 class

More information

GOVX-B11: A Clade B HIV Vaccine for the Developed World

GOVX-B11: A Clade B HIV Vaccine for the Developed World GeoVax Labs, Inc. 19 Lake Park Drive Suite 3 Atlanta, GA 3 (678) 384-72 GOVX-B11: A Clade B HIV Vaccine for the Developed World Executive summary: GOVX-B11 is a Clade B HIV vaccine targeted for use in

More information

AIDSVaccine2010 Atlanta, Georgia Willy Bogers. NIH HIVRad Grant nr 5P01AI066287

AIDSVaccine2010 Atlanta, Georgia Willy Bogers. NIH HIVRad Grant nr 5P01AI066287 HIV-1 envelope-cd4 receptor complexes elicit broad T- and B- cell immune responses as well as cross-reactive neutralizing antibodies in Rhesus macaques NIH HIVRad Grant nr 5P01AI066287 AIDSVaccine2010

More information

Fostering Clinical Development for HIV-1 Vaccine

Fostering Clinical Development for HIV-1 Vaccine W Fostering Clinical Development for HIV-1 Vaccine Ravimiarenduse alane seminar 9. oktoobril Tallinnas Mart Ustav, PhD CSO, SVP 1 FIT Biotech Founded in 1995 Operations in Tampere, Finland and Tartu, Estonia

More information

Mechanisms of antagonism of HIVspecific CD4+ T cell responses BSRI

Mechanisms of antagonism of HIVspecific CD4+ T cell responses BSRI Mechanisms of antagonism of HIVspecific CD4+ T cell responses BSRI Problems Virus escape from immune recognition Antagonism of T cell responses Peptide-MHC-TCR interaction T cell antagonism Variants of

More information

Potential cross reactions between HIV 1 specific T cells and the microbiome. Andrew McMichael Suzanne Campion

Potential cross reactions between HIV 1 specific T cells and the microbiome. Andrew McMichael Suzanne Campion Potential cross reactions between HIV 1 specific T cells and the microbiome Andrew McMichael Suzanne Campion Role of the Microbiome? T cell (and B cell) immune responses to HIV and Vaccines are influenced

More information

HIV cure: current status and implications for the future

HIV cure: current status and implications for the future HIV cure: current status and implications for the future Carolyn Williamson, PhD Head of Medical Virology, Faculty Health Sciences, University of Cape Town CAPRISA Research Associate, Centre of Excellence

More information

Defining kinetic properties of HIV-specific CD8 + T-cell responses in acute infection

Defining kinetic properties of HIV-specific CD8 + T-cell responses in acute infection Defining kinetic properties of HIV-specific CD8 + T-cell responses in acute infection Yiding Yang 1 and Vitaly V. Ganusov 1,2,3 1 Department of Microbiology, University of Tennessee, Knoxville, TN 37996,

More information

HIV vaccines, neutralising antibodies, ADCC and beyond. Stephen Kent University of Melbourne Peter Doherty Institute

HIV vaccines, neutralising antibodies, ADCC and beyond. Stephen Kent University of Melbourne Peter Doherty Institute HIV vaccines, neutralising antibodies, ADCC and beyond Stephen Kent University of Melbourne Peter Doherty Institute Viro-Immunobabble bingo Virology/Immunology/vaccinology full of jargon! Shout Immunobabble

More information

Control of Viremia and Prevention of AIDS following Immunotherapy of SIV-Infected Macaques with Peptide- Pulsed Blood

Control of Viremia and Prevention of AIDS following Immunotherapy of SIV-Infected Macaques with Peptide- Pulsed Blood Control of Viremia and Prevention of AIDS following Immunotherapy of SIV-Infected Macaques with Peptide- Pulsed Blood Robert De Rose 1, Caroline S. Fernandez 1, Miranda Z. Smith 1, C. Jane Batten 1, Sheilajen

More information

The Swarm: Causes and consequences of HIV quasispecies diversity

The Swarm: Causes and consequences of HIV quasispecies diversity The Swarm: Causes and consequences of HIV quasispecies diversity Julian Wolfson Dept. of Biostatistics - Biology Project August 14, 2008 Mutation, mutation, mutation Success of HIV largely due to its ability

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION ` SUPPLEMENTAL FIGURES doi:10.1038/nature10003 Supplemental Figure 1: RhCMV/SIV vectors establish and indefinitely maintain high frequency SIV-specific T cell responses in diverse tissues: The figure shows

More information

Immunization with single-cycle SIV significantly reduces viral loads after an intravenous challenge with SIV(mac)239

Immunization with single-cycle SIV significantly reduces viral loads after an intravenous challenge with SIV(mac)239 University of Massachusetts Medical School escholarship@umms Preventive and Behavioral Medicine Publications and Presentations Preventive and Behavioral Medicine 1-23-2009 Immunization with single-cycle

More information

Received 19 September 2007/Accepted 21 November 2007

Received 19 September 2007/Accepted 21 November 2007 JOURNAL OF VIROLOGY, Feb. 2008, p. 1723 1738 Vol. 82, No. 4 0022-538X/08/$08.00 0 doi:10.1128/jvi.02084-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Patterns of CD8 Immunodominance

More information

Replicating measles-shiv vaccine induces long term preservation of central memory CD4 cells in the gut of macaques challenged with SHIV89.

Replicating measles-shiv vaccine induces long term preservation of central memory CD4 cells in the gut of macaques challenged with SHIV89. Replicating measles-shiv vaccine induces long term preservation of central memory CD4 cells in the gut of macaques challenged with SHIV89.6P Frédéric Tangy Viral Genomics and Vaccination Laboratory Measles

More information

Received 31 March 2011/Accepted 19 July 2011

Received 31 March 2011/Accepted 19 July 2011 JOURNAL OF VIROLOGY, Oct. 2011, p. 10518 10528 Vol. 85, No. 20 0022-538X/11/$12.00 doi:10.1128/jvi.00655-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Fitness Costs and Diversity

More information

Does Cytolysis by CD8 + T Cells Drive Immune Escape in HIV Infection?

Does Cytolysis by CD8 + T Cells Drive Immune Escape in HIV Infection? The Journal of Immunology Does Cytolysis by CD8 + T Cells Drive Immune Escape in HIV Infection? Mehala Balamurali,* Janka Petravic,* Liyen Loh, Sheilajen Alcantara, Stephen J. Kent, and Miles P. Davenport*

More information

PRACTICE POINTS AIDS Vaccine 2001: Looking to the Future

PRACTICE POINTS AIDS Vaccine 2001: Looking to the Future PRACTICE POINTS AIDS Vaccine 2001: Looking to the Future 1 Ronald T. Mitsuyasu 1 Associate Professor of Medicine, University of California Los Angeles, and Director of the UCLA CARE Center, UCLA Medical

More information

Lecture 11. Immunology and disease: parasite antigenic diversity

Lecture 11. Immunology and disease: parasite antigenic diversity Lecture 11 Immunology and disease: parasite antigenic diversity RNAi interference video and tutorial (you are responsible for this material, so check it out.) http://www.pbs.org/wgbh/nova/sciencenow/3210/02.html

More information

Antiretroviral Prophylaxis and HIV Drug Resistance. John Mellors University of Pittsburgh

Antiretroviral Prophylaxis and HIV Drug Resistance. John Mellors University of Pittsburgh Antiretroviral Prophylaxis and HIV Drug Resistance John Mellors University of Pittsburgh MTN Annual 2008 Outline Two minutes on terminology Origins of HIV drug resistance Lessons learned from ART Do these

More information

Antibody Dependent Cellular Cytotxic activity: Past and Future. Guido Ferrari, M.D. Duke University Medical Center

Antibody Dependent Cellular Cytotxic activity: Past and Future. Guido Ferrari, M.D. Duke University Medical Center Antibody Dependent Cellular Cytotxic activity: Past and Future Guido Ferrari, M.D. Duke University Medical Center Mechanism of Antibody Dependent Cellular Cytotoxicity (ADCC) ADCC Effector Cells (NK, monocytes/macrophages,

More information

Vertical T cell immunodominance and epitope entropy determine HIV-1 escape

Vertical T cell immunodominance and epitope entropy determine HIV-1 escape Vertical T cell immunodominance and epitope entropy determine HIV-1 escape Michael K.P. Liu,, Andrew McMichael, Nilu Goonetilleke J Clin Invest. 2013;123(1):380-393. https://doi.org/10.1172/jci65330. Research

More information

Therapeutic Cancer Vaccines

Therapeutic Cancer Vaccines Therapeutic Cancer Vaccines Goal for all therapeutic cancer vaccines: To enhance the natural immune response so that it becomes an effective therapy Approaches being investigated in clinical studies: Whole

More information

Immunization with Single-Cycle SIV Significantly Reduces Viral Loads After an Intravenous Challenge with SIV mac 239

Immunization with Single-Cycle SIV Significantly Reduces Viral Loads After an Intravenous Challenge with SIV mac 239 Immunization with Single-Cycle SIV Significantly Reduces Viral Loads After an Intravenous Challenge with SIV mac 239 Bin Jia 1, Sharon K. Ng 1, M. Quinn DeGottardi 1, Michael Piatak Jr. 2, Eloísa Yuste

More information

HIV 101: Fundamentals of HIV Infection

HIV 101: Fundamentals of HIV Infection HIV 101: Fundamentals of HIV Infection David H. Spach, MD Professor of Medicine University of Washington Seattle, Washington Learning Objectives After attending this presentation, learners will be able

More information

Epitope-Specific CD8 + T Cell Kinetics Rather than Viral Variability Determine the Timing of Immune Escape in Simian Immunodeficiency Virus Infection

Epitope-Specific CD8 + T Cell Kinetics Rather than Viral Variability Determine the Timing of Immune Escape in Simian Immunodeficiency Virus Infection Published March 30, 2015, doi:10.4049/jimmunol.1400793 The Journal of Immunology Epitope-Specific CD8 + T Cell Kinetics Rather than Viral Variability Determine the Timing of Immune Escape in Simian Immunodeficiency

More information

Combinatorial Vaccines for AIDS and other Infectious Diseases

Combinatorial Vaccines for AIDS and other Infectious Diseases Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health Department of Health and Human Services Combinatorial Vaccines for AIDS

More information

DNA and Protein Vaccination Confers Protection Upon Mucosal Challenge with Heterologous SIVsmE660 (OA 10.04)

DNA and Protein Vaccination Confers Protection Upon Mucosal Challenge with Heterologous SIVsmE660 (OA 10.04) DNA and Protein Vaccination Confers Protection Upon Mucosal Challenge with Heterologous SIVsmE660 (OA 10.04) Rashmi Jalah Human Retrovirus Pathogenesis Section, Vaccine Branch, CCR, National Cancer Institute

More information

Supporting Information

Supporting Information Supporting Information Horwitz et al. 73/pnas.35295 A Copies ml - C 3NC7 7 697 698 7 7 73 76-2 2 Days Gp2 residue G458D G459D T278A 7/36 N28 K D 28 459 A28T ID# 697 ID# 698 ID# 7 ID# 7 ID# 73 ID# 76 ID#

More information

Development of Broadly Reactive HIV-1/AIDS Virus-like Particle Vaccines. Sean Patrick McBurney. B.S. Microbiology, University of Pittsburgh, 2004

Development of Broadly Reactive HIV-1/AIDS Virus-like Particle Vaccines. Sean Patrick McBurney. B.S. Microbiology, University of Pittsburgh, 2004 Development of Broadly Reactive HIV-1/AIDS Virus-like Particle Vaccines by Sean Patrick McBurney B.S. Microbiology, University of Pittsburgh, 2004 Submitted to the Graduate Faculty of School of Medicine

More information

Novel Heterologous Prime-Boost Vaccine Strategies for HIV. Dan Barouch April 18, 2012

Novel Heterologous Prime-Boost Vaccine Strategies for HIV. Dan Barouch April 18, 2012 Novel Heterologous Prime-Boost Vaccine Strategies for HIV Dan Barouch April 18, 2012 Desired Features of a Next Generation HIV-1 Vaccine Candidate The RV1 study suggests that an HIV-1 vaccine is possible

More information

The potential role of PD-1/PD-L1 blockade in HIV Remission and Cure Strategies

The potential role of PD-1/PD-L1 blockade in HIV Remission and Cure Strategies The potential role of PD-1/PD-L1 blockade in HIV Remission and Cure Strategies Stephen Mason Director, Discovery Virology Bristol-Myers Squibb Community Cure Workshop 2015 Sunday, Feb 22, 2015 Seattle,

More information

Therapeutic DNA Vaccine Induces Broad T Cell Responses in the Gut and Sustained Protection from Viral Rebound and AIDS in SIV-Infected Rhesus Macaques

Therapeutic DNA Vaccine Induces Broad T Cell Responses in the Gut and Sustained Protection from Viral Rebound and AIDS in SIV-Infected Rhesus Macaques Therapeutic DNA Vaccine Induces Broad T Cell Responses in the Gut and Sustained Protection from Viral Rebound and AIDS in SIV-Infected Rhesus Macaques Deborah Heydenburg Fuller 1,2,3 * a, Premeela Rajakumar

More information

Supplementary information. Early development of broad neutralizing antibodies in HIV-1 infected infants

Supplementary information. Early development of broad neutralizing antibodies in HIV-1 infected infants Supplementary information Early development of broad neutralizing antibodies in HIV-1 infected infants Leslie Goo, Vrasha Chohan, Ruth Nduati, Julie Overbaugh Supplementary Figure 1. Neutralization profile

More information

Alternate Antibody-Based Therapeutic Strategies To Purge the HIV Cell Reservoir

Alternate Antibody-Based Therapeutic Strategies To Purge the HIV Cell Reservoir Alternate Antibody-Based Therapeutic Strategies To Purge the HIV Cell Reservoir Giuseppe Pantaleo, M.D. Professor of Medicine Head, Division of Immunology and Allergy Executive Director, Swiss Vaccine

More information

NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2009 July 1.

NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2009 July 1. NIH Public Access Author Manuscript Published in final edited form as: Nature. 2009 January 1; 457(7225): 87 91. doi:10.1038/nature07469. Immune Control of an SIV Challenge by a T Cell-Based Vaccine in

More information

Transmitted Virus Fitness and Host T Cell Responses Collectively Define Divergent Infection Outcomes in Two HIV-1 Recipients

Transmitted Virus Fitness and Host T Cell Responses Collectively Define Divergent Infection Outcomes in Two HIV-1 Recipients Transmitted Virus Fitness and Host T Cell Responses Collectively Define Divergent Infection Outcomes in Two HIV-1 Recipients Ling Yue, Emory University Katja J. Pfafferott, University of Oxford Joshua

More information

Understanding HIV. Transmitted/Founder Viruses. Brandon Keele SAIC-Frederick National Cancer Institute

Understanding HIV. Transmitted/Founder Viruses. Brandon Keele SAIC-Frederick National Cancer Institute Understanding HIV Transmission Utilizing Transmitted/Founder Viruses Brandon Keele SAIC-Frederick National Cancer Institute AIDS Vaccine 2011 15 September 2011 Overview Several years ago, the CHAVI sought

More information

Anti-SIV Cytolytic Molecules in Pigtail Macaques

Anti-SIV Cytolytic Molecules in Pigtail Macaques AIDS RESEARCH AND HUMAN RETROVIRUSES Volume 24, Number 8, 2008 Mary Ann Liebert, Inc. DOI: 10.1089/aid.2008.0081 Anti-SIV Cytolytic Molecules in Pigtail Macaques Erik Rollman, Stephen J. Turner, Katherine

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Notes 1: accuracy of prediction algorithms for peptide binding affinities to HLA and Mamu alleles For each HLA and Mamu allele we have analyzed the accuracy of four predictive algorithms

More information

Current Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a Case Study

Current Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a Case Study Note: I have added some clarifying comments to the slides -- please click on Comments under View to see them. Current Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a

More information

Why are validated immunogenicity assays important for HIV vaccine development?

Why are validated immunogenicity assays important for HIV vaccine development? Why are validated immunogenicity assays important for HIV vaccine development? There is a need to compare immunogenicity of products in the pipeline, when similar or different in class when developed by

More information

HIV and Challenges of Vaccine Development

HIV and Challenges of Vaccine Development Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health HIV and Challenges of Vaccine Development Richard A. Koup, MD INTEREST

More information

Approaching a Cure Daniel R. Kuritzkes, MD

Approaching a Cure Daniel R. Kuritzkes, MD Approaching a Cure Daniel R. Kuritzkes, MD Division of Infectious Diseases Brigham and Women s Hospital Harvard Medical School Disclosures The speaker is a consultant and/or has received speaking honoraria

More information

JOURNAL OF VIROLOGY, Oct. 1999, p Vol. 73, No. 10. Copyright 1999, American Society for Microbiology. All Rights Reserved.

JOURNAL OF VIROLOGY, Oct. 1999, p Vol. 73, No. 10. Copyright 1999, American Society for Microbiology. All Rights Reserved. JOURNAL OF VIROLOGY, Oct. 1999, p. 8201 8215 Vol. 73, No. 10 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Role of Immune Responses against the Envelope

More information

MedChem 401~ Retroviridae. Retroviridae

MedChem 401~ Retroviridae. Retroviridae MedChem 401~ Retroviridae Retroviruses plus-sense RNA genome (!8-10 kb) protein capsid lipid envelop envelope glycoproteins reverse transcriptase enzyme integrase enzyme protease enzyme Retroviridae The

More information

Co-evolution of host and pathogen: HIV as a model. Can Keşmir Theoretical Biology/Bioinformatics Utrecht University, NL

Co-evolution of host and pathogen: HIV as a model. Can Keşmir Theoretical Biology/Bioinformatics Utrecht University, NL Co-evolution of host and pathogen: HIV as a model Can Keşmir Theoretical Biology/Bioinformatics Utrecht University, NL c.kesmir@bio.uu.nl Outline Does HIV adapt to monomorphic human molecules? Polymorphic

More information

How germinal centers evolve broadly neutralizing antibodies: the breadth of the follicular helper T cell response.

How germinal centers evolve broadly neutralizing antibodies: the breadth of the follicular helper T cell response. JVI Accepted Manuscript Posted Online 6 September 2017 J. Virol. doi:10.1128/jvi.00983-17 Copyright 2017 American Society for Microbiology. All Rights Reserved. 1 2 How germinal centers evolve broadly

More information

Low-Level Viremia in HIV

Low-Level Viremia in HIV Mountain West AIDS Education and Training Center Low-Level Viremia in HIV Brian R. Wood, MD Medical Director, Mountain West AETC ECHO Telehealth Program Assistant Professor of Medicine, University of Washington

More information

CD4 + T-cell-inducing HIV vaccines may have an impact on viral control

CD4 + T-cell-inducing HIV vaccines may have an impact on viral control CD4 + T-cell-inducing HIV vaccines may have an impact on viral control Clues from cytokines produced by CD4 + T-cells from HIVinfected patients and vaccinated seronegative volunteers Eva Van Braeckel 1,

More information

Can HIV be cured? (how about long term Drug free remission?)

Can HIV be cured? (how about long term Drug free remission?) Can HIV be cured? (how about long term Drug free remission?) Shirin Heidari International AIDS Society EC Think Tank meeting 27-28 October 2010 Luxemburg HAART can control HIV, cannot eradicate it Life

More information

JAK3 inhibitor administration in vivo in chronically SIV Infected Rhesus Macaques

JAK3 inhibitor administration in vivo in chronically SIV Infected Rhesus Macaques JAK3 inhibitor administration in vivo in chronically SIV Infected Rhesus Macaques preferentially depletes NK Cells Ladawan Kowawisatsut 1 Kovit Pattanapanyasat 1 Aftab A. Ansari 2 1 Department of Immunology

More information

Generation of Neutralizing Antibodies and Divergence of SIVmac239 in Cynomolgus Macaques Following Short- Term Early Antiretroviral Therapy

Generation of Neutralizing Antibodies and Divergence of SIVmac239 in Cynomolgus Macaques Following Short- Term Early Antiretroviral Therapy Generation of Neutralizing Antibodies and Divergence of SIVmac239 in Cynomolgus Macaques Following Short- Term Early Antiretroviral Therapy Gülşen Özkaya Şahin 1., Emma J. Bowles 2., Joe Parker 2, Hannes

More information

Chronic HIV-1 Infection Frequently Fails to Protect against Superinfection

Chronic HIV-1 Infection Frequently Fails to Protect against Superinfection Chronic HIV-1 Infection Frequently Fails to Protect against Superinfection Anne Piantadosi 1,2[, Bhavna Chohan 1,2[, Vrasha Chohan 3, R. Scott McClelland 3,4,5, Julie Overbaugh 1,2* 1 Division of Human

More information

Challenges in Designing HIV Env Immunogens for Developing a Vaccine

Challenges in Designing HIV Env Immunogens for Developing a Vaccine b514_chapter-13.qxd 12/4/2007 3:39 PM Page 327 Chapter 13 Challenges in Designing HIV Env Immunogens for Developing a Vaccine Indresh K. Srivastava* and R. Holland Cheng Summary HIV continues to be a major

More information

HIV Vaccine. Sunee Sirivichayakul, Ph.D. Faculty of Medicine Chulalongkorn University. August 22, 2014

HIV Vaccine. Sunee Sirivichayakul, Ph.D. Faculty of Medicine Chulalongkorn University. August 22, 2014 HIV Vaccine Sunee Sirivichayakul, Ph.D. Faculty of Medicine Chulalongkorn University August 22, 2014 Immunity Natural immunity Active natural immunity e.g., infection Passive natural immunity e.g., trans-placental

More information

The first T cell response to transmitted/ founder virus contributes to the control of acute viremia in HIV-1 infection

The first T cell response to transmitted/ founder virus contributes to the control of acute viremia in HIV-1 infection Published Online: 1 June, 2009 Supp Info: http://doi.org/10.1084/jem.20090365 Downloaded from jem.rupress.org on December 10, 2018 ARTICLE The first T cell response to transmitted/ founder virus contributes

More information

Development of a Universal T Cell Vaccine. Tomáš Hanke Weatherall Institute of Molecular Medicine University of Oxford United Kingdom

Development of a Universal T Cell Vaccine. Tomáš Hanke Weatherall Institute of Molecular Medicine University of Oxford United Kingdom Development of a Universal T Cell Vaccine Tomáš Hanke Weatherall Institute of Molecular Medicine University of Oxford United Kingdom Development of HIV-1 vaccines Induction of cell-mediated responses Immunogens

More information

Should There be Further Efficacy Testing of T-T cell Based Vaccines that do not Induce Broadly Neutralizing Antibodies?

Should There be Further Efficacy Testing of T-T cell Based Vaccines that do not Induce Broadly Neutralizing Antibodies? Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health Department of Health and Human Services Should There be Further Efficacy

More information

2005 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.

2005 LANDES BIOSCIENCE. DO NOT DISTRIBUTE. [Human Vaccines 1:2, 45-60; March/April 2005]; 2005 Landes Bioscience Review Role of Neutralizing Antibodies in Protective Immunity Against HIV Indresh K. Srivastava* Jeffrey B. Ulmer Susan W. Barnett

More information

SYSTEMS BIOLOGY APPROACHES TO IDENTIFY MECHANISMS OF IMMUNE MEDIATED PROTECTION TRANSLATING RESEARCH INTO HEALTH

SYSTEMS BIOLOGY APPROACHES TO IDENTIFY MECHANISMS OF IMMUNE MEDIATED PROTECTION TRANSLATING RESEARCH INTO HEALTH SYSTEMS BIOLOGY APPROACHES TO IDENTIFY MECHANISMS OF IMMUNE MEDIATED PROTECTION TRANSLATING RESEARCH INTO HEALTH Novel assays to decipher protective immune responses Decoding the immune response to infectious

More information

Immune correlates of protection from congenital cytomegalovirus after primary infection in pregnancy

Immune correlates of protection from congenital cytomegalovirus after primary infection in pregnancy Laboratori Sperimentali di Ricerca, Fondazione IRCCS Policlinico San Matteo, Pavia, Italia Immune correlates of protection from congenital cytomegalovirus after primary infection in pregnancy Daniele Lilleri

More information

Escaich Sonia, COO BIOSANTECH SA.

Escaich Sonia, COO BIOSANTECH SA. Escaich Sonia, COO SA. Transactivator of transcription (Tat) of HIV-1 is essential for the viral gene expression and productive infection Tat protein expression is a first step of the virus life cycle

More information

Citation for published version (APA): Von Eije, K. J. (2009). RNAi based gene therapy for HIV-1, from bench to bedside

Citation for published version (APA): Von Eije, K. J. (2009). RNAi based gene therapy for HIV-1, from bench to bedside UvA-DARE (Digital Academic Repository) RNAi based gene therapy for HIV-1, from bench to bedside Von Eije, K.J. Link to publication Citation for published version (APA): Von Eije, K. J. (2009). RNAi based

More information

Dynamics of lentiviral infection in vivo in the absence of adaptive immune responses

Dynamics of lentiviral infection in vivo in the absence of adaptive immune responses Dynamics of lentiviral infection in vivo in the absence of adaptive immune responses Elissa J. Schwartz Associate Professor School of Biological Sciences Department of Mathematics & Statistics Washington

More information

A Path to an HIV Vaccine: GSID Consortium Activities. Faruk Sinangil, PhD 4th Annual CAVD Meeting Miami, FL December 1-4, 2009

A Path to an HIV Vaccine: GSID Consortium Activities. Faruk Sinangil, PhD 4th Annual CAVD Meeting Miami, FL December 1-4, 2009 A Path to an HIV Vaccine: GSID Consortium Activities Faruk Sinangil, PhD 4th Annual CAVD Meeting Miami, FL December 1-4, 2009 Project Goals Acquire and disseminate information that will contribute to the

More information

Rapid Degranulation of NK Cells following Activation by HIV-Specific Antibodies

Rapid Degranulation of NK Cells following Activation by HIV-Specific Antibodies This information is current as of December 7, 2018. Rapid Degranulation of NK Cells following Activation by HIV-Specific Antibodies Amy W. Chung, Erik Rollman, Rob J. Center, Stephen J. Kent and Ivan Stratov

More information

Prevention of infection 2 : immunisation. How infection influences the host : viruses. Peter

Prevention of infection 2 : immunisation. How infection influences the host : viruses. Peter Prevention of infection 2 : immunisation How infection influences the host : viruses Peter Balfe, p.balfe@bham.ac.uk @pbalfeuk Let s have some LO s just for fun 1. Define the Immune response to viruses,

More information

Min Levine, Ph. D. Influenza Division US Centers for Disease Control and Prevention. June 18, 2015 NIBSC

Min Levine, Ph. D. Influenza Division US Centers for Disease Control and Prevention. June 18, 2015 NIBSC Workshop on Immunoassay Standardization for Universal Flu Vaccines Min Levine, Ph. D. Influenza Division US Centers for Disease Control and Prevention June 18, 2015 NIBSC 1 Multiple Immune Mechanisms Contribute

More information

NEUTRALIZING ANTIBODY-MEDIATED CONTROL OF LENTIVIRUS INFECTION SANDRA D. TAYLOR

NEUTRALIZING ANTIBODY-MEDIATED CONTROL OF LENTIVIRUS INFECTION SANDRA D. TAYLOR NEUTRALIZING ANTIBODY-MEDIATED CONTROL OF LENTIVIRUS INFECTION By SANDRA D. TAYLOR A dissertation submitted in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY WASHINGTON

More information

Selection on the Human Immunodeficiency Virus Type 1 Proteome following Primary Infection

Selection on the Human Immunodeficiency Virus Type 1 Proteome following Primary Infection JOURNAL OF VIROLOGY, Oct. 2006, p. 9519 9529 Vol. 80, No. 19 0022-538X/06/$08.00 0 doi:10.1128/jvi.00575-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Selection on the Human

More information

We are IntechOpen, the first native scientific publisher of Open Access books. International authors and editors. Our authors are among the TOP 1%

We are IntechOpen, the first native scientific publisher of Open Access books. International authors and editors. Our authors are among the TOP 1% We are IntechOpen, the first native scientific publisher of Open Access books 3,350 108,000 1.7 M Open access books available International authors and editors Downloads Our authors are among the 151 Countries

More information

MID 36. Cell. HIV Life Cycle. HIV Diagnosis and Pathogenesis. HIV-1 Virion HIV Entry. Life Cycle of HIV HIV Entry. Scott M. Hammer, M.D.

MID 36. Cell. HIV Life Cycle. HIV Diagnosis and Pathogenesis. HIV-1 Virion HIV Entry. Life Cycle of HIV HIV Entry. Scott M. Hammer, M.D. Life Cycle Diagnosis and Pathogenesis Scott M. Hammer, M.D. -1 Virion Entry Life Cycle of Entry -1 virion -1 Virus virion envelope Cell membrane receptor RELEASE OF PROGENY VIRUS REVERSE Co- TRANSCRIPTION

More information

Supporting Information

Supporting Information Supporting Information Walker et al. 1.173/pnas.111753118 - JR-CSF 1 3 1 4 1 5 1 6 1 7 1 8 blank beads protein A beads JR-FL - 1 3 1 4 1 5 1 6 1 7 1 8 - MGRM-C26 1 3 1 4 1 5 1 6 1 7 1 8 reciprocal serum

More information

CD8 + T Cells from SIV Elite Controller Macaques Recognize Mamu-B*08-Bound Epitopes and Select for Widespread Viral Variation

CD8 + T Cells from SIV Elite Controller Macaques Recognize Mamu-B*08-Bound Epitopes and Select for Widespread Viral Variation CD8 + T Cells from SIV Elite Controller Macaques Recognize Mamu-B*08-Bound Epitopes and Select for Widespread Viral Variation John T. Loffredo 1. *, Thomas C. Friedrich 1., Enrique J. León 1, Jason J.

More information

Progress on new vaccine strategies against chronic viral infections

Progress on new vaccine strategies against chronic viral infections Progress on new vaccine strategies against chronic viral infections Jay A. Berzofsky,, Masaki Terabe, Igor M. Belyakov J Clin Invest. 2004;114(4):450-462. https://doi.org/10.1172/jci22674. Review Among

More information

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone.

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. alpha beta ATGCTCCTGCTGCTCGTCCCAGTGCTCGAGGTGATTTTTACTCTGGGAGGAACCAGAGCC CAGTCGGTGACCCAGCTTGACAGCCACGTCTCTGTCTCTGAAGGAACCCCGGTGCTGCTG

More information