The Human Major Histocompatibility Complex

Size: px
Start display at page:

Download "The Human Major Histocompatibility Complex"

Transcription

1 The Human Major Histocompatibility Complex 1

2 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):

3 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3

4 Structure of HLA Class I and Class II Molecules NEJM 343(10):

5 Cellular Distribution of HLA Class I and Class II Molecules HLA Class I: Expressed on the surface of nearly all nucleated cells The highest level of Class I molecules are expressed on lymphocytes Fibroblasts, muscle cells, hepatocytes and neural cells express very low levels of Class I molecules HLA Class II: Expressed primarily on Ag-presenting cells (macrophages, dendritic cells and B cells) 5

6 Antigen Processing and Presentation HLA Class I HLA Class II NEJM 343(10):

7 Interaction Between T-Cell Receptor and HLA - Peptide Complex 7

8 HLA Class I Molecule 8

9 HLA Class I Molecule Peptide-binding cleft binds 8-10 amino acids in length 9

10 HLA Class II Molecule Peptide-binding cleft binds amino acids in length 10

11 Polymorphism in HLA Class I Genes In the human population, over 11,000 HLA Class I alleles have been identified some are null alleles, synonymous or differ in intronic region Number of polymorphisms (alleles) HLA Class I 11,859 Alleles (Dec. 2016) 0 A B C 11

12 Polymorphism in HLA Class II Genes In the human population, over 3,800 HLA Class II alleles have been identified some are null alleles, synonymous or differ in intronic region Number of polymorphisms (alleles) HLA Class II 3,805 Alleles (Dec. 2016) 0 DR DQ DP 12

13 HLA Nomenclature 13

14 Additional Suffixes Added to the Allele Number to Indicate Expression Status: N L Null alleles that have been shown not to be expressed i.e. B*15:190N Low cell surface expression i.e. A*24:02:01:02L S Q Secreted molecule but not expressed on cell surface i.e. B*44:02:01:02S Questionable allele expression on cell surface i.e. A*23:19Q 14

15 Our Laboratory s Current HLA Typing Approach Sequence Specific Primers (SSP) Low / Intermediate Resolution Typing Resolve Ambiguities Reverse Sequence Specific Oligonucleotide (rsso) Luminex Low / Intermediate Resolution Typing High-throughput Typing Sequence Based Typing (SBT) High Resolution Typing Low / Intermediate Resolution Typing High-throughput Typing 15

16 SSP - Agarose Gel Electrophoresis 16

17 Intermediate Resolution HLA Typing (rsso) rsso: Reverse Sequence Specific Oligonucleotide Genomic DNA is PCR amplified by locus specific primers The PCR product is hybridized with a panel of probes (bound to fluorescently coded microbeads) directed against known polymorphisms The assignment of the HLA typing is determined by analysis software 17

18 rsso Luminex 18

19 High Resolution HLA Typing (SBT) SBT: Sequence Based Typing Genomic DNA is PCR amplified Each HLA locus is amplified with either generic primers or allele specific primers Amplified DNA is used as a template for sequencing reactions using fluorescent dye-labeled dideoxynucleotides (ddatp, ddttp, ddctp, ddgtp) Fluorescently labeled sequence fragments are analyzed by a capillary DNA sequencer for laser detection The assignment of the HLA typing is determined by analysis software 19

20 Sequence Based Typing (SBT) 20

21 HLA Typing Ambiguities Due to Heterozygous Sequence HLA Class I sequencing of exons 2 and 3 may give: HLA-B*44:02/*44:19N/*44:27 HLA-B*44:02 is the most common allele HLA-B*44:19N has a single base substitution in exon 1 (not analyzed) HLA-B*44:27 has a single base substitution in exon 4 (not analyzed) HLA-C*04:01/*04:09N HLA-C*04:01 is the most common allele HLA-C*04:09N has a single base deletion in exon 7 (not analyzed) HLA-DRB1 sequencing of exon 2 may give: HLA-DRB1*14:01/*14:54 HLA-DRB1*14:54 is the common allele HLA-DRB1*14:54 has a single base substitution in exon 3 (not analyzed) 21

22 Reporting of Ambiguous Heterozygous HLA Typing: Ambiguous HLA Typing Exon Identity A*02:16/02:131 A*02:03:01/02:03:06/02:253/02:264/02:370/02:480/02:505/ 02:557 B*13:02:01:01/13:02:01:02/13:02:01:03/13:02:05/13:02:09/ 13:02:16/13:38/13:69/13:96/13:99 C*16:01:01:01/16:01:01:02/16:01:01:03/16:01:01:04/16:58/ 16:97/16:100 DRB1*12:01:01:01/12:01:01:02/12:01:01:03/12:06/12:10/ 12:17 A*02:16P A*02:03:01G B*13:02:01G C*16:01:01G DRB1*12:01:01G Class I Exons 2 and 3 Class II Exon 2 22

23 CASE STUDY: HLA Typing Discrepancy Method Allele 1 Allele 2 rsso DRB1*14:01 DRB1*16:02 SBT (Typing Kit # 1) DRB1*14:01/ SBT (Typing Kit # 2) DRB1*14:01/54/113 DRB1*16 Novel 23

24 CASE STUDY: HLA Typing Discrepancy Codon 6, Position 16 24

25 Clinical Applications Solid Organ Transplantation Hematopoietic Stem Cell Transplantation Bone Marrow Cord Blood Non-transplant Applications Population Studies Disease Association Drug Sensitivity Platelet /Transfusion Medicine 25

26 HLA and Hematopoietic Cell Transplantation GvH HLA Mismatch Patient has HLA alleles not present in the donor Patient Donor A*02:01:01 A*23:01:01 A*02:01:01 A*02:01:01 B*08:01:01 B*07:01:01 B*08:01:01 B*07:01:01 C*03:03:01 C*07:01:01 C*03:03:01 C*07:01:01 DRB1*01:02:01 DRB1*04:01:01 DRB1*01:02:01 DRB1*01:02:01 DQB1*03:02:01 DQB1*05:01 DQB1*03:02:01 DQB1*05:01 26

27 HLA and Hematopoietic Cell Transplantation Rejection HLA Mismatch Donor has HLA alleles not present in the patient Patient Donor A*26:01:01 A*33:03:01 A*26:01:01 A*33:03:01 B*40:02:01 B*40:02:01 B*40:02:01 B*48:01:01 C*03:03:01 C*08:01:01 C*03:03:01 C*08:01:01 DRB1*03:01:01 DRB1*15:01:01 DRB1*03:01:01 DRB1*15:01:01 DQB1*02:01:01 DQB1*06:02:01 DQB1*02:01:01 DQB1*06:02:01 27

Completing the CIBMTR Confirmation of HLA Typing Form (Form 2005)

Completing the CIBMTR Confirmation of HLA Typing Form (Form 2005) Completing the CIBMTR Confirmation of HLA Typing Form (Form 2005) Stephen Spellman Research Manager NMDP Scientific Services Maria Brown Scientific Services Specialist Data Management Conference 2007 1

More information

Histocompatibility Evaluations for HSCT at JHMI. M. Sue Leffell, PhD. Professor of Medicine Laboratory Director

Histocompatibility Evaluations for HSCT at JHMI. M. Sue Leffell, PhD. Professor of Medicine Laboratory Director Histocompatibility Evaluations for HSCT at JHMI M. Sue Leffell, PhD Professor of Medicine Laboratory Director JHMI Patient Population Adults Peds NMDP data >20,000 HSCT JHMI HSCT Protocols Bone marrow

More information

10/18/2012. A primer in HLA: The who, what, how and why. What?

10/18/2012. A primer in HLA: The who, what, how and why. What? A primer in HLA: The who, what, how and why What? 1 First recognized in mice during 1930 s and 1940 s. Mouse (murine) experiments with tumors Independent observations were made in humans with leukoagglutinating

More information

Basel - 6 September J.-M. Tiercy National Reference Laboratory for Histocompatibility (LNRH) University Hospital Geneva

Basel - 6 September J.-M. Tiercy National Reference Laboratory for Histocompatibility (LNRH) University Hospital Geneva Basel - 6 eptember 2012 J.-M. Tiercy National Reference Laboratory for Histocompatibility (LNRH) University Hospital Geneva Outline the HLA system is (a) complex anti-hla immunisation and alloreactivity

More information

Human Leukocyte Antigens and donor selection

Human Leukocyte Antigens and donor selection Human Leukocyte Antigens and donor selection Duangtawan Thammanichanond, MD. PhD. Histocompatibility and Immunogenetics Laboratory, Faculty of Medicine Ramathibodi Hospital, Mahidol University Outline

More information

Significance of the MHC

Significance of the MHC CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

Documentation of Changes to EFI Standards: v 5.6.1

Documentation of Changes to EFI Standards: v 5.6.1 Modified Standard B - PERSONNEL QUALIFICATIONS B1.000 The laboratory must employ one or more individuals who meet the qualifications and fulfil the responsibilities of the Director/Co-Director, Technical

More information

The Major Histocompatibility Complex (MHC)

The Major Histocompatibility Complex (MHC) The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens

More information

The role of HLA in Allogeneic Hematopoietic Stem Cell Transplantation and Platelet Refractoriness.

The role of HLA in Allogeneic Hematopoietic Stem Cell Transplantation and Platelet Refractoriness. The role of HLA in Allogeneic Hematopoietic Stem Cell Transplantation and Platelet Refractoriness. Robert Liwski, MD, PhD, FRCPC Medical Director HLA Typing Laboratory Department of Pathology Dalhousie

More information

25/10/2017. Clinical Relevance of the HLA System in Blood Transfusion. Outline of talk. Major Histocompatibility Complex

25/10/2017. Clinical Relevance of the HLA System in Blood Transfusion. Outline of talk. Major Histocompatibility Complex Clinical Relevance of the HLA System in Blood Transfusion Dr Colin J Brown PhD FRCPath. October 2017 Outline of talk HLA genes, structure and function HLA and immune complications of transfusion TA-GVHD

More information

DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS

DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS The definitions below are intended as general concepts. There will be exceptions to these general definitions. These definitions do not imply any specific

More information

Validation of the MIA FORA NGS FLEX Assay Using Buccal Swabs as the Sample Source

Validation of the MIA FORA NGS FLEX Assay Using Buccal Swabs as the Sample Source S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. Introduction

More information

HLA Mismatches. Professor Steven GE Marsh. Anthony Nolan Research Institute EBMT Anthony Nolan Research Institute

HLA Mismatches. Professor Steven GE Marsh. Anthony Nolan Research Institute EBMT Anthony Nolan Research Institute HLA Mismatches Professor Steven GE Marsh HLA Mismatches HLA Genes, Structure, Polymorphism HLA Nomenclature HLA Mismatches in HSCT Defining a mismatch HLA Mismatches HLA Genes, Structure, Polymorphism

More information

Minimal Requirements for Histocompatibility & Immunogenetics Laboratory

Minimal Requirements for Histocompatibility & Immunogenetics Laboratory Minimal Requirements for Histocompatibility & Immunogenetics Laboratory The 4 th WBMT Congress and Workshop Riyadh, KSA - January 15-17, 2017 HLA Discovery, 1958 The Nobel Prize in Physiology or Medicine

More information

Clinical Relevance of the HLA System in Blood Transfusion. Dr Colin J Brown PhD FRCPath. October 2017

Clinical Relevance of the HLA System in Blood Transfusion. Dr Colin J Brown PhD FRCPath. October 2017 Clinical Relevance of the HLA System in Blood Transfusion Dr Colin J Brown PhD FRCPath. October 2017 Outline of talk HLA genes, structure and function HLA and immune complications of transfusion TA-GVHD

More information

The MHC and Transplantation Brendan Clark. Transplant Immunology, St James s University Hospital, Leeds, UK

The MHC and Transplantation Brendan Clark. Transplant Immunology, St James s University Hospital, Leeds, UK The MHC and Transplantation Brendan Clark Transplant Immunology, St James s University Hospital, Leeds, UK Blood Groups Immunofluorescent staining has revealed blood group substance in the cell membranes

More information

ASHI Proficiency Testing Program Summary Report. Survey 2013-HT1 / HLA Typing

ASHI Proficiency Testing Program Summary Report. Survey 2013-HT1 / HLA Typing ASHI Proficiency Testing Program Summary Report Survey 2013-HT1 / HLA Typing Shipping Date: February 26,2013 / Results Due Date:April 5,2013 / Report Date: May 17,2013 The ASHI HT proficiency testing survey

More information

MATCHMAKER, MATCHMAKER, MAKE ME A MATCH, FIND ME A MISMATCHED TRANSPLANT TO CATCH

MATCHMAKER, MATCHMAKER, MAKE ME A MATCH, FIND ME A MISMATCHED TRANSPLANT TO CATCH MATCHMAKER, MATCHMAKER, MAKE ME A MATCH, FIND ME A MISMATCHED TRANSPLANT TO CATCH TEJASWINI M. DHAWALE, M.D. HEME FELLOWS CONFERENCE NOVEMBER 08, 2013 CASE PRESENTATION 51 yo M with history of MDS (unilinear

More information

The Relationship between Minor Histocompatibility Antigens and Graft Versus Host Disease in Unrelated Peripheral Blood Stem Cell Transplants

The Relationship between Minor Histocompatibility Antigens and Graft Versus Host Disease in Unrelated Peripheral Blood Stem Cell Transplants mhags and GVHD Page 1 The Relationship between Minor Histocompatibility Antigens and Graft Versus Host Disease in Unrelated Peripheral Blood Stem Cell Transplants Running Title: mhags and GVHD Conflict

More information

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared

More information

HLA and new technologies. Vicky Van Sandt

HLA and new technologies. Vicky Van Sandt HLA and new technologies. Vicky Van Sandt Life-threatning malignant and non malignant blood disorders can be cured by hematopoetic stem cell transplantation (HSCT). GVHD is the 2nd most prevalent cause

More information

HLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012.

HLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012. www.ebmt.org HLA and more Ilias I.N. Doxiadis Geneva 03/04/2012 HLA and more HLA and more / Doxiadis 2 Topic of the day Compatibility testing is a type of testing used to ensure compatibility of the system/application/website

More information

Significance of the MHC

Significance of the MHC CHAPTER 8 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared

More information

Histocompatibility antigens

Histocompatibility antigens Histocompatibility antigens Tuesday 09 November 2010 Telegraph UK Livers grown in the laboratory could eventually solve organ transplant shortage. Made-to-measure organs for transplantation are a step

More information

Allele and Haplotype Frequencies of Human Leukocyte Antigen-A, -B, -C, -DRB1, and -DQB1 From Sequence- Based DNA Typing Data in Koreans

Allele and Haplotype Frequencies of Human Leukocyte Antigen-A, -B, -C, -DRB1, and -DQB1 From Sequence- Based DNA Typing Data in Koreans Original Article Diagnostic Immunology Ann Lab Med 2015;35:429-435 http://dx.doi.org/10.3343/alm.2015.35.4.429 ISSN 2234-3806 eissn 2234-3814 Allele and Haplotype Frequencies of Human Leukocyte Antigen-A,

More information

Cover Page. The handle holds various files of this Leiden University dissertation.

Cover Page. The handle   holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/20898 holds various files of this Leiden University dissertation. Author: Jöris, Monique Maria Title: Challenges in unrelated hematopoietic stem cell transplantation.

More information

ASSESSMENT OF THE RISK FOR TYPE 1 DIABETES MELLITUS CONFERRED BY HLA CLASS II GENES. Irina Durbală

ASSESSMENT OF THE RISK FOR TYPE 1 DIABETES MELLITUS CONFERRED BY HLA CLASS II GENES. Irina Durbală ASSESSMENT OF THE RISK FOR TYPE 1 DIABETES MELLITUS CONFERRED BY HLA CLASS II GENES Summary Irina Durbală CELL AND MOLECULAR BIOLOGY DEPARTMENT FACULTY OF MEDICINE, OVIDIUS UNIVERSITY CONSTANŢA Class II

More information

Specimen Collection Requirements. Test Name Specimen Type Storage Time Storage Conditions

Specimen Collection Requirements. Test Name Specimen Type Storage Time Storage Conditions 1 Specimen Collection Requirements PURPOSE/PRINCIPLE: To outline proper specimen collection for molecular HLA testing, including tube type, minimum specimen amount, proper tube and requisition labeling,

More information

FONS Nové sekvenační technologie vklinickédiagnostice?

FONS Nové sekvenační technologie vklinickédiagnostice? FONS 2010 Nové sekvenační technologie vklinickédiagnostice? Sekvenování amplikonů Sequence capture Celogenomové sekvenování FONS 2010 Sekvenování amplikonů Amplicon sequencing - amplicon sequencing enables

More information

Dr. Yi-chi M. Kong August 8, 2001 Benjamini. Ch. 19, Pgs Page 1 of 10 TRANSPLANTATION

Dr. Yi-chi M. Kong August 8, 2001 Benjamini. Ch. 19, Pgs Page 1 of 10 TRANSPLANTATION Benjamini. Ch. 19, Pgs 379-399 Page 1 of 10 TRANSPLANTATION I. KINDS OF GRAFTS II. RELATIONSHIPS BETWEEN DONOR AND RECIPIENT Benjamini. Ch. 19, Pgs 379-399 Page 2 of 10 II.GRAFT REJECTION IS IMMUNOLOGIC

More information

Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT

Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT Stephen Spellman, MBS Director, Immunobiology and Observational Research Assistant Scientific Director CIBMTR,

More information

HLA-A * L

HLA-A * L What is Nomenclature? HLA Nomenclature 3.0 Signifies DNA Subtype Differences outside the coding region (introns) HLA-A * 4 0 01 0 L Steve Spellman Sr. Manager, NMDP Asst. Scientific Director, CIBMTR Locus

More information

Significance of the MHC

Significance of the MHC CHAPTER 8 Major Histocompatibility Complex (MHC) What is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) - MHC molecules were initially discovered during studies aimed

More information

OPTN/UNOS Policy Notice Review of HLA Tables (2016)

OPTN/UNOS Policy Notice Review of HLA Tables (2016) Review of HLA Tables (2016) Sponsoring Committee: Policy/Bylaws Affected: Histocompatibility Policy 4.10 (Reference Tables of HLA Antigen Values and Split Equivalences) Public Comment: July 31, 2017 October

More information

HLA AND KIR GENE POLYMORPHISM IN HEMATOPOIETIC STEM CELL TRANSPLANTATION

HLA AND KIR GENE POLYMORPHISM IN HEMATOPOIETIC STEM CELL TRANSPLANTATION FROM THE DEPARTMENT OF LABORATORY MEDICINE, DIVISION OF CLINICAL IMMUNOLOGY KAROLINSKA INSTITUTET, STOCKHOLM, SWEDEN HLA AND KIR GENE POLYMORPHISM IN HEMATOPOIETIC STEM CELL TRANSPLANTATION Marie Schaffer

More information

Transplantation. Immunology Unit College of Medicine King Saud University

Transplantation. Immunology Unit College of Medicine King Saud University Transplantation Immunology Unit College of Medicine King Saud University Objectives To understand the diversity among human leukocyte antigens (HLA) or major histocompatibility complex (MHC) To know the

More information

CHAPTER 3 LABORATORY PROCEDURES

CHAPTER 3 LABORATORY PROCEDURES CHAPTER 3 LABORATORY PROCEDURES CHAPTER 3 LABORATORY PROCEDURES 3.1 HLA TYPING Molecular HLA typing will be performed for all donor cord blood units and patients in the three reference laboratories identified

More information

Calculation Tables. Olerup SSP Kits without Taq Polymeras

Calculation Tables. Olerup SSP Kits without Taq Polymeras Calculation Tables lerup SSP Kits without Taq Polymeras Table 1: Volumes of the components needed per test for different numbers of when using Master Mix without. The recommended volumes listed below include

More information

Calculation Tables. Olerup SSP Kits without Taq Polymeras

Calculation Tables. Olerup SSP Kits without Taq Polymeras Calculation Tables lerup SSP Kits without Polymeras Table 1: Volumes of the components needed per test for different numbers of when using Master Mix without. The recommended volumes listed below include

More information

EBMT2008_1_21:EBMT :06 Pagina 46 * CHAPTER 3. Immunogenetics of allogeneic HSCT * 3.1. The role of HLA in HSCT. J.M.

EBMT2008_1_21:EBMT :06 Pagina 46 * CHAPTER 3. Immunogenetics of allogeneic HSCT * 3.1. The role of HLA in HSCT. J.M. EBMT2008_1_21:EBMT2008 6-11-2008 9:06 Pagina 46 * CHAPTER 3 Immunogenetics of allogeneic HSCT * 3.1 The role of HLA in HSCT J.M. Tiercy EBMT2008_1_21:EBMT2008 6-11-2008 9:06 Pagina 47 CHAPTER 3.1 HLA and

More information

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria AIDS - Knowledge and Dogma Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/17 2010, Vienna, Austria Reliability of PCR to detect genetic sequences from HIV Juan Manuel

More information

IMMUNOLOGY. Elementary Knowledge of Major Histocompatibility Complex and HLA Typing

IMMUNOLOGY. Elementary Knowledge of Major Histocompatibility Complex and HLA Typing IMMUNOLOGY Elementary Knowledge of Major Histocompatibility Complex and HLA Typing Tapasya Srivastava and Subrata Sinha Department of Biochemistry All India Institute of Medical Sciences New Delhi - 110029

More information

Virtual Crossmatch in Kidney Transplantation

Virtual Crossmatch in Kidney Transplantation Virtual Crossmatch in Kidney Transplantation Shiva Samavat Associate Professor of Nephrology Labbafinejad Hospital SBMU 2018.11.21 All transplant candidates are screened to determine the degree of humoral

More information

21/05/2018. Continuing Education. Presentation Recording. learn.immucor.com

21/05/2018. Continuing Education. Presentation Recording. learn.immucor.com Transplant Webinar Series: Ep. 6 Donor Selection for Haematopoietic Stem Cell Transplantation Future Webinars The Role of NGS in the Transplant Setting Featuring Dr Sujatha Krishnakumar Sirona Genomics,

More information

Robert B. Colvin, M.D. Department of Pathology Massachusetts General Hospital Harvard Medical School

Robert B. Colvin, M.D. Department of Pathology Massachusetts General Hospital Harvard Medical School Harvard-MIT Division of Health Sciences and Technology HST.035: Principle and Practice of Human Pathology Dr. Robert B. Colvin Transplantation: Friendly organs in a hostile environment Robert B. Colvin,

More information

Transplant Booklet D Page 1

Transplant Booklet D Page 1 Booklet D Pretest Correct Answers 4. (A) is correct. Technically, performing a hematopoietic stem cell transplant is one of the simplest transplantation procedures. The hematopoietic stem cells are infused

More information

Antigen Presentation to T lymphocytes

Antigen Presentation to T lymphocytes Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman jhamerman@benaroyaresearch.org Office hours by arrangement Antigen processing: How are

More information

HISTOCOMPATIBILITY LABORATORIES

HISTOCOMPATIBILITY LABORATORIES HISTOCOMPATIBILITY LABORATORIES SERVICE PROVISION USER GUIDE Page 1 of 22 CONTENTS SERVICE PROVISION INTRODUCTION... 3 SUMMARY... 4 PROCEDURES UNDERTAKEN FOR HAEMATOPOIETIC STEM CELL TRANSPLATATION...

More information

Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany

Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany HLA ISSN 2059-2302 BRIEF COMMUNICATION Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany C. J. Hernández-Frederick 1, N. Cereb 2,A.S.Giani 1, J.

More information

The Use of HLA /HPA Selected Platelets

The Use of HLA /HPA Selected Platelets The Use of HLA /HPA Selected Platelets Dr Colin Brown PhD FRCPath. Consultant Clinical Scientist Histocompatibility and Immunogenetics HLA and Transfusion Human Leucocyte Antigens HLA Human Platelet Antigens

More information

Evaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group

Evaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,

More information

2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center

2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,

More information

HISTOCOMPATIBILITY LABORATORIES

HISTOCOMPATIBILITY LABORATORIES HISTOCOMPATIBILITY LABORATORIES SERVICE PROVISION USER GUIDE DOC45 Version 004 September 2015 Page 1 of 23 CONTENTS CONTENTS... 1 SERVICE PROVISION INTRODUCTION... 3 SUMMARY... 4 PROCEDURES UNDERTAKEN

More information

Basic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction

Basic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Basic Immunology Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Molecular structure of MHC, subclasses, genetics, functions. Antigen presentation and MHC restriction.

More information

Diversity and Frequencies of HLA Class I and Class II Genes of an East African Population

Diversity and Frequencies of HLA Class I and Class II Genes of an East African Population Open Journal of Genetics, 2014, 4, 99-124 Published Online April 2014 in SciRes. http://www.scirp.org/journal/ojgen http://dx.doi.org/10.4236/ojgen.2014.42013 Diversity and Frequencies of HLA Class I and

More information

the HLA complex Hanna Mustaniemi,

the HLA complex Hanna Mustaniemi, the HLA complex Hanna Mustaniemi, 28.11.2007 The Major Histocompatibility Complex Major histocompatibility complex (MHC) is a gene region found in nearly all vertebrates encodes proteins with important

More information

The Major Histocompatibility Complex of Genes

The Major Histocompatibility Complex of Genes The Major Histocompatibility Complex of Genes Topic 4 The Major Histocompatibility Complex Outline of Lectures The immunological reasons for transplant rejection How the MHC was discovered using inbred

More information

RNA based high-resolution HLA sequencing based typing

RNA based high-resolution HLA sequencing based typing Chapter 2 RNA based high-resolution HLA sequencing based typing Judith Reinders, Anna Houben, Alain van Mill, Erik Rozemuller, Jan van den Tweel and Marcel Tilanus Department of Pathology, University Medical

More information

HLA-A*26 and Susceptibility of Iranian Patients with Non-Hodgkin Lymphoma

HLA-A*26 and Susceptibility of Iranian Patients with Non-Hodgkin Lymphoma HLA-A*26 and Susceptibility of Iranian Patients with Non-Hodgkin Lymphoma Arezou Sayad 1, Mohammad Taghi Akbari 2**, Mahshid Mehdizadeh 3,4, Mohammad Taheri 1, Abbas Hajifathali 3* 1 Department of Medical

More information

The Major Histocompatibility Complex

The Major Histocompatibility Complex The Major Histocompatibility Complex Today we will discuss the MHC The study of MHC is necessary to understand how an immune response is generated. And these are the extra notes with respect to slides

More information

MHC class I MHC class II Structure of MHC antigens:

MHC class I MHC class II Structure of MHC antigens: MHC class I MHC class II Structure of MHC antigens: MHC class I antigens consist of a transmembrane heavy chain (α chain) that is non-covalently associated with β2- microglobulin. Membrane proximal domain

More information

10/7/ Immediate Action, Quest Diagnostics Nichols Institute, Valencia

10/7/ Immediate Action, Quest Diagnostics Nichols Institute, Valencia REDIRECTS Please Not all test codes assigned to each assay are listed in the table of contents. Please refer to the complete listing on the page numbers indicated. Test Code Test Name Effective Date Page

More information

How to Find an Unrelated Donor Theory & Technology

How to Find an Unrelated Donor Theory & Technology How to Find an Unrelated Donor Theory & Technology Carlheinz R. Müller Zentrales Knochenmarkspender-Register für die Bundesrepublik Deutschland (ZKRD) Ulm, Germany How to Find an Unrelated Donor HLA-Basics

More information

Historical definition of Antigen. An antigen is a foreign substance that elicits the production of antibodies that specifically binds to the antigen.

Historical definition of Antigen. An antigen is a foreign substance that elicits the production of antibodies that specifically binds to the antigen. Historical definition of Antigen An antigen is a foreign substance that elicits the production of antibodies that specifically binds to the antigen. Historical definition of Antigen An antigen is a foreign

More information

Haplo vs Cord vs URD Debate

Haplo vs Cord vs URD Debate 3rd Annual ASBMT Regional Conference for NPs, PAs and Fellows Haplo vs Cord vs URD Debate Claudio G. Brunstein Associate Professor University of Minnesota Medical School Take home message Finding a donor

More information

Factors Influencing Haematopoietic Progenitor cell transplant outcome Optimising donor selection

Factors Influencing Haematopoietic Progenitor cell transplant outcome Optimising donor selection Factors Influencing Haematopoietic Progenitor cell transplant outcome Optimising donor selection Alison Logan Transplantation Laboratory Manchester Royal Infirmary Haematopoietic progenitor cell transplants

More information

Two categories of immune response. immune response. infection. (adaptive) Later immune response. immune response

Two categories of immune response. immune response. infection. (adaptive) Later immune response. immune response Ivana FELLNEROVÁ E-mail: fellneri@hotmail.com, mob. 732154801 Basic immunogenetic terminology innate and adaptive immunity specificity and polymorphism immunoglobuline gene superfamily immunogenetics MHC

More information

- Transplantation: removing an organ from donor and gives it to a recipient. - Graft: transplanted organ.

- Transplantation: removing an organ from donor and gives it to a recipient. - Graft: transplanted organ. Immunology Lecture num. (21) Transplantation - Transplantation: removing an organ from donor and gives it to a recipient. - Graft: transplanted organ. Types of Graft (4 types): Auto Graft - From a person

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

[Some people are Rh positive and some are Rh negative whether they have the D antigen on the surface of their cells or not].

[Some people are Rh positive and some are Rh negative whether they have the D antigen on the surface of their cells or not]. Few things to add to agglutination subject: When you agglutinate red blood cells (hemagglutination) you cross link the antigens that are present on two adjacent red blood cells, and of course red blood

More information

Immunogenetics in SARS: a casecontrol

Immunogenetics in SARS: a casecontrol RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES MHL Ng 吳香玲 SH Cheng 鄭淑恆 KM Lau 劉建盟 GM Leung 梁卓偉 US Khoo 邱瑋璇 BCW Zee 徐仲鍈 JJY Sung 沈祖堯 Key Messages 1. Human leukocyte antigen (HLA) genotypes from 102

More information

The Anthony Nolan Trust Histocompatibility Laboratories & Operations Department Service Provision

The Anthony Nolan Trust Histocompatibility Laboratories & Operations Department Service Provision The Anthony Nolan Trust Histocompatibility Laboratories & Operations Department Registered Charity 803716/SC038827 Contents 1. Introduction... 2. Summary... 3. Procedures Undertaken for Haematopoietic

More information

Introduction to Clinical Hematopoietic Cell Transplantation (HCT) George Chen, MD Thursday, May 03, 2018

Introduction to Clinical Hematopoietic Cell Transplantation (HCT) George Chen, MD Thursday, May 03, 2018 Introduction to Clinical Hematopoietic Cell Transplantation (HCT) George Chen, MD Thursday, May 03, 2018 The transfer of hematopoietic progenitor and stem cells for therapeutic purposes Hematopoietic Cell

More information

SALSA MLPA KIT P050-B2 CAH

SALSA MLPA KIT P050-B2 CAH SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to

More information

AG MHC HLA APC Ii EPR TAP ABC CLIP TCR

AG MHC HLA APC Ii EPR TAP ABC CLIP TCR !! AG MHC HLA APC Ii EPR TAP ABC CLIP TCR Antigen Major Histocompartibility Complex Human Leukocyte Antigen Antigen Presenting Cell Invariant Chain Endoplasmatic Reticulum Transporters Associated with

More information

T-cell receptor feature. Antibody/antigen interaction. Major Histocompatibility Complex. Antigen processing. Antigen presentation

T-cell receptor feature. Antibody/antigen interaction. Major Histocompatibility Complex. Antigen processing. Antigen presentation ntibody/antigen interaction Major Histocompatibility Complex ntigen processing ntigen presentation PC/T-cell interaction T-cell receptor feature CD4+ T-Cell HL/peptide/TCR complex CD8+ T-Cell Proteasome

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

IVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois

IVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois FERTILITY AND STERILITY VOL. 80, NO. 4, OCTOBER 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Inc. Printed on acid-free paper in U.S.A. CASE REPORTS Preimplantation

More information

Major Histocompatibility Complex (MHC) and T Cell Receptors

Major Histocompatibility Complex (MHC) and T Cell Receptors Major Histocompatibility Complex (MHC) and T Cell Receptors Historical Background Genes in the MHC were first identified as being important genes in rejection of transplanted tissues Genes within the MHC

More information

Principles of Adaptive Immunity

Principles of Adaptive Immunity Principles of Adaptive Immunity Chapter 3 Parham Hans de Haard 17 th of May 2010 Agenda Recognition molecules of adaptive immune system Features adaptive immune system Immunoglobulins and T-cell receptors

More information

XIV. HLA AND TRANSPLANTATION MEDICINE

XIV. HLA AND TRANSPLANTATION MEDICINE XIV. HLA AND TRANSPLANTATION MEDICINE A. Introduction 1. The HLA system includes a complex array of genes and their molecular products that are involved in immune regulation and cellular differentiation.

More information

The Major Histocompatibility Complex (MHC)

The Major Histocompatibility Complex (MHC) Advanced molecular immunology-2011 The Major Histocompatibility Complex (MHC) Youmin Kang 2011.04.06 Activation IFN-g IL-4 IL-2 YYYYYY YYYYY B cells MHC class II pathway Discovery of MHC MHC Class I pathway

More information

BDC Keystone Genetics Type 1 Diabetes. Immunology of diabetes book with Teaching Slides

BDC Keystone Genetics Type 1 Diabetes.  Immunology of diabetes book with Teaching Slides BDC Keystone Genetics Type 1 Diabetes www.barbaradaviscenter.org Immunology of diabetes book with Teaching Slides PRACTICAL Trailnet screens relatives and new onset patients for autoantibodies and HLA

More information

Hematopoietic Stem Cells, Stem Cell Processing, and Transplantation

Hematopoietic Stem Cells, Stem Cell Processing, and Transplantation Hematopoietic Stem Cells, Stem Cell Processing, and Joseph (Yossi) Schwartz, M irector, Hemotherapy and Stem Cell Processing Facility Bone Marrow Can Cure: Leukemia Lymphoma Multiple Myeloma Genetic iseases:

More information

Antigen Recognition by T cells

Antigen Recognition by T cells Antigen Recognition by T cells TCR only recognize foreign Ags displayed on cell surface These Ags can derive from pathogens, which replicate within cells or from pathogens or their products that cells

More information

Handling Immunogenetic Data Managing and Validating HLA Data

Handling Immunogenetic Data Managing and Validating HLA Data Handling Immunogenetic Data Managing and Validating HLA Data Steven J. Mack PhD Children s Hospital Oakland Research Institute 16 th IHIW & Joint Conference Sunday 3 June, 2012 Overview 1. Master Analytical

More information

FIT Board Review Corner March 2016

FIT Board Review Corner March 2016 FIT Board Review Corner March 2016 Welcome to the FIT Board Review Corner, prepared by Sarah Spriet, DO, and Tammy Peng, MD, senior and junior representatives of ACAAI's Fellows-In-Training (FITs) to the

More information

7.012 Problem Set 4 October 28, 2005

7.012 Problem Set 4 October 28, 2005 Name TA Sec 7.012 Problem Set 4 October 28, 2005 Answers to this problem set must be inserted into the box outside 68-120 by 4:30 am, Thursday, November 3 rd. Problem sets will not be accepted late. Solutions

More information

LESSON 2: THE ADAPTIVE IMMUNITY

LESSON 2: THE ADAPTIVE IMMUNITY Introduction to immunology. LESSON 2: THE ADAPTIVE IMMUNITY Today we will get to know: The adaptive immunity T- and B-cells Antigens and their recognition How T-cells work 1 The adaptive immunity Unlike

More information

Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.

Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon

More information

IMMUNOGENETICS AND TRANSPLANTATION

IMMUNOGENETICS AND TRANSPLANTATION IMMUNOGENETICS AND TRANSPLANTATION WHAT S THE MHC GOT TO DO WITH TRANSPLANTATION? We have learned that the molecules of Class I and II MHC are involved in presenting antigenic peptides to the receptors

More information

TRANSPLANT IMMUNOLOGY. Shiv Pillai Ragon Institute of MGH, MIT and Harvard

TRANSPLANT IMMUNOLOGY. Shiv Pillai Ragon Institute of MGH, MIT and Harvard TRANSPLANT IMMUNOLOGY Shiv Pillai Ragon Institute of MGH, MIT and Harvard Outline MHC / HLA Direct vs indirect allorecognition Alloreactive cells: where do they come from? Rejection and Immunosuppression

More information

Management of platelet refractory patients, why does your patient keep on bleeding? Dr Colin Brown, H&I Dept, NHSBT Colindale

Management of platelet refractory patients, why does your patient keep on bleeding? Dr Colin Brown, H&I Dept, NHSBT Colindale Management of platelet refractory patients, why does your patient keep on bleeding? Dr Colin Brown, H&I Dept, NHSBT Colindale Pooled Platelets (Buffy Coat Derived) Adult dose from 4 ABO-identical donors

More information

Profiling HLA motifs by large scale peptide sequencing Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009

Profiling HLA motifs by large scale peptide sequencing Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009 Profiling HLA motifs by large scale peptide sequencing 2009 Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009 HLA Background The human leukocyte antigen system (HLA) is the

More information

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix. SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:

More information

T Cell Development. Xuefang Cao, MD, PhD. November 3, 2015

T Cell Development. Xuefang Cao, MD, PhD. November 3, 2015 T Cell Development Xuefang Cao, MD, PhD November 3, 2015 Thymocytes in the cortex of the thymus Early thymocytes development Positive and negative selection Lineage commitment Exit from the thymus and

More information

Predicting HLA Class II Alloantigen Immunogenicity From the Number and Physiochemical Properties of Amino Acid Polymorphisms

Predicting HLA Class II Alloantigen Immunogenicity From the Number and Physiochemical Properties of Amino Acid Polymorphisms CLINICAL AND TRANSLATIONAL RESEARCH Predicting HLA Class II Alloantigen Immunogenicity From the Number and Physiochemical Properties of Amino Acid Polymorphisms Vasilis Kosmoliaptsis, 1,2,6 Linda D. Sharples,

More information

16/01/2018. Pre-Transplant Immunogenetic and Immunological assessment for Hematopoietic Stem Cell Transplantation

16/01/2018. Pre-Transplant Immunogenetic and Immunological assessment for Hematopoietic Stem Cell Transplantation Pre-Transplant Immunogenetic and Immunological assessment for Hematopoietic Stem Cell Transplantation Dr UMA KANGA Dept. of Transplant Immunology & Immunogenetics umakanga@hotmail.com January 2018 Bone

More information

Pre-Transplant Immunogenetic and Immunological assessment for Hematopoietic Stem Cell Transplantation

Pre-Transplant Immunogenetic and Immunological assessment for Hematopoietic Stem Cell Transplantation Pre-Transplant Immunogenetic and Immunological assessment for Hematopoietic Stem Cell Transplantation Dr UMA KANGA Dept. of Transplant Immunology & Immunogenetics umakanga@hotmail.com January 2018 1 Bone

More information