Supplementary Material

Size: px
Start display at page:

Download "Supplementary Material"

Transcription

1 Supplementary Material Single-locus gene screening methods We screened for single nucleotide polymorphisms (SNPs) at 16 candidate immune genes (Table S1) by initially sequencing three captive-bred Attwater s prairie-chickens and one greater prairie-chicken from either the genetically diverse Kansas or Nebraska populations. If we found polymorphism among these sequences, we randomly selected an additional 16 Attwater s prairie-chickens to 8 genotype and identified exons by aligning each sequence with the domestic chicken (Gallus gallus) genome using the BLAST algorithm in Geneious version 7.0. If there were non-synonymous SNPs that resulted in different alleles (n = 20 individuals), we 10 genotyped the remaining Attwater s prairie-chickens used in this study (n = 125) In total, we genotyped Attwater s prairie-chickens at seven non-mhc genes, however, three of these (TLR4, TLR5 and AvBD11) had only two alleles and were included only in the 12 immune response and survival models where standardized heterozygosity and heterozygosity at individual loci were used as predictor variables (Tables S4 and S6). All immune gene sequences that were found in at least two individuals or two independent PCRs are 14 deposited in Genbank (accession nos. KX KX239750). 16

2 Table S1. Primers and PCR conditions used to amplify the seven single-locus immune genes used in the study (A) and the nine other immune genes not used (B) because they did not contain non-synonymous SNPs. Each immune gene was amplified in PCRs (final volume 20ul) consisting of 1x Green GoTaq Flexi Buffer (Promega), 1.5 mm of MgCl 2, 10% DMSO, 0.5 µm of each primer, 0.4 mm of dntps, 1.0 U of GoTaq DNA polymerase and approximately 50 ng of genomic DNA. PCRs were performed with an initial denaturation step at 94 C for 2 min followed by 35 cycles of 20 s at 94 C, 20 s at locus-specific annealing temperature (T A ) and extension time (T E ) at 72 C. 24 (A) T A T E Locus ( C) (sec) Primer names Primer sequences (5'-3') References Toll-like receptor 1B (TLR1B) avtlr1lbf TCCAGGYTWCAAAATCTGACAC 1 Alcaide and Edwards 2010 avtlr1lbr CGGCACRTCCARGTAGATG Toll-like receptor 4 (TLR4) avtlr4f GAGACCTTGATGCCCTGAG Alcaide and Edwards 2010 avtlr4r CCATCTTRAGCACTTGCAAAG Toll-like receptor 5 (TLR5) avtlr5f GTAATCTTACCAGCTTCCAAGG Alcaide and Edwards 2010 avtlr5r GCTGGAGTTCATCTTCATC Toll-like receptor (TLR15) TLR15F1 GCTGGGTGCTGTTTTGGAGT This study TLR15R1 GAGGTGCTGCAGAGAGATCG C-type lectin-like receptor Blec1F AGCTCCCACGTTTCTCATCC This study (Blec1) Blec1R CCAAGGCAAGGATGGGAACT Interleukin 4 (IL4) IL4ex1-2F ATGAGCTCCTCACTGCCCAC This study IL4ex1-2R CTGGCTTTCCTCTTACCTTA β-defensin 11 (AvBD11) AvBD11F1mat GACTGATCCTGCAGCACAAC 2 Hellgren and Sheldon 2011 AvBD11R1 AGGGCTCCCACACGTACC 1 Alcaide M, Edwards SV Molecular evolution of the toll-like receptor multigene family in birds. Molecular Biology and Evolution 28: Hellgren O, Sheldon BC Locus-specific protocol for nine different innate immune genes (antimicrobial peptides: β-defensins) across passerine birds species reveals within-species coding variation and a case of trans-species polymorphism. Molecular Ecology Resources 11:

3 30 (B) Locus T A ( C) T E (sec) Primer names Primer sequences (5'-3') References Toll-like receptor 3 (TLR3) pctlr3falt ACCTCTCACTGAGCCATGTG This study pctlr3r TGTTGTTATTGCTGATGTC Toll-like receptor 7 (TLR7) pctlr7f2 GAAGCTTATCCCCAGTCTTG This study pctlr7r3 AGACAGGTAGCAGAATTCGC Interleukin 1B (IL1B) IL1Bex5-6F CTTCGACATCTTCGACATCAAC 1 Downing, et al IL1Bex5-6R ATACGAGATGGAAACCAGCAAC Interleukin 6 (IL6.1) IL6ex2-3F CGAGAACAGCATGGAGATGC This study IL6ex2-3R GTGGCCGCCAGGTGCTTTGT Interleukin 6 (IL6.2) IL6ex4F GTGATAAATCCCGATGAAGT This study IL6ex4R TCAGGCACTGAAACTCCTGG Interleukin 10 (IL10) IL-10_F1 CCACTGCTGGGGTTCAGATT This study IL-10_R1 CTCTCTCCCCACCCACTGAA β-defensin 02 (AvBD02) AvBD2ex2F ATGAGGATTCTTTACCTGC This study AvBD2ex3R CATTTGCAGCAGGAACGGAA β-defensin 04 (AvBD04) pcavbd4ex3f TGTTCAGGCTTTCCCCGTCC This study pcavbd4ralt TCAGTTTAGCCATAGTCAAG Lysozyme (LYZ) LYSOex1_Falt GAGACAGGTGCAAGAGAGCC This study LYSOex1_Ralt GGGAAAGGAGCGTAAAGGGA 1 Downing T, Lynn DJ, Connell S, Lloyd AT, et al Contrasting evolution of diversity at two disease-associated chicken genes. Immunogenetics 61:

4 32 34 Table S2. Description of the sequences that did not contain non-synonymous SNPs, obtained from the nine single-locus immune genes in the initial screening of prairie-chickens (n = 20). Included are the number of birds (n), particular exons sequences and the corresponding exon length in base pairs (intron length in parentheses if amplified), synonymous (Syn) and intron SNPs. Immune gene n Exon(s) Sequence length Syn SNPs Toll-like receptor 3 (TLR3) Toll-like receptor 7 (TLR7) Interleukin 1B (IL1B) 20 4,5,6 422 (185) 3 4 Interleukin 6 (IL6.1) 4 2,3 161 (121) 0 0 Interleukin 6 (IL6.2) Interleukin 10 (IL10) 20 3,4 219 (509) 1 2 β-defensin 02 (AvBD02) 20 2,3 180 (231) 1 3 β-defensin 04 (AvBD04) Lysozyme (LYZ) (188) 2 3 Intron SNPs

5 Table S3. Models for post-release survival of Attwater s prairie-chickens using higher thresholds for the number of reads (compare with Table 2). Survival model A includes individuals (n = 93) with MHC class I genotypes based on 30 pyrosequencing reads, whereas survival model B includes individuals (n = 100) with class II genotypes based on 300 pyrosequencing. Predictor variables are specific alleles at immune genes, genome-wide heterozygosity, body mass (g), age class and sex. Family ID was also included in the models as a random factor. Presented are the parameter estimates (β), standard error (SE), hazard ratio (Exp(β)), P values from the Cox proportional mixed model and q values (the probability (P) values corrected for the false discovery rate). Predictors with P and q values 0.07 are in bold. Model A Model B β SE Exp(β) P q β SE Exp(β) P q Genome-wide het MHC class I Tycu-IA* Tycu-IA* Tycu-IA* MHC class II Tycu-BLB* < < Blec1 Blec1* Blec1* Blec1* < < TLR1B TLR1B* TLR1B* TLR1B* TLR1B* TLR15 TLR15* TLR15* TLR15* TLR15*

6 IL-4 IL4* IL4* IL4* Age class Body mass < Sex

7 Table S4. Post-release survival of Attwater s prairie-chickens (n = 116) in relation to standardized heterozygosity (A) and single-locus heterozygosity (B) at immune genes, genomewide heterozygosity, body mass (g), age class and sex. In both analyses, family group was used as a random factor. Presented are the parameter estimates (β), standard error (SE), hazard ratio (Exp(β)) and corresponding P and q (P values corrected for the false discovery rate) values from the Cox proportional mixed models. Predictors with P and q values < 0.05 are given in bold. (A) 62 Predictor β SE Exp(β) P q Genome-wide het Immune gene het Age class Body mass Sex (B) 64 Predictor β SE Exp(β) P q Genome-wide het MHC class I Blec TLR1B TLR TLR TLR IL AvBD Age class < Body mass Sex

8 Table S5. Immune response of Attwater s prairie-chickens in relation to specific alleles at immune genes, genome-wide heterozygosity, body mass (g), age class and sex. Family group was used as a random factor. Presented are the estimates (β), standard error (SE), P and q (P values corrected for the false discovery rate) values for each predictor variable in the models for Bacteria killing assay (n = 116) and Agglutination assay (n = 107). Note that no predictors had significant q values. Bacteria killing Agglutination Predictor β SE P q β SE P q Genome-wide het MHC class I Tycu-IA* Tycu-IA* Tycu-IA* MHC class II Tycu-BLB* Blec1 Blec1* Blec1* Blec1* TLR1B TLR1B* TLR1B* TLR1B* TLR1B* TLR15 TLR15* TLR15* TLR15* TLR15* IL-4 IL4* IL4* IL4* Age class Body mass Sex

9 Table S6. Immune response of pre-released Attwater s prairie-chickens in relation to standardized heterozygosity (A) and single-locus heterozygosity (B) at eight immune genes, genome-wide heterozygosity, body mass (g), age class and sex. In these models, family group was included as a random factor. Sample sizes (n), parameter estimates (β), standard error (SE), P and q (P values corrected for the false discovery rate) values are given from the generalized linear mixed models. Single-locus heterozygosity models (B) also include false discovery rate q values for each variable. Significant q values are given in bold. A) Immunoassay Genome-wide het Immune genes het Age class Body mass Sex Lysozyme β < n = 127 SE < P <0.01 q ** Haemolysis β n = 129 SE P q Bacteria-killing β < n = 128 SE < P q Agglutination β n = 118 SE P < q * * indicates that second year after hatch birds had increased agglutination activity; ** indicates that males had stronger lysozyme activity 86

10 2 Table 6 (continued) 4 B) Immunoassay Genomewide het MHCI Blec1 TLR1B TLR4 TLR5 TLR15 IL4 AvBD11 Age class Body mass Sex Lysozyme β < n = 114 SE < P <0.01 q * Haemolysis β n = 113 SE P q Bacteria-killing β < n = 115 SE P q Agglutination β n = 105 SE P q *indicates that males had stronger lysozyme activity 6 8

11 92 94 Figure S1. Plot of standardized heterozygosity at SNPs (genome-wide) and eight single-locus immune genes in Attwater s prairie-chickens released into the wild in 2011 and Genome-wide heterozygosity Immune gene heterozygosity

Effects of Drift, Selection and Gene Flow on Immune Genes in Prairie Grouse

Effects of Drift, Selection and Gene Flow on Immune Genes in Prairie Grouse University of Wisconsin Milwaukee UWM Digital Commons Theses and Dissertations May 2016 Effects of Drift, Selection and Gene Flow on Immune Genes in Prairie Grouse Zachary Bateson University of Wisconsin-Milwaukee

More information

Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.

Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon

More information

Studies on probiotics effects on innate immune functions in the gastrointestinal tract of broiler chicks (SUMMARY)

Studies on probiotics effects on innate immune functions in the gastrointestinal tract of broiler chicks (SUMMARY) Doctoral Thesis Studies on probiotics effects on innate immune functions in the gastrointestinal tract of broiler chicks (SUMMARY) ELSAYED SEDDEK IBRAHEM MOHAMMED Department of Bioresource Science Graduate

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Cheng MH, Fan U, Grewal N, et al. Acquired autoimmune polyglandular

More information

HOST-PARASITE INTERPLAY

HOST-PARASITE INTERPLAY HOST-PARASITE INTERPLAY Adriano Casulli EURLP, ISS (Rome, Italy) HOST-PARASITE INTERPLAY WP3 (parasite virulence vs human immunity) (Parasite) Task 3.1: Genotypic characterization Task 3.6: Transcriptome

More information

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:

More information

Discovery of a SNP in exon 2 the lipoprotein lipase gene and its association with intramuscular fat content in Chinese ring-necked pheasant

Discovery of a SNP in exon 2 the lipoprotein lipase gene and its association with intramuscular fat content in Chinese ring-necked pheasant Discovery of a SNP in exon 2 the lipoprotein lipase gene and its association with intramuscular fat content in Chinese ring-necked pheasant Qiong Wu Xiumei Xing Min Rong and Fuhe Yang Institute of Special

More information

SUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish

SUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish SUPPLEMENTARY INFOATION Divergent TLR7/9 signaling and type I interferon production distinguish pathogenic and non-pathogenic AIDS-virus infections Judith N. Mandl, Ashley P. Barry, Thomas H. Vanderford,

More information

Cytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M0042F): Acid-mediated intra-molecular cycloadditions enhance

Cytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M0042F): Acid-mediated intra-molecular cycloadditions enhance SUPPORTING INFORMATION Cytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M42F): Acid-mediated intra-molecular cycloadditions enhance chemical diversity Zhuo Shang, Ritesh Raju,

More information

New Enhancements: GWAS Workflows with SVS

New Enhancements: GWAS Workflows with SVS New Enhancements: GWAS Workflows with SVS August 9 th, 2017 Gabe Rudy VP Product & Engineering 20 most promising Biotech Technology Providers Top 10 Analytics Solution Providers Hype Cycle for Life sciences

More information

a) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.

a) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5. 1 2 APPENDIX Legends to figures 3 4 5 Figure A1: Distribution of perfect SSR along chromosome 1 of V. cholerae (El-Tor N191). a) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.

More information

To test the possible source of the HBV infection outside the study family, we searched the Genbank

To test the possible source of the HBV infection outside the study family, we searched the Genbank Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),

More information

Genetics and Genomics in Medicine Chapter 8 Questions

Genetics and Genomics in Medicine Chapter 8 Questions Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional

More information

Diversity and Frequencies of HLA Class I and Class II Genes of an East African Population

Diversity and Frequencies of HLA Class I and Class II Genes of an East African Population Open Journal of Genetics, 2014, 4, 99-124 Published Online April 2014 in SciRes. http://www.scirp.org/journal/ojgen http://dx.doi.org/10.4236/ojgen.2014.42013 Diversity and Frequencies of HLA Class I and

More information

2) Cases and controls were genotyped on different platforms. The comparability of the platforms should be discussed.

2) Cases and controls were genotyped on different platforms. The comparability of the platforms should be discussed. Reviewers' Comments: Reviewer #1 (Remarks to the Author) The manuscript titled 'Association of variations in HLA-class II and other loci with susceptibility to lung adenocarcinoma with EGFR mutation' evaluated

More information

The Human Major Histocompatibility Complex

The Human Major Histocompatibility Complex The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure

More information

Parentage and relatedness determination in farmed Atlantic salmon. Ashie T. Norris*, Daniel G. Bradley and Edward P. Cunningham.

Parentage and relatedness determination in farmed Atlantic salmon. Ashie T. Norris*, Daniel G. Bradley and Edward P. Cunningham. Parentage and relatedness determination in farmed Atlantic salmon (Salmo salar) using microsatellite markers Ashie T. Norris*, Daniel G. Bradley and Edward P. Cunningham. Department of Genetics, Trinity

More information

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits? corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Validation of the MIA FORA NGS FLEX Assay Using Buccal Swabs as the Sample Source

Validation of the MIA FORA NGS FLEX Assay Using Buccal Swabs as the Sample Source S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. Introduction

More information

Drug Metabolism Disposition

Drug Metabolism Disposition Drug Metabolism Disposition The CYP2C19 intron 2 branch point SNP is the ancestral polymorphism contributing to the poor metabolizer phenotype in livers with CYP2C19*35 and CYP2C19*2 alleles Amarjit S.

More information

Multi-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis

Multi-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis JCM Accepts, published online ahead of print on 30 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.00678-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Multi-clonal origin

More information

Isolation and identification of Mycoplasma gallisepticum in chickensbn from industrial farms in Kerman province

Isolation and identification of Mycoplasma gallisepticum in chickensbn from industrial farms in Kerman province Available online at http://www.ijabbr.com International journal of Advanced Biological and Biomedical Research Volume 2, Issue 1, 2014: 100-104 Isolation and identification of Mycoplasma gallisepticum

More information

Single SNP/Gene Analysis. Typical Results of GWAS Analysis (Single SNP Approach) Typical Results of GWAS Analysis (Single SNP Approach)

Single SNP/Gene Analysis. Typical Results of GWAS Analysis (Single SNP Approach) Typical Results of GWAS Analysis (Single SNP Approach) High-Throughput Sequencing Course Gene-Set Analysis Biostatistics and Bioinformatics Summer 28 Section Introduction What is Gene Set Analysis? Many names for gene set analysis: Pathway analysis Gene set

More information

University of Groningen. Metabolic risk in people with psychotic disorders Bruins, Jojanneke

University of Groningen. Metabolic risk in people with psychotic disorders Bruins, Jojanneke University of Groningen Metabolic risk in people with psychotic disorders Bruins, Jojanneke IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from

More information

Award Number: W81XWH TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer

Award Number: W81XWH TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. Rajvir Dahiya, Ph.D. CONTRACTING ORGANIZATION:

More information

Generating Mouse Models of Pancreatic Cancer

Generating Mouse Models of Pancreatic Cancer Generating Mouse Models of Pancreatic Cancer Aom Isbell http://www2.massgeneral.org/cancerresourceroom/types/gi/index.asp Spring/Summer 1, 2012 Alexandros Tzatsos, MD PhD Bardeesy Lab: Goals and Objectives

More information

Host-parasite interactions: Evolutionary genetics of the House Finch- Mycoplasma epizootic

Host-parasite interactions: Evolutionary genetics of the House Finch- Mycoplasma epizootic Host-parasite interactions: Evolutionary genetics of the House Finch- Mycoplasma epizootic Scott V. Edwards Department of Organismic and Evolutionary Biology Harvard University Cambridge, MA USA http://www.oeb.harvard.edu/faculty/edwards

More information

Genetics of Pediatric Inflammatory Bowel Disease

Genetics of Pediatric Inflammatory Bowel Disease Genetics of Pediatric Inflammatory Bowel Disease Judith Kelsen MD Assistant Professor of Pediatrics Division of Gastroenterology, Hepatology, and Nutrition IBD Education Day 2/9/2014 Objectives Brief overview

More information

Supplementary Information

Supplementary Information Supplementary Information Detection and differential diagnosis of colon cancer by a cumulative analysis of promoter methylation Qiong Yang 1,3*, Ying Dong 2,3, Wei Wu 1, Chunlei Zhu 1, Hui Chong 1, Jiangyang

More information

Introduction to LOH and Allele Specific Copy Number User Forum

Introduction to LOH and Allele Specific Copy Number User Forum Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.

More information

Supplemental Information For: The genetics of splicing in neuroblastoma

Supplemental Information For: The genetics of splicing in neuroblastoma Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,

More information

TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer

TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. CONTRACTING ORGANIZATION: Northern California

More information

CS2220 Introduction to Computational Biology

CS2220 Introduction to Computational Biology CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS

More information

SINGLE CHOICE. 5. The gamma invariant chain binds to this molecule during its intracytoplasmic transport. A TCR B BCR C MHC II D MHC I E FcγR

SINGLE CHOICE. 5. The gamma invariant chain binds to this molecule during its intracytoplasmic transport. A TCR B BCR C MHC II D MHC I E FcγR A Name: Group: SINGLE CHOICE 1. Which is the most important ligand of TLR5? A endospore B flagellin C polysaccharide capsule D DNA E pilus 2. The antibody-binding site is formed primarily by... A the constant

More information

Rare Variant Burden Tests. Biostatistics 666

Rare Variant Burden Tests. Biostatistics 666 Rare Variant Burden Tests Biostatistics 666 Last Lecture Analysis of Short Read Sequence Data Low pass sequencing approaches Modeling haplotype sharing between individuals allows accurate variant calls

More information

International Journal of Science, Environment and Technology, Vol. 6, No 5, 2017,

International Journal of Science, Environment and Technology, Vol. 6, No 5, 2017, International Journal of Science, Environment and Technology, Vol. 6, No 5, 2017, 2792 2796 ISSN 2278-3687 (O) 2277-663X (P) POLYMORPHISM IN EXON 9 OF HEAT SHOCK TRANSCRIPTION FACTOR 4 (HSF4) GENE IN EXOTIC

More information

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Missense damaging predictions as a function of allele frequency

Nature Neuroscience: doi: /nn Supplementary Figure 1. Missense damaging predictions as a function of allele frequency Supplementary Figure 1 Missense damaging predictions as a function of allele frequency Percentage of missense variants classified as damaging by eight different classifiers and a classifier consisting

More information

CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.

CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder

More information

Whole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis

Whole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis HMG Advance Access published December 21, 2012 Human Molecular Genetics, 2012 1 13 doi:10.1093/hmg/dds512 Whole-genome detection of disease-associated deletions or excess homozygosity in a case control

More information

Supplementary Note. Nature Genetics: doi: /ng.2928

Supplementary Note. Nature Genetics: doi: /ng.2928 Supplementary Note Loss of heterozygosity analysis (LOH). We used VCFtools v0.1.11 to extract only singlenucleotide variants with minimum depth of 15X and minimum mapping quality of 20 to create a ped

More information

Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage

Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage T. Cui and M.S. Jiang College of Physical Education, Shandong University of Finance and Economics, Ji nan, Shandong,

More information

Supplementary Information

Supplementary Information Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,

More information

PREVENTION OF HAEMOGLOBINOPATHIES: New methodologies and procedures Non-invasive Prenatal Diagnosis

PREVENTION OF HAEMOGLOBINOPATHIES: New methodologies and procedures Non-invasive Prenatal Diagnosis PREVENTION OF HAEMOGLOBINOPATHIES: New methodologies and procedures Non-invasive Prenatal Diagnosis Marina Kleanthous Cyprus School of Molecular Medicine The Cyprus Institute of Neurology and Genetics

More information

immunity defenses invertebrates vertebrates chapter 48 Animal defenses --

immunity defenses invertebrates vertebrates chapter 48 Animal defenses -- defenses Animal defenses -- immunity chapter 48 invertebrates coelomocytes, amoebocytes, hemocytes sponges, cnidarians, etc. annelids basophilic amoebocytes, acidophilic granulocytes arthropod immune systems

More information

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl) a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6

More information

Sebastian Jaenicke. trnascan-se. Improved detection of trna genes in genomic sequences

Sebastian Jaenicke. trnascan-se. Improved detection of trna genes in genomic sequences Sebastian Jaenicke trnascan-se Improved detection of trna genes in genomic sequences trnascan-se Improved detection of trna genes in genomic sequences 1/15 Overview 1. trnas 2. Existing approaches 3. trnascan-se

More information

CHAPTER 18: Immune System

CHAPTER 18: Immune System CHAPTER 18: Immune System 1. What are four characteristics of the specific immune system? a. b. c. d. 2. List the two main types of defense mechanisms and briefly describe features of each. 3. Give examples

More information

Immunology 2011 Lecture 11 Innate Immunity & Genetics of Inbreeding. 6 October

Immunology 2011 Lecture 11 Innate Immunity & Genetics of Inbreeding. 6 October Immunology 2011 Lecture 11 Innate Immunity & Genetics of Inbreeding 6 October HANDOUT #6, Problem Set 3 TODAY Innate Immunity no core notes Genetics of Inbreeding - Appendix 10 MHC & Transplantation, Chapter

More information

Genetic Approaches to Alcoholism, Alcohol Abuse Susceptibility, and Therapeutic Response. Ray White Verona March

Genetic Approaches to Alcoholism, Alcohol Abuse Susceptibility, and Therapeutic Response. Ray White Verona March Genetic Approaches to Alcoholism, Alcohol Abuse Susceptibility, and Therapeutic Response Ray White Verona March 18. 2008 Craig Venter Genome 2,810,000,000 bases, 7.5-fold coverage 3,213,401 SNPs 85% in

More information

ASSESSMENT OF THE RISK FOR TYPE 1 DIABETES MELLITUS CONFERRED BY HLA CLASS II GENES. Irina Durbală

ASSESSMENT OF THE RISK FOR TYPE 1 DIABETES MELLITUS CONFERRED BY HLA CLASS II GENES. Irina Durbală ASSESSMENT OF THE RISK FOR TYPE 1 DIABETES MELLITUS CONFERRED BY HLA CLASS II GENES Summary Irina Durbală CELL AND MOLECULAR BIOLOGY DEPARTMENT FACULTY OF MEDICINE, OVIDIUS UNIVERSITY CONSTANŢA Class II

More information

Lack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population

Lack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population Lack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population J. Zhu 1 *, F. He 2 *, D.D. Zhang 2 *, J.Y. Yang 2, J. Cheng 1, R. Wu 1, B. Gong 2, X.Q. Liu

More information

INVESTIGATION THE PREVALENCE OF MUTATIONS IVS 10 AND R158Q IN A NUMBER OF IRANIAN PATIENTS WITH PKU

INVESTIGATION THE PREVALENCE OF MUTATIONS IVS 10 AND R158Q IN A NUMBER OF IRANIAN PATIENTS WITH PKU : 293-297 ISSN: 2277 4998 INVESTIGATION THE PREVALENCE OF MUTATIONS IVS 10 AND R158Q IN A NUMBER OF IRANIAN PATIENTS WITH PKU SHIRIN JAHANBAZI, FATEMEHKESHAVARZI* Department of Biology, Sanandaj Branch,

More information

Two hierarchies. Genes Chromosomes Organisms Demes Populations Species Clades

Two hierarchies. Genes Chromosomes Organisms Demes Populations Species Clades Evolution cont d Two hierarchies Genes Chromosomes Organisms Demes Populations Species Clades Molecules Cells Organisms Populations Communities Ecosystems Regional Biotas At its simplest level Evolution

More information

Dan Koller, Ph.D. Medical and Molecular Genetics

Dan Koller, Ph.D. Medical and Molecular Genetics Design of Genetic Studies Dan Koller, Ph.D. Research Assistant Professor Medical and Molecular Genetics Genetics and Medicine Over the past decade, advances from genetics have permeated medicine Identification

More information

CHAPTER IV RESULTS Microcephaly General description

CHAPTER IV RESULTS Microcephaly General description 47 CHAPTER IV RESULTS 4.1. Microcephaly 4.1.1. General description This study found that from a previous study of 527 individuals with MR, 48 (23 female and 25 male) unrelated individuals were identified

More information

Figure S1. Schematic presentation of genomic replication of idsiv after transfection and infection. After transfection of idsiv plasmid DNA into 293T

Figure S1. Schematic presentation of genomic replication of idsiv after transfection and infection. After transfection of idsiv plasmid DNA into 293T Figure S1. Schematic presentation of genomic replication of idsiv after transfection and infection. After transfection of idsiv plasmid DNA into 293T cells, the RNA genomes with all modifications are generated

More information

In search for hypoallergenic trees: Screening for genetic diversity in birch pollen allergens, a multigene family of Bet v 1 (PR 10) proteins MJM

In search for hypoallergenic trees: Screening for genetic diversity in birch pollen allergens, a multigene family of Bet v 1 (PR 10) proteins MJM In search for hypoallergenic trees: Screening for genetic diversity in birch pollen allergens, a multigene family of Bet v 1 (PR 10) proteins MJM Smulders, MF Schenk, LJWJ Gilissen Hay fever Hay fever

More information

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized

More information

Role of inflammatory parameters in the susceptibility of cerebral thrombosis

Role of inflammatory parameters in the susceptibility of cerebral thrombosis Role of inflammatory parameters in the susceptibility of cerebral thrombosis X.F. Qi 1, T.J. Feng 2, P. Yang 1, H.Y. Feng 3, P. Zhang 2, L.Y. Kong 1, D.L. Liang 1, P.F. Li 4, W. Na 5, Y.W. Li 5 and Y.

More information

New polymorphism of the influenza virus resistance Mx1 gene in Iberian domestic pigs RF Godino1, AI Fernández2 Abstract Keywords:

New polymorphism of the influenza virus resistance Mx1 gene in Iberian domestic pigs RF Godino1, AI Fernández2  Abstract Keywords: Postdoc Journal Vol. 4, No. 9, September 2016 Journal of Postdoctoral Research www.postdocjournal.com New polymorphism of the influenza virus resistance Mx1 gene in Iberian domestic pigs RF Godino 1, AI

More information

Supplementary webappendix

Supplementary webappendix Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kratz JR, He J, Van Den Eeden SK, et

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

1. Overview of Adaptive Immunity

1. Overview of Adaptive Immunity Chapter 17A: Adaptive Immunity Part I 1. Overview of Adaptive Immunity 2. T and B Cell Production 3. Antigens & Antigen Presentation 4. Helper T cells 1. Overview of Adaptive Immunity The Nature of Adaptive

More information

Genetics of COPD Prof. Ian P Hall

Genetics of COPD Prof. Ian P Hall Genetics of COPD 1 Prof. Ian P. Hall Dean, Faculty of Medicine and Health Sciences The University of Nottingham Medical School Ian.Hall@nottingham.ac.uk Chronic obstructive pulmonary disease (COPD) 900,000

More information

Examples of questions for Cellular Immunology/Cellular Biology and Immunology

Examples of questions for Cellular Immunology/Cellular Biology and Immunology Examples of questions for Cellular Immunology/Cellular Biology and Immunology Each student gets a set of 6 questions, so that each set contains different types of questions and that the set of questions

More information

MRC-Holland MLPA. Description version 29;

MRC-Holland MLPA. Description version 29; SALSA MLPA KIT P003-B1 MLH1/MSH2 Lot 1209, 0109. As compared to the previous lots 0307 and 1006, one MLH1 probe (exon 19) and four MSH2 probes have been replaced. In addition, one extra MSH2 exon 1 probe,

More information

The Innate Immune Response

The Innate Immune Response The Innate Immune Response FUNCTIONS OF THE IMMUNE SYSTEM: Recognize, destroy and clear a diversity of pathogens. Initiate tissue and wound healing processes. Recognize and clear damaged self components.

More information

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,

More information

Significance of the MHC

Significance of the MHC CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Detection and significance of PD-1.3 SNP (rs ) and IL28B SNP (rs ) in patients with current or past hepatitis B virus (HBV) infection

Detection and significance of PD-1.3 SNP (rs ) and IL28B SNP (rs ) in patients with current or past hepatitis B virus (HBV) infection Detection and significance of PD-1.3 SNP (rs11568821) and IL28B SNP (rs12979860) in patients with current or past hepatitis B virus (HBV) infection Asterios Saitis 1, Nikolaos K. Gatselis 1, Kalliopi Azariadi

More information

SALSA MLPA KIT P050-B2 CAH

SALSA MLPA KIT P050-B2 CAH SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to

More information

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:

More information

JCM Accepts, published online ahead of print on 27 September 2006 J. Clin. Microbiol. doi: /jcm

JCM Accepts, published online ahead of print on 27 September 2006 J. Clin. Microbiol. doi: /jcm JCM Accepts, published online ahead of print on 27 September 2006 J. Clin. Microbiol. doi:10.1128/jcm.01786-06 Copyright 2006, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

IVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois

IVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois FERTILITY AND STERILITY VOL. 80, NO. 4, OCTOBER 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Inc. Printed on acid-free paper in U.S.A. CASE REPORTS Preimplantation

More information

RNA based high-resolution HLA sequencing based typing

RNA based high-resolution HLA sequencing based typing Chapter 2 RNA based high-resolution HLA sequencing based typing Judith Reinders, Anna Houben, Alain van Mill, Erik Rozemuller, Jan van den Tweel and Marcel Tilanus Department of Pathology, University Medical

More information

Computational Systems Biology: Biology X

Computational Systems Biology: Biology X Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH

More information

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T

More information

WDR62 is associated with the spindle pole and mutated in human microcephaly

WDR62 is associated with the spindle pole and mutated in human microcephaly WDR62 is associated with the spindle pole and mutated in human microcephaly Adeline K. Nicholas, Maryam Khurshid, Julie Désir, Ofélia P. Carvalho, James J. Cox, Gemma Thornton, Rizwana Kausar, Muhammad

More information

Genome - Wide Linkage Mapping

Genome - Wide Linkage Mapping Biological Sciences Initiative HHMI Genome - Wide Linkage Mapping Introduction This activity is based on the work of Dr. Christine Seidman et al that was published in Circulation, 1998, vol 97, pgs 2043-2048.

More information

Supplementary Figure 1. Estimation of tumour content

Supplementary Figure 1. Estimation of tumour content Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent

More information

Y. Zhan, C. Li, Q. Gao, J. Chen, S. Yu and S.G. Liu. Corresponding author: Y. Zhan

Y. Zhan, C. Li, Q. Gao, J. Chen, S. Yu and S.G. Liu. Corresponding author: Y. Zhan Association between the rs4753426 polymorphism in MTNR1B with fasting plasma glucose level and pancreatic β-cell function in gestational diabetes mellitus Y. Zhan, C. Li, Q. Gao, J. Chen, S. Yu and S.G.

More information

MRP1 polymorphisms (T2684C, C2007T, C2012T, and C2665T) are not associated with multidrug resistance in leukemic patients

MRP1 polymorphisms (T2684C, C2007T, C2012T, and C2665T) are not associated with multidrug resistance in leukemic patients MRP1 polymorphisms (T2684C, C2007T, C2012T, and C2665T) are not associated with multidrug resistance in leukemic patients F. Mahjoubi, S. Akbari, M. Montazeri and F. Moshyri Clinical Genetics Department,

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 5 microns C7 B6 unclassified H19 C7 signal H19 guide signal H19 B6 signal C7 SNP spots H19 RNA spots B6 SNP spots colocalization H19 RNA classification Supplementary Figure 1. Allele-specific

More information

Sex is determined by genes on sex chromosomes

Sex is determined by genes on sex chromosomes BREVIA Temperature Sex Reversal Implies Sex Gene Dosage in a Reptile Alexander E. Quinn, 1 * Arthur Georges, 1 Stephen D. Sarre, 1 Fiorenzo Guarino, 1 Tariq Ezaz, 2 Jennifer A. Marshall Graves 2 Sex is

More information

HLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012.

HLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012. www.ebmt.org HLA and more Ilias I.N. Doxiadis Geneva 03/04/2012 HLA and more HLA and more / Doxiadis 2 Topic of the day Compatibility testing is a type of testing used to ensure compatibility of the system/application/website

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal

Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,

More information

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary

More information

Supplementary information. Supplementary figure 1. Flow chart of study design

Supplementary information. Supplementary figure 1. Flow chart of study design Supplementary information Supplementary figure 1. Flow chart of study design Supplementary Figure 2. Quantile-quantile plot of stage 1 results QQ plot of the observed -log10 P-values (y axis) versus the

More information

Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,

Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng, The American Journal of Human Genetics, Volume 91 Supplemental Data A Functional Copy-Number Variation in MAPKAPK2 Predicts Risk and Survival of Lung Cancer Bin Liu, Lei Yang, Binfang Huang, Mei Cheng,

More information

Supplementary Document

Supplementary Document Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.

More information

Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population

Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population Int J Clin Exp Med 2014;7(12):5832-5836 www.ijcem.com /ISSN:1940-5901/IJCEM0002117 Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk

More information

TNF-α antibodies in immune-mediated inflammatory disorders

TNF-α antibodies in immune-mediated inflammatory disorders 1 TNF-α antibodies in immune-mediated inflammatory disorders Potential side effects: allergic reactions, opportunistic infections joint lesions and psoriasiform and eczematiform skin lesions Seemingly

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig 1. Comparison of sub-samples on the first two principal components of genetic variation. TheBritishsampleisplottedwithredpoints.The sub-samples of the diverse sample

More information